Sperm-specific AKAP protein genes and uses

Abstract

This invention provides isolated nucleic acid encoding sperm-specific protein kinase A anchoring proteins from mammalian species, recombinant expression constructs encoding said mammalian sperm-specific protein kinase A anchoring proteins, cells transformed with said constructs, and homogenous preparations of these proteins prepared using recombinant genetic techniques. The invention also provides analytic tools such as polyclonal antisera and monoclonal antibodies specific for said sperm-specific protein kinase A anchoring proteins of the invention. The invention also provides methods for isolating nucleic acid encoding mammalian sperm-specific protein kinase A anchoring proteins and recombinant genetic methods for producing said mammalian sperm-specific protein kinase A anchoring proteins of the invention. The invention particularly provides high throughput screening methods for screening compounds that can disrupt binding between protein kinase A and the sperm-specific protein kinase A anchoring protein and methods for determining and producing compounds, particularly antisense oligonucleotides, for inhibiting or preventing expression of sperm-specific protein kinase A anchoring protein in sperm, spermatids, or progenitor cells thereof. These methods are useful for development of effective, male-specific contraceptives, which are also provided by the invention.

Description

BACKGROUND OF THE INVENTION

[0002] 1. Field of the Invention

[0003] This invention relates to sperm-specific protein kinase A anchoring proteins from mammalian species and the genes encoding such proteins. Specifically, the invention relates to the isolation of nucleic acid encoding sperm-specific protein kinase A anchoring proteins from mammalian species, and the production of homogenous preparations of such proteins using recombinant genetic techniques. The invention also relates to the preparation of analytic tools such as polyclonal antisera and monoclonal antibodies specific for said sperm-specific protein kinase A anchoring proteins. Importantly, the invention is related to high throughput screening of compounds that can disrupt binding between protein kinase A and the sperm-specific protein kinase A anchoring proteins of the invention, or that inhibit or prevent expression of the sperm-specific protein kinase A anchoring proteins in sperm, spermatids or progenitor cells thereof, for development of effective contraceptives, and provides antisense oligonucleotides, agents and compounds detected using the screening methods of the invention as reversible, male contraceptive agents.

[0004] 2. Background of the Invention

[0005] Signal transduction enzymes such as protein kinases and phosphatases play pivotal roles in mediating cellular responses to a wide variety of stimuli. Cyclic AMP (cAMP) mediates the motility of sperm and a variety of other ciliated cells (Satir, 1985, Molec. Cell Biol. 4: 1-46; Tash, 1989, Cell Motil. Cytoskel. 14: 332-339; Bedford and Hoskins 1990, in Marchall's Physiology of Reproduction, (Lamming, ed.), Churchill Livingstone: New York, p. 379). Increases in the level of this nucleotide are associated with development of sperm motility in the epididymis (Bedford and Hoskins, ibid.; Hoskins et al., 1974, J. Reprod. Fertil. 37: 131-133). Cell-permeant cAMP analogs, cAMP phosphodiesterase inhibitors, and adenylyl cyclase activators all stimulate motility of sperm from several species (Garbers et al., 1972, Biol. Reprod. 7: 132; Garbers et al., 1978, Adv. Cyclic Nucleotide Res. 9: 583-595). Flagellar activity in sperm has been shown to be regulated by cAMP (Tash, ibid.; Garbers and Kopf, 1980, in Advances in Cyclic Nucleotide Research, (Greengard and Robison, eds.), Vol. 13, Raven Press: New York, pp. 252-306; Lindemann and Kanous, 1989, Arch. Androl. 23: 1-22; Tash & Means, 1988, Prog. Clin. Biol. Res. 267: 335-355).

[0006] The cAMP-dependent protein kinase (PKA) is a ubiquitous, multifunctional enzyme involved in the regulation of a diverse array of cellular events. PKA holoenzyme consists of four subunits, two catalytic (C) and two regulatory (R). In the absence of cAMP, the regulatory subunits keep the catalytic subunits inactive. Cyclic AMP binding to the regulatory subunit promotes dissociation from and activation of the catalytic subunits. There are two R subunit classes, RI and RII, which form the type I and type II holoenzymes, respectively. Type II PKA is present in all cells, whereas the tissue distribution of type I PKA is more restricted. Subcellular localization of PKA is directed through the regulatory (R) subunit. Recent studies have shown that PKA is anchored at specific subcellular sites through the interaction of its regulatory subunit with A-kinase anchoring proteins (AKAPs) (Carr et al., 1991, J. Biol. Chem. 266: 14188-14192; Rubin, 1994, Biochim. Biophys. Acta 1224: 467-479; Dell'Aqua & Scott, 1997, J. Biol. Chem. 272: 12881-4; Faux et al., 1996, Cell 85: 9-12; Pawson et al., 1997, Science 278: 2075-2080).

[0007] A number of AKAPs have been cloned and biochemically characterized (Dell'Aqua & Scott, ibid.). All AKAPs contain a common structural motif that binds with nanomolar (nM) affinity to the regulatory subunit of PKA (Carr et al., 1991, ibid.; Carr et al., 1992, J. Biol. Chem. 267: 13376-13382). Certain of the anchoring proteins that are capable of binding both RI Huang et al., 1997, Proc. Natl. Acad. Sci. USA 94: 11184-11189). Since PKA has broad substrate specificity, presumably one of the primary functions of PKA anchoring is to spatially restrict its action, thus providing specificity of function.

[0008] Because cAMP analogs and agents that increase intracellular cAMP are potent stimulators of sperm motility, the role of PKA and AKAP subcellular localization of PKA was expected by the inventors to be important for understanding and modulating sperm motility. The highly polarized sperm cell is particularly well suited for investigating the structure and function of PKA anchoring proteins. Differentiated sperm have a number of district subcellular structures. The microtubular apparatus in mammalian sperm is surrounded by district cellular organelles such as the outer dense fibers and fibrous sheath. The cytoplasmic volume of the sperm cell is considerably lower than that of most somatic cells. Free diffusion of plasma membrane proteins is apparently restricted to three distinct domains, defined by the sperm head, midpiece and tail regions (Friend, 1982, J. Cell Biol. 93: 243-249). This unique compartmentalization of the sperm cell made it an excellent model system to study the role of targeting and anchoring of PKA and other enzymes in regulating cell function.

[0009] Regulation of sperm motility also provides an important avenue for developing a new generation of contraceptive agents. In the past, contraception has relied on barrier methods (such as condoms) and in regulating a female's capacity to be impregnated or the fertilized zygote to attach to the uterus (examples include the intrauterine device and “the Pill”). Regulation of cAMP-stimulated sperm motility by targeting the PKA/AKAP interaction provides for the first time a male-specific route of contraceptive intervention.

[0010] There thus remains a need in this art for specific, effective, reversible, reliable male contraceptive with minimal physiological or systemic side effects. As disclosed herein, one particular PKA anchoring protein, termed AKAP110, is uniquely expressed in sperm, making it possible that therapies which interfere with or prevent expression of this protein could be used as a contraceptive. One example of such an approach is to use antisense oligonucleotides to inhibit or prevent AKAP110 gene expression in developing sperm or spermatids, which have been shown to express this protein. Antisense-based therapeutics are already being used in humans, and it is likely that systemic administration of antisense reagents will be achieved in the near future. Antisense approaches to male contraception have clear advantages over other methods, such as hormonal or immunological methods, such as being completely reversible and in having a likelihood of fewer and less physiologically significant side effects. Other examples of novel contraceptive approaches is the use of peptides or small molecules that directly interfere with the AKAP110:PKA binding interaction in the absence of threshold levels of cAMP.

SUMMARY OF THE INVENTION

[0011] The present invention relates to the cloning, expression and functional characterization of mammalian sperm-specific protein kinase A anchoring protein having an apparent molecular weight of about 110 kildaltons, termed “AKAP110” herein.

[0012] This invention specifically provides isolated nucleic acid encoding sperm-specific protein kinase A anchoring protein from human, bovine and murine male germ cells, recombinant expression constructs comprising said nucleic acid, and cells transformed with such recombinant expression constructs and producing the sperm-specific protein kinase A anchoring protein thereby. The invention also provides homogenous preparations of sperm-specific protein kinase A anchoring protein, and antibodies raised against and that immunologically recognize said protein. The invention also provides methods for producing said homogeneous preparation of the sperm-specific protein kinase A anchoring proteins of the invention using said cells transformed with the recombinant expression constructs of the invention. The invention advantageously provides methods for screening compounds for the capacity to disrupt binding between the sperm-specific protein kinase A anchoring protein of the invention and protein kinase A regulatory subunits, and methods for disrupting, inhibiting or preventing expression of this protein in developing sperm cells, spermatids or progenitor cells thereof, in order to provide male-specific contraception agents. Methods of male contraception, most preferably and advantageously readily reversible methods of male contraception, and methods for the prevention of pregnancy are provided by the use of compounds that disrupt, inhibit or prevent expression of the AKAP110 protein of the invention, whereby such compounds are detected or characterized using the methods of the invention. Advantageously, the invention also provides agents, preferably pharmaceutical agents, for effecting male contraception, most preferably comprising antisense oligonucleotides for inhibiting or preventing expression of AKAP110 in sperm cells, spermatids and progenitors thereof, and peptides and small molecules for disrupting AKAP110/PKA RII binding in said cells.

[0013] Specific preferred embodiments of the present invention will become evident from the following more detailed description of certain preferred embodiments and the claims.

DESCRIPTION OF THE DRAWINGS

[0014] FIGS. 1A and 1B illustrate one- (FIG. 1A) and two-dimensional (FIG. 1B) gel electrophoretic analyses of extracted bovine sperm proteins. Numbering in the left-hand side of each Figure are molecular weight markers (in kilodaltons). Electrophoresis in each of the Figures in the vertical direction is SDS/PAGE; electrophoresis in the horizontal direction in FIG. 1B is isoelectric focusing, performed between pH 10 and pH 3 (arrayed left-to-right in the Figure). Paired lanes in FIG. 1A are labeled “S” for supernatant and “P” for pellet, as described in Example 1. The arrow in FIG. 1B denotes the position of the protein band excised for microsequencing analysis as described in Example 1.

[0015] FIG. 2 is a sequence alignment of human, bovine and murine AKAP110 amino acid sequences. Shaded areas indicate sequence identity between at least two of the three species.

[0016] FIGS. 3A, 3B and 3C depict RII overlay (FIG. 3A) and Western blot assays (FIGS. 3B and 3C). Numbering in the left-hand side of FIG. 3A represents molecular weight markers (in kilodaltons).

[0017] FIGS. 4A and 4B depict RII overlay (FIG. 4A) and Western blot assays (FIG. 4B) of identical blots containing full-length (1-864) and truncated fragments (1-470; 471-864; 1-350; 1-164; and 1-117) of murine AKAP110 protein expressed and isolated from E. coli.

[0018] FIG. 4C is a schematic diagram of RII binding to AKAP110 and fragments thereof.

[0019] FIG. 4D depicts Western blot analysis performed in the absence (left-hand lane) or presence (right-hand lane) of the peptide used to prepare the antibody with which the Western blots were probed. Numbering in the left-hand side of the Figure represents molecular weight markers (in kilodaltons).

[0020] FIG. 5A is a amino acid sequence alignment of RII binding domains of a variety of AKAP proteins: AKAP110 (Seq. ID No. 19); AKAP82 (Seq. ID No. 20); S-AKAP84 (Seq. ID No. 21); TAKAP80 (Seq. ID No. 22); MAP2 (Seq. ID No. 23); Ht31 (Seq. ID No. 24); AKAP150 (Seq. ID No. 25); AKAP75 (Seq. ID No. 26); AKAP92 (Seq. ID No. 27); AKAP120 (Seq. ID No. 28); AKAP220 (Seq. ID No. 29); Gravin (Seq. ID No. 30); AKAP-KL (Seq. ID No. 31); AKAP18 (Seq. ID No. 32) and Ezrin (Seq. ID No. 33). Shaded residues are conserved in a majority of the 15 aligned sequences.

[0021] FIGS. 5B and 5C are schematic diagrams of helical wheel representations of the AKAP consensus sequence of the RII binding domain (FIG. 5B) and the AKAP110 RII binding domain (FIG. 5C).

[0022] FIG. 6 is a schematic alignment of AKAP110 and AKAP82 amino acid sequences. The boxed regions represent portions of the amino acid sequence of at least 20 amino acids having greater than 50% sequence homology.

[0023] FIG. 7 is an autoradiogram of Northern blot hybridization of mRNAs from various mouse tissues probed with an AKAP110 cDNA. Numbering in the left-hand side of the Figure represents molecular weight markers (in kilobases).

[0024] FIGS. 8A through 8C show the results of in situ hybridization analyses performed as described in Example 6. FIG. 8A shows hybridization to frozen cryosection of mouse testis. “L” indicates the seminiferous tubule lumen; “RS” represents round spermatids of the seminiferous epithelium. Dotted lines represent boundaries between adjacent seminiferous tubules. FIG. 8B represents a higher-magnification view of a single seminiferous tubule hybridized with antisense AKAP110 probe. The bracketed areas represent the basal region of the seminiferous epithelium, containing spermatogonia, spermatocytes and Sertoli cells. “LS” represents late spermatids adjacent to the tubule lumen. Hybridization is detected only in the RS region of this section. FIG. 8C is in situ hybridization performed using a sense AKAP110 probe; no hybridization was detected.

[0025] FIGS. 9A and 9B are matched phase-contrast (FIG. 9A) and immunofluorescence (FIG. 9B) photomicrographs of caudal epididymal spermatozoa. The bar at the upper left-hand corner labeled “A” equals 15 &mgr;M. “F” indicates sperm flagella, “H” indicates sperm heads, “AC” indicates acrosomal segments, and “AC*” represents acrosomal caps released from the sperm heads. Inserts labeled “B” and “B′” are phase-contrast and immunofluorescence photomicrographs incubated with preimmune serum.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0026] The terms “mammalian sperm-specific protein kinase A anchoring protein having an apparent molecular weight of about 110 kildaltons” and “AKAP110” as used herein are intended to encompass proteins having the biological activity of any of the sperm-specific protein kinase A anchoring proteins disclosed herein or PKA-RII subunit-binding fragments thereof. This definition is also intended to encompass natural allelic variations in the sperm-specific protein kinase A anchoring protein-encoding sequences of the invention. Cloned nucleic acid provided by the present invention encodes sperm-specific protein kinase A anchoring proteins of any species of origin, including, for example, mouse, cow, horse, pig, rat, rabbit, dog, cat, and human, but preferably the nucleic acid provided by the invention encodes sperm-specific protein kinase A anchoring protein including the murine (SEQ ID Nos.: 11 and 12), bovine (SEQ ID Nos.: 13 and 14), and human (SEQ ID Nos.: 15 and 16) homologues. In addition, sequence alignment of the nucleic acid sequences of the murine (SEQ ID No. 11), bovine (SEQ ID No. 13) and human (SEQ ID No. 15) sequences provides one of ordinary skill in the art with sufficient information to be able to identify a nucleic acid probe wherein the sequence (or the amino acid sequence encoded therein) between the three mammalian species are identical. Such a sequence provides the skilled artisan with a probe that is useful for isolating a nucleic acid encoding AKAP110 from any mammalian species. Thus, this invention provides a plurality of consensus sequences for probe production, wherein said probes are useful for isolation or detection of AKAP110 genes or gene expression from any mammalian species.

[0027] The production of proteins such as the sperm-specific protein kinase A anchoring protein of the invention from cloned genes by genetic engineering means is well known in this art. The discussion which follows is accordingly intended as an overview of this field, and is not intended to reflect the full state of the art.

[0028] Nucleic acid encoding the sperm-specific protein kinase A anchoring proteins of this invention can be obtained, in view of the instant disclosure, by chemical synthesis, by screening reverse transcripts of mRNA from testis cells or cultured cell lines derived therefrom, by screening genomic libraries from appropriate cells, or by combinations of these procedures, as illustrated below. Screening of cDNA prepared from cellular mRNA or genomic DNA may be carried out with full-length, partial or oligonucleotide probes generated from the sperm-specific protein kinase A anchoring protein nucleotide sequence information provided herein, as discussed above. Probes may be labeled with a detectable group such as a fluorescent group, a radioactive atom or a chemiluminescent group in accordance with known procedures and used in conventional hybridization assays, as described in greater detail in the Examples below. In the alternative, sperm-specific protein kinase A anchoring protein encoding nucleic acid can be obtained by use of the polymerase chain reaction (PCR) procedure, with the PCR oligonucleotide primers being produced from the sperm-specific protein kinase A anchoring protein nucleotide sequences provided herein. See U.S. Pat. No. 4,683,195 to Mullis et al. and U.S. Pat. No. 4,683,202 to Mullis. In addition, consensus proteins comprising artificially produced and/or genetically engineered proteins encoding at each sequence position an amino acid comprising the “consensus” between the nucleic acid sequences identified as Seq. ID Nos. 11, 13 and 15 are also provided by the invention.

[0029] Nucleic acids and oligonucleotides of the present invention are useful as probes for screening DNA libraries to isolate and characterize additional mammalian homologues of the sperm-specific protein kinase A anchoring protein-encoding nucleic acids of the invention. For the purposes of this invention, these probes are used under high stringency hybridization conditions, defined herein as follows. The probes are labeled with 150 &mgr;Ci 32P-ATP and hybridized overnight at 42° C. in a hybridization buffer comprising 6×SSC (0.9M NaCl, 0.09M sodium citrate dihydrate (pH 7.0)), 2×Denhardt's solution (0.04% Ficoll, 0.04% polyvinylpyrrolidone, 0.04% bovine serum albumin), and 0.25% sodium dodecyl sulfate (SDS). After hybridization, filters are washed four or five times for ten minutes apiece in an excess volume of 6×SSC (0.9 M NaCl, 0.09M sodium citrate dihydride, pH 7.0) and 0.05% SDS at room temperature. Thereafter, three ten-minute washes are performed one after another in this buffer at temperatures of 55° C., 60° C. and 63° C.

[0030] Sperm-specific protein kinase A anchoring proteins may be synthesized in cells, most preferably cells comprising exogenously-added, recombinant DNA, most preferably cDNA, encoding said proteins. In particular, cells transformed with a recombinant expression construct comprising a nucleic acid encoding a sperm-specific protein kinase A anchoring protein of the invention can be used to provide a homogeneous culture of sperm-specific protein kinase A anchoring protein expressing cells. Recombinant expression constructs comprising the sperm-specific protein kinase A anchoring protein coding sequences as disclosed herein can also be comprised of a vector that is a replicable DNA construct. Vectors are used herein either to amplify DNA encoding a sperm-specific protein kinase A anchoring protein and/or to express DNA which encodes a sperm-specific protein kinase A anchoring protein. For the purposes of this invention, a recombinant expression construct is a replicable DNA construct in which a DNA sequence encoding a sperm-specific protein kinase A anchoring protein is operably linked to suitable control sequences capable of effecting the expression of the receptor in a suitable host cell. The need for such control sequence will vary depending upon the host selected and the transformation method chosen. Generally, control sequences include a transcriptional promoter, an optional operator or enhancer sequence to control or regulate transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences which control the termination of transcription and translation, and in mammalian cells, sequences that direct 5′ terminal capping and 3′ terminal polyadenylation of the primary transcript. Amplification vectors, on the other hand, do not require expression control domains. All that is needed is the ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants. See, Sambrook et al., 1990, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press: New York).

[0031] Vectors useful for practicing the present invention include plasmids, viruses (including phage), retroviruses, and particularly integratable DNA fragments (i.e., fragments integratable into the host genome by recombination). The vector may replicate and function independently of the host genome, or more preferably, may, in some instances, integrate into the genome itself. Suitable vectors will contain replicon and control sequences which are derived from species compatible with the intended expression host. Transformed host cells are preferably prokaryotic or eukaryotic cells which have been transformed or transfected with recombinant expression constructs made using recombinant DNA techniques and comprising mammalian sperm-specific protein kinase A anchoring protein-encoding sequences. Preferred host cells are bacterial cells, most preferably Escherichia coli cells. Transformed host cells are chosen that are capable of expressing functional sperm-specific protein kinase A anchoring protein introduced using the recombinant expression construct. See, Sambrook et at., ibid.

[0032] Homogenous compositions of the mammalian sperm-specific protein kinase A anchoring proteins are provided by the invention. As used herein, the term “homogenous” is intended to encompass preparations wherein the mammalian sperm-specific protein kinase A anchoring protein of the invention is the predominant protein species in the preparation, preferably wherein the mammalian sperm-specific protein kinase A anchoring protein comprises at least 70%, more preferably wherein the mammalian sperm-specific protein kinase A anchoring protein comprises from 80-90%, and most preferably where the mammalian sperm-specific protein kinase A anchoring protein comprises greater than 90% of the protein in the preparation. In preferred embodiments, said preparations have one or a multiplicity of additional protein components wherein no one component comprises more than about 5% and more preferably about 1% of the protein in the preparation.

[0033] The invention also provides antibodies that are immunologically reactive to a mammalian sperm-specific protein kinase A anchoring protein, most preferably the bovine, murine or human homologues explicitly disclosed herein. The antibodies provided by the invention are raised in animals by inoculation with homogenous preparations of a mammalian sperm-specific protein kinase A anchoring protein of the invention or epitopes thereof, using methods well known in the art. Alternatively, peptide fragments of the mammalian sperm-specific protein kinase A anchoring protein of the invention can be chemically synthesized or isolated from the full-length sequence, covalently attached to a carrier molecule such as keyhole limpet hemocyanin, and injected into an appropriate experimental animal. Animals that are used for such inoculations include individuals from species comprising cows, sheep, pigs, mice, rats, rabbits, hamsters, goats and primates. Preferred animals for inoculation are rodents (including mice, rats, and hamsters) and rabbits. For preparing polyclonal antisera, the most preferred animal is rabbit. For preparing monoclonal antibodies, the most preferred animal is the mouse.

[0034] Cells that can be used for such inoculations, or for any of the other means used in the invention, include any cell, clonal isolate or cell line that expresses a mammalian sperm-specific protein kinase A anchoring protein or any epitope thereof, most preferably as a result of molecular or genetic engineering. Preferred cells for preparing said recombinant protein is E. coli cells, most preferably having been transformed with a recombinant expression construct comprising a nucleic acid encoding a human, bovine or murine sperm-specific protein kinase A anchoring protein or epitopes thereof, and that express the mammalian gene product, wherein it is understood that such preparations are sufficiently purified from pyrogenic or other bacterial toxins or contaminants as to be suitable for injection into an animal.

[0035] The present invention provides polyclonal antisera and monoclonal antibodies that are immunologically reactive with an epitope that is a mammalian sperm-specific protein kinase A anchoring protein or fragment thereof. These antibodies are made using methods and techniques well known to those of skill in the art.

[0036] Monoclonal antibodies provided by the present invention are produced by hybridoma cell lines, that are also provided by the invention and that are made by methods well known in the art. Hybridoma cell lines are made by fusing individual cells of a myeloma cell line with spleen cells derived from animals immunized with a mammalian sperm-specific protein kinase A anchoring protein, or cells expressing such a mammalian sperm-specific protein kinase A anchoring protein, preferably the murine, bovine or human sperm-specific protein kinase A anchoring protein, as described above. The myeloma cell lines used in the invention include lines derived from myelomas of mice, rats, hamsters, primates and humans. Preferred myeloma cell lines are from mouse, and the most preferred mouse myeloma cell line is P3X63-Ag8.653. The animals from whom spleens are obtained after immunization are rats, mice and hamsters, preferably mice, most preferably Balb/c mice. Spleen cells and myeloma cells are fused using a number of methods well known in the art, including but not limited to incubation with inactivated Sendai virus and incubation in the presence of polyethylene glycol (PEG). The most preferred method for cell fusion is incubation in the presence of a solution of 45% (w/v) PEG-1450. Monoclonal antibodies produced by hybridoma cell lines can be harvested from cell culture supernatant fluids from in vitro cell growth; alternatively, hybridoma cells can be injected subcutaneously and/or into the peritoneal cavity of an animal, most preferably a mouse, and the monoclonal antibodies obtained from blood and/or ascites fluid.

[0037] Monoclonal antibodies provided by the present invention are also produced by recombinant genetic methods well known to those of skill in the art, and the present invention encompasses antibodies made by such methods that are immunologically reactive with an epitope of a mammalian sperm-specific protein kinase A anchoring protein.

[0038] The present invention encompasses fragments of the antibody that are immunologically reactive with an epitope of a mammalian sperm-specific protein kinase A anchoring protein. Such fragments are produced by any number of methods, including but not limited to proteolytic cleavage, chemical synthesis or preparation of such fragments by means of genetic engineering technology, and include Fab fragments, Fab′ fragments, F(ab)2 fragments, and Fv fragments. The present invention also encompasses single-chain antibodies that are immunologically reactive with an epitope of a mammalian sperm-specific protein kinase A anchoring protein made by methods known to those of skill in the art. In preferred embodiments, the mammalian sperm-specific protein kinase A anchoring protein is a bovine, murine or human homologue as provided by the invention.

[0039] The present invention also encompasses an epitope of a mammalian sperm-specific protein kinase A anchoring protein that is comprised of sequences and/or a conformation of sequences present in the mammalian sperm-specific protein kinase A anchoring protein molecule. This epitope may be naturally occurring, or may be the result of proteolytic cleavage of the mammalian sperm-specific protein kinase A anchoring protein molecule and isolation of an epitope-containing peptide or may be obtained by chemical and more preferably automated chemical synthesis of an epitope-containing peptide using methods well known to those skilled in the art. The epitope also comprises a “consensus” epitope, wherein the identity of the amino acid residue at each position in the epitope sequence represents the “consensus” residue obtained by comparison of the amino acid sequences identified as Seq. ID Nos. 12, 14 and 16. The present invention also encompasses epitope peptides produced as a result of genetic engineering technology and synthesized by genetically engineered cells, preferably prokaryotic cells and most preferably E. coli cells.

[0040] The invention also provides methods for screening compounds for the capacity to disrupt binding between the mammalian sperm-specific protein kinase A anchoring proteins of the invention and protein kinase A, most preferably the RII subunit of protein kinase A. In these methods, homogenous preparations of both the mammalian sperm-specific protein kinase A anchoring protein of the invention and protein kinase A, preferably recombinant embodiments thereof and most preferably recombinant RII subunits thereof, are used to assay the effects of the screened compounds on AKAP-PKA binding. Preferably, the mammalian sperm-specific protein kinase A anchoring protein of the invention or protein kinase A, most preferably said RII subunit thereof, are detectably labeled, which for the purposes of this aspect is intended to encompass but not be limited to radioactive, fluorescent and antigenic labels. In other preferred embodiments, the mammalian sperm-specific protein kinase A anchoring protein of the invention or protein kinase A, most preferably said RII subunit thereof, are immobilized to a substrate. For the purposes of this disclosure, the term “substrate” is intended to encompass solid platforms such as are used as understood by those with skill in the art in enzyme-linked immunosorbent assay (“ELISA”) and radioimmune assay (“RIA”) wells and the wells of plastic 96-well plates, and in addition beads and chromatographic substrates. In certain embodiments, the methods are performed as variants of the RII overlay method described herein below. In alternative embodiments, particularly suited for high throughput screening and automation, the methods are performed to resemble ELISA and RIA assays, whereby at least one of either the mammalian sperm-specific protein kinase A anchoring protein of the invention or protein kinase A are immobilized to a solid support. In preferred embodiments of each of these aspects of the methods of the invention, either the mammalian sperm-specific protein kinase A anchoring protein of the invention or protein kinase A is detectably labeled. The invention also provides the agents and compounds detecting using these methods that are capable of disrupting AKAP:PKA RII binding.

[0041] The invention also provides methods for inhibiting or preventing expression of the mammalian sperm-specific protein kinase A anchoring protein of the invention in sperm, spermatids or progenitor cells thereof, said methods comprising introducing an antisense oligonucleotide into said cell. Said methods further comprise screening candidate oligonucleotides in recombinant cells, most preferably mammalian cells, transformed with a recombinant expression construct of the invention encoding a mammalian sperm-specific protein kinase A anchoring protein as disclosed herein, and assaying said cell in the presence and absence of the candidate oligonucleotide for recombinant gene expression. The invention also provides the oligonucleotides detected using these methods that are capable of inhibiting or preventing recombinant AKAP expression.

[0042] The Examples which follow are illustrative of specific embodiments of the invention, and various uses thereof. They set forth for explanatory purposes only, and are not to be taken as limiting the invention.

EXAMPLE 1

Isolation and Characterization of Bovine AKAP110 Protein from Bovine Sperm

[0043] In order to derive a probe for isolating cDNA encoding an anchoring kinase A protein having an apparent molecular weight of 110 kD (AKAP110) in sperm, AKAP110 protein was isolated from bovine sperm as follows.

[0044] Testes from mature bulls with intact tunica were obtained from a local slaughterhouse and sperm from caput or caudal epididymis were isolated and washed as described in Vijayaraghavan et al. (1985, Biol. Reproduc. 32: 489-500). The washed sperm were fractionated into heads, tails and midpieces as described in Mohapatra et al. (1998, Biochem. Biophys. Res. Commun. 244: 540-545). Tails were pelleted at 16,000×g for 15min and resuspended in homogenization buffer (HB) comprising 50 mM Tris-HCl (pH 7.0), 2 mM EGTA, 2 mM EDTA, 0.5M NaCl, 1% Nonidet P-40 (NP-40), 0.1% &bgr;-mercaptoethanol, 10 mM benzamidine, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM dithiothreitol (DTT), 10 &mgr;g/mL trypsin inhibitor, 10 &mgr;g/mL leupeptin, 1 &mgr;g/mL aprotinin and 1 &mgr;g/mL N&agr;-p-tosyl-L-lysine chloromethyl ketone (TLCK; all chemicals obtained from Sigma Chemical Co., St. Louis, Mo.). The resuspended tails were sonicated in HB for 20 sec at a setting of “4” on a Branson Sonifer 450. The sonicated suspension was inverted for 30 min at 4° C. and then centrifuged at 16,000×g for 15 min at 4° C. The pellet was then resuspended in HB, inverted for 30 min at 4° C., and then again centrifuged at 16,000 rpm for 15 min at 4° C. Finally, the pellet was resuspended in Sonication Buffer (SB) comprising 9M deionized urea, 4% NP-40, 2% , &bgr;-mercaptoethanol, and 2% ampholytes pH 3-10 (obtained from Pharmacia LKB, Upsala, Sweden) and rocked at room temperature for 2 h. This mixture was then used for two-dimensional electrophoresis as described below.

[0045] The identity of AKAP110 in the extracts prepared as described above was determine using an RII overlay assay. This assay was based on previous experiments which had shown that PKA anchoring proteins could be specifically detected after electrophoretic separation by overlay with labeled RII subunit of mammalian PKA (see Vijayaraghavan et al., 1997, J. Biol. Chem. 272; 47474-4752). These assays were performed as follows. Polyacrylamide gel electrophoresis containing sodium dodecyl sulfate (SDS/PAGE) was performed as described in Johnson et al. (1997, Devel. Biol. 192: 340-350) and Visconti et al. (1997, Devel. Biol. 192: 351-363). Approximately 50 &mgr;g protein per lane was loaded on a 10% gel and electrophoresed overnight at a constant current of 8 mA. After electrophoresis, protein bands were transferred to Immobilon P (polyvinylidene difluoride, obtained from Millipore, Bedford, Mass.) as described in the Johnson and Visconti references. After about 1 h, blot transfer was complete, and the blots were pre-treated in a solution containing 10 mM Tris-HCl (pH 7.5), 150 mM NaCl, 5% non-fat milk, and 0.1% BSA (termed BLOTTO buffer) to prevent non-specific binding to the membrane. The blot was then treated with 32P labeled RII&agr; protein at a concentration of 500,000 cpm/mL in BLOTTO buffer. Recombinant RII&agr; (prepared by expression in E. coli as described above; see Carr et al., 1991, J. Biol. Chem. 266: 14188-14193) was radiolabeled by incubation with the catalytic subunit of PKA in the presence of &ggr;-32P-labeled ATP. Approximately 1 &mgr;g of catalytic subunit was added to 5 &mgr;g of RII plus 50 &mgr;Ci of 32P-ATP in a buffer consisting of 0.05M MOPS (pH 7.0), 0.01M MgCl2, 0.25 mg/mL bovine serum albumin (BSA) and 0.01M dithiothreitol (DTT) and incubated for one hour at room temperature. The radiolabeled RII was then separated from the radiolabeled ATP using a KWIK-Sep™ exocellulose desalting column (Pierce Chemical, Rockford, Ill.) following the manufacturer's instructions. After incubation of the blot for four hours at room temperature, the blot was washed four times for fifteen minutes each with an excess volume of TTBS (0.1% Tween-20, 10 mM Tris-HCl, pH 7.5, 150 mM NaCl). Protein bands on the blot radiolabeled by binding to the 32P labeled RII&agr; were then visualized by autoradiography by exposure to X-ray film (Kodak XAR, Eastman Kodak, Rochester, N.Y.) overnight at −80° C.

[0046] The results of one such experiment are shown in FIGS. 1A and 1B. FIG. 1A shows SDS/PAGE analysis of tail fractions extracted in HB containing 0.1, 0.2 or 0.3M NaCl (lanes 1, 2 and 3 of the Figure), 0.3M NaCl plus 0.1 or 1% SDS (lane 4 and 5), or 0.3M NaCl, 1% SDS and 7M urea (lane 6), followed by blotting and radioactive RII overlay analysis as described. (In these experiments, the HB lacked 0.5M NaCl and 1% NP-40.) These experiments illustrate the insolubility of AKAP110 protein in bovine sperm under the extraction conditions employed in these assays; the majority of the protein is seen to remain in the pellet even after extraction in high salt and/or detergent concentrations.

[0047] FIG. 1B shows the results of two-dimensional assay comprising isoelectric focusing (IEF) in the first (horizontal) dimension and SDS/PAGE in the second (vertical) dimension. These assays were performed only on sperm that had been subjected to the final extraction step using SB buffer described above. IEF was performed using standard protocols as described in Bollag & Edelstein (1991, Protein Methods, Wiley-Liss, N.Y.) using ampholytes spanning a pH range of 3-10, and SDS/PAGE was performed as described above. The results of these assays showed that AKAP110 was solubilized only by treatment with high concentrations of urea (9M).

[0048] A band on a gel processed in parallel and corresponding to the position of AKAP110 detected in the two-dimensional assay as described was excised and the AKAP110 protein eluted therefrom. This protein was subjected to tryptic digestion, high pressure liquid chromatographic separation, and amino acid microsequencing. As a result, seven peptide fragments were sequenced; these sequences are as follows: 1 SCVETLGEHIIK (Seq. ID No.:1) KGFCVDYYNTT (Seq. ID No.:2) EGISACLQGSPFVTP (Seq. ID No.:3) SPAVSHESSLR (Seq. ID No.:4) NLLSETIFK (Seq. ID No.:5) GTGTAETFLQNAYQAIHNEL; and (Seq. ID No.:6) LLQLSAAAVEK (Seq. ID No.:7)

[0049] These sequences were compared with sequences in GenBank and were determined to be unique. However, certain of these peptides (SEQ ID Nos. 6 and 7) showed approximately 90% sequence similarity to expressed sequence tags (ESTs) previously isolated from mouse and human testis-specific cDNA libraries. These included ESTs designated MTEST21 (C. Hoog, Department of Molecular Genetics, Karolinska Institute, Stockholm, Sweden), AA424242 (available royalty-free from Lawrence Livermore National Laboratory), AA92960 (available royalty-free from Lawrence Livermore National Laboratory) and AA061683 (Genbank, National Center for Biotechnology Information, Bethesda, Md). These similarities, and the uniqueness of the peptide sequences specific for bovine testis AKAP110, were used to develop probes for the library screening experiments described in Example 2.

EXAMPLE 2

Isolation and Characterization of cDNA Encoding Murine AKAP110 Protein

[0050] The results obtained in Example 1 were used to develop AKAP110-specific probes for screening a murine cDNA library for sequences encoding AKAP110.

[0051] Two of the EST sequences identified as being similar to two of the seven peptide sequences derived from bovine AKAP110 protein were used. These ESTs, AA92960 and AA061683, had the following nucleotide sequence: 2 AA92960: (Seq ID No.:8) ATGAGTGCAAACTTAAGTCTCCTCCCCACAAGATATGTGACCAAGAACAA ACAGAAAAGAAAGATCTGATGAGTGTCATCTTCAATTTTATCCGGAACTT ACTCAGCGAGACCATATTCAAGAGTAGCCGTAACTGTGAATCCAATGTGC ATGAGCAGAACACTCAGGAAGAAGAGATACACCCGTGTGAAAGGCCTAAG ACTCCATGTGAAAGGCCTATTACCCCGCCTGCCCCGAAATTCTGTGAGGA TGAGGAGGCCACTGGTGGTGCCTTATCTGGGCTAACCAAGATGGTTGCCA ACCAGCTAGACAACTGTATGAATGGGCAGATGGTGGAGCACCTGATGGAC TCGGTGATGAAGTTATGCCTCATTATTGCCAAGTCCTGTGACTCTCCCCT GTCGGAGCTGGGAGAGGAAAAGTGTGGGGATG; and AA061683: (Seq ID No.:9) GTGAATCCAATGTGCATGAGCAGAACACTCAGGAAGAAGAGATACACCCG TGTGAAAGGCCTAAGACTCCATGTGAAAGGCCTATTACCCCGCCTGCCCC GAAATTCTGTGAGGATGAGGAGGCCACTGGTGGTGCCTTATCTGGGCTAA CCAAGATGGTTGCCAACCAGCTAGACAACTGTATGAATGGGCAGATGGTG GAGCACCTGATGGACTCGGTGATGAAGTTATGCCTCATTATTGCCAAGTC CTGTGACTCTCCCCTGTCGGAGCTGGGAGAGGAAAAGTGTGGGGATGCCA GCCGGCCAAATTCTGCCTTCCCAGATAACTTATATGAGTGCCTACCAGTC AAGGGCACAGGGACAGCTGAAGCCCTCCTGCAGAACG.

[0052] These oligonucleotides were obtained from Research Genetics Inc. (Huntsville, Ala.). and radiolabeled by end-labeling with 32P using terminal transferase (obtained from New England Biolabs, Beverly, Mass.) in the presence of &ggr;32P-ATP under conditions recommended by the supplier. Radiolabeled probes were used to screen a mixed germ cell mouse testis cDNA library prepared in the cloning vector Lambda ZAP, obtained from Stratagene (LaJolla, Calif.). Approximately 500,000 phage plaques were screened using conventional techniques (Sambrook et al., ibid.). The probes were labeled with 150 &mgr;Ci 32P-ATP and hybridized overnight at 42° C. in a hybridization buffer comprising 6×SSC (0.9M NaCl, 0.09M sodium citrate dihydrate (pH 7.0)), 2×Denhardt's solution (0.04% Ficoll, 0.04% polyvinylpyrrolidone, 0.04% bovine serum albumin), and 0.25% SDS. After hybridization, the filters were washed four or five times for ten minutes apiece in an excess volume of 6×SSC (0.9 M NaCl, 0.09M sodium citrate dihydride, pH 7.0) and 0.05% SDS at room temperature. Thereafter, three ten minute washes were performed one after another in this buffer at temperatures of 55° C., 60° C. and 63° C. Three positively-hybridizing clones were identified and plaque-purified. Insert were excised from the phage vector in vitro to provide pBluescript SK plasmids containing the inserts using an excision technique according to the manufacturer's instructions (Stratagene).

[0053] Inserts were amplified by the polymerase chain reaction for 25 cycles consisting of 30 sec at 94° C., 30 sec at 55° C. and 2 min at 72° C. using primers complementary to the pBluescript SK vector on either side of the insert (Stratagene). Amplification using the three plasmids derived from the three positively-hybridizing phage resulted in amplification products of 2.5 kb, 2.5 kb and 3.1 kb. Nucleotide sequence determination was performed using Taq polymerase (in a kit supplied by Applied Biosystems, Foster City, Calif.) by the dideoxynucleotide chain termination method (Sanger et al., 1977, Proc. Natl. Acad. Sci. USA 74: 5463-5467). The sequences of these inserts were overlapping, with the 3.1 kb insert containing an additional 600 bp of sequence information 5′ to the sequences contained in the other insert fragments. In the largest clone, an initiation Met codon is located at nucleotide residue 292, and the context of this initiation codon (residues 289-294: AGGATGG) indicates that it is a translation start site (Kozak, 1987, Nucleic Acids Res. 15: 8125-8148). The 288 residues 5′ to this putative translation start site contain 10 inframe translation termination codons, precluding the use of another contiguous ATG codon upstream. In addition, the sequence between nucleotide residue 292 and residue 2887 comprised an open reading frame encoding a protein having 864 amino acids; residues 2884-2886 encoded a translation termination codon followed by a polyA tail at residue 3079. This 3.1 kb insert was cloned into plasmid pET30A (obtained from Novagen, Madison, Wis.) after digestion with EcoRI and XhoI using conventional techniques.

[0054] The sequence of the 3.1 kb fragment is shown in FIG. 2 and comprises Seq ID Nos. 10 and 11. These sequences have been deposited with GenBank under accession number AF093406.

EXAMPLE 3

Isolation and Characterization of cDNA Encoding Bovine and Human AKAP110 Protein

[0055] The bovine and human homologues of the mouse AKAP110 protein-encoding cDNA described in Example 2 above were obtained as follows.

[0056] The mouse AKAP cDNA was used as a probe to screen a bovine oligo dT-primed cDNA library prepared in the Lambda ZAPII vector and obtained from Stratagene. 700,000 clones were screened at high stringency as described above using the 3.1 kb insert 32P-labeled by the random primer method (Sambrook et al., ibid.). This screening resulted in 12 positively-hybridizing plaques that were plaque-purified and converted to pBluescript plasmids as described above. Nucleotide sequencing of these plasmids revealed them to be a collection of overlapping fragments, the longest of which was 2.9 kb in length and contained all but the amino-terminal 4 amino acids of the complete bovine AKAP110-encoding sequence (when compared with the putative amino acid sequence of the murine clone). The bovine sequence is shown in FIG. 2 and Seq ID Nos. 12 and 13. All seven of the peptides produced by microsequencing the bovine AKAP110 protein as described in Example 1 were found in the predicted bovine amino acid sequence. These sequences have been deposited with GenBank under accession number AF093407.

[0057] The human AKAP110 cDNA was isolated from a human testis cDNA library obtained from Clontech (Palo Alto, Calif.) and was screened using the murine 3.1 kb fragment at high stringency as described for the screening of the bovine library. Several positively-hybridizing phage plaques were obtained and plaque purified, and the size of the hybridizing insert fragments determined by restriction enzyme digestion and Southern blot analysis (Sambrook et al., ibid.). The longest hybridizing insert was 1.3 kb, which was sequenced and recognized to be too short to encode the complete 110 kD protein. The polymerase chain reaction-based RACE technique was used to obtain the missing portions of the sequence from testis cDNA (obtained from Clontech), the method being performed using a kit supplied by Clontech according to the instructions provided by the supplier.

[0058] The human sequence is shown in FIG. 2 and Seq ID Nos. 14 and 15. An initiation Met codon is located at nucleotide residue 230, and the 229 residues 5′ to this putative translation start site contain 3 inframe translation termination codons. In addition, the sequence between nucleotide residue 230 and residue 2788 comprised an open reading frame encoding a protein having 853 amino acids; residues 2789-2791 encoded a translation termination codon. These sequences have been deposited with GenBank under accession number AF0934098.

EXAMPLE 4

Sequence Characterization and Comparison of cDNA Encoding Murine, Bovine and Human AKAP110 Protein

[0059] The amino acid sequences encoded by the three mammalian AKAP110 cDNA clones of the invention are aligned in FIG. 2; regions of sequence identity are represented as shaded in the Figure. This alignment was produced using the ClustalW Alignment program (MacVector Software, Oxford Molecular Group). The nucleotide sequence of the bovine clone predicted an amino acid sequence of 859 amino acids having a calculated molecular weight of 95,578 and a calculated isoelectric point of 6.02. These results were consistent with the experimentally-observed values obtained according to Example 1. There was 65% amino acid sequence identity between the three species (554 out of 864 identical residues). There were also large domains of greater than 95% sequence homology interspersed by regions where some amino acids were deleted in one sequence compared with the other two (for example, beginning at amino acid 45), as well as a region of significant sequence diversity (e.g., the 50 amino acids between residues 475 and 525). No matches to AKAP110 were found in the Prosite database of patterns (Bairoch et al., 1997, Nucleic Acids Res. 25: 217-221), except for patterns otherwise having a high probability of occurrence, such as phosphorylation sites. Finally, the SOSUI structural analysis computer program (Hirokawa et al., 1998, Bioinformatics 14: 378-379) predicts AKAP110 to be a soluble protein.

[0060] The conserved regions of sequence are expected to correspond to functional domains. The portion of the sequence corresponding to the RII binding domain was determined using an RII overlay assay as follows. The mouse cDNA was fragmented into the following species containing the indicated portions of the full-length AKAP110 amino acid sequence: residues 1-470; 471-864; 1-350; 1-164; and 1-117. These fragments were subcloned into the pET30A vector (Novagen) and expressed in E. coli using a protocol provided by the supplier of the vector. The protein fragments were isolated from individual E. coli clones, separated by SDS/PAGE and transferred to an Immobilon P membrane as described above. This blot was then hybridized with 32P-labeled RII&agr; (results shown in FIG. 4A) or with horse radish peroxidase-conjugated S-protein that detects an S-tag expressed as a fusion protein by the pET30A vector (results shown in FIG. 4B). The results shown in FIG. 4B demonstrate the presence of all six fragments on the blot, while the results shown in FIG. 4A indicate that only certain of these fragments are capable of binding the radiolabeled RII&agr; protein. The pattern of RII&agr; binding of these fragments is summarized in FIG. 4C. Deletion of the carboxyl-terminal half of the protein (residues 471-864) had no effect on RII binding, while deletion of the amino terminal half (residues 1-470) abolished RII binding. Progressive continuation of this deletion analysis limited the region of the sequence to amino acids 117 and 164.

[0061] A comparison of the portion of the sequence delineated by this analysis and several prior art AKAP sequences implicated the sequence corresponding to amino acids 124-141 in the mouse sequence as being the RII binding site. The identity of this portion of the sequence as an RII&agr; binding site was confirmed by preparing a synthetic peptide having amino acid sequence:

[0062] SFYANRLTNLVI (Seq ID No.: 16)

[0063] with an automated peptide synthesizer using 9-fluorenylmethoxycarbonyl (Fmoc) chemistry and base-mediated coupling (Applied Biosystems). This peptide was shown to prevent radiolabeled RII&agr; binding when it was included in the binding assay at a concentration of 1 &mgr;M. The results of these experiments are shown in FIG. 4D.

[0064] As a result of this alignment, a comparison was made between the RII binding domain of AKAP110 and the RII binding domains of 14 other known AKAP proteins; this alignment is shown in FIG. 5A. This alignment permitted the development of a model of the RII binding motif in AKAP proteins. Optimal alignment of the RII binding sequence from these fifteen proteins was performed using the ClustalW Alignment program (MacVector). The comparison was performed iteratively, wherein the sequences were compared and modified until a consensus sequence was obtained. This analysis revealed that 8 out of 18 positions were strongly conserved in this sequence. All of these conserved positions encoded predominantly hydrophobic amino acids. A common motif can be represented as follows: 3 (Seq ID No.:17) X-{L/I/V}-X-X-X-{A/S}-X-X-{L/I/V}-{L/I/V}-X-X- {L/I/V}-{L/I/V}-X-X-{A/S}-L/I/V}

[0065] where “X” is any amino acid and the residues in brackets are alternative, conserved amino acids at that position in the consensus sequence. Eleven of the fifteen AKAPs aligned match at least 7 of the 8 conserved positions; if additional alternative residues are allowed (such as V for A/S and T, A or M for L/I/V, then nine of the fifteen AKAPs are conserved in all eight positions and 13 out of 15 are conserved at 7 of 8 positions. Six of the eight conserved positions consist of branched aliphatic residues that are most likely to be involved in binding hydrophobic amino acids at the amino terminus of the RII subunit (see Dell'Aqua & Scott, 1997, J. Biol. Chem. 272: 12881-12884). The other two positions (position 5 and 7) are occupied by either Ala or Ser, residues having low steric bulk, amphipathic or hydrophobically neutral and ambivalent in terms of placement either on the internal or external face of a protein. Positions 2 and 18 contain the most variability in the conserved residues, suggesting that these residues flank a more sequence-restricted central core.

[0066] Arrangement of the residues in the consensus sequence into an alpha helical structure is shown in FIGS. 5B and 5C. When drawn in this way, all of the conserved positions are on one face of the helix (between residues 9 and 18 as shown). The residues between the conserved residues are predominantly hydrophilic neutral residues. These results are consistent with a model of AKAP:RII binding containing an amphipathic helix having a highly conserved, hydrophobic face and a less well conserved, hydrophilic face. The entire binding domains appears to encompass five turn of the alpha helix. It is expected that the affinity between any particular AKAP and RII pair will be related to how closely the AKAP binding domain matches the conserved motif, especially at positions (such as 6, 9, 10, 13, 14 and 17) in the middle of the domain. AKAP110 is conserved at all 6 of these central positions (as shown in FIG. 5C).

[0067] These results suggest methods for screening compounds for the ability to inhibit, modulate or enhance binding between AKAP110 and RII&agr;, as described in further detail herein.

[0068] The murine, bovine and human AKAP110 sequences were used to search a number of databases for related amino acid sequences. No matches were found in the Prosite database (Bairoch et al., 1997, Nucleic Acids Res. 25: 217-221). Using the Gapped BLAST program (Altschult et al., 1990, J. Molec. Biol. 215: 403-410) from the National Library of Medicine at the National Institutes of Health, AKAP110 was found to have significant amino acid sequence homology to a previously-described sperm major fibrous sheet protein, variously termed AKAP82, p82, FSC-1 and HI (see Carrera et al., 1994, Develop. Biol. 165: 272-284; Fulcher et al., 1995, Biol. Reprod. 52: 41-49; and Mohapatra et al., 1998, ibid.). Alignment using up to 20 gaps revealed 35% sequence identity between AKAP110 and AKAP82. This sequence similarity exists throughout the entire length of the protein molecule, although the longest continuous stretch of identity is 11 amino acids in length. The topography of the sequence similarities between AKAP110 and AKAP82 is illustrated in FIG. 6, where the boxes define conserved regions of sequence of at least 20 amino acids having greater than 50% homology. This comparison suggests that these proteins may share several conserved domains that may perform similar functions. Conversely over half the amino acid sequence is dissimilar, suggesting that each protein may have diverged to perform different functions. It is also interesting to note that two regions at the amino terminus are conserved, even though the mature AKAP82 protein is processed to eliminate this portion of the protein (at a cleavage site depicted in the Figure). The third domain depicted in the Figure contains the putative RII binding site for both proteins; FIG. 5A provides a comparison, showing that 12 of the 18 amino acids of the binding site are conserved.

[0069] Despite the significant sequence homology between these two proteins, there is no cross-hybridization between cDNA encoding these proteins, and no cross-reactivity between either of these proteins and antibodies raised against the other. As described below, Northern blot analysis of germ cell-specific mRNA (or, as described above, screening a cDNA library prepared therefrom) using AKAP110 cDNA as a probe detected only AKAP mRNA or cDNA. Similarly, antibodies specific for AKAP110 detected only the single 110 kD AKAP110 protein band in Western blot experiments (described below). In addition, although AKAP82 has been reported to be an RII binding protein (see Carrera et al., ibid. and Visconti et al., ibid.), and the sequence comparison disclosed herein revealed significant sequence homology between the RII binding site of AKAP110 and the putative RII binding site of AKAP82, only AKAP110 was detected in RII overlay analyses of sperm protein extracts (as described in Example 1 and shown in FIG. 1). One explanation for these results is that AKAP110 has a higher affinity for RII that AKAP82, an explanation that is supported by the differences noted in the RII binding site. Importantly, the differences in RII binding suggests that the diversity at certain conserved positions in the RII binding site may be important: for example, AKAP82 has a valine at position 6 rather than an alanine or serine, and a serine at position 10 rather than a leucine, isoleucine, valine, alanine or threonine. These results suggest that these sites are particularly important for AKAP:RII interaction, which further suggests that these sites may be important targets for disrupting the AKAP:RII interaction in vivo, as described in greater detail below.

EXAMPLE 5

Expression of AKAP mRNA and Protein in Adult Tissues and in Sperm

[0070] AKAP110 expression in adult tissues was investigated at both the mRNA and protein levels.

[0071] In order to detect AKAP110 protein expression, polyclonal antisera were produced in rabbits. A peptide corresponding to amino acid residues 448-459 of bovine AKAP110 was synthesized using an automated peptide synthesizer and Fmoc chemistry (Applied Biosystems), having the following sequence:

[0072] SCVETLGEHIIK (Seq. ID No.: 1).

[0073] This peptide was conjugated to keyhole limpet hemocyanin according to conventional protocols (Harlow & Lane, 1988, Antibodies, Cold Spring Harbor Press: New York) and injected into two New Zealand white rabbits. The animals were bled from the ear after six weeks, the serum separated and then pooled. Ammonium sulfate was then added to the pooled serum to a final concentration of 40% to precipitate the immunoglobulin fraction. The precipitated antibodies were resuspended in phosphate buffered saline (PBS) and subjected to affinity chromatography using the original peptide (Seq ID No.: 1) conjugated to Amino Link matrix (obtained from Pierce Chemical Co.) according to the instructions from the supplier.

[0074] The plasmids prepared as described above in Example 2 were used to produce full-length AKAP110 in E. coli using ITPG induction as detailed in the instructions provided with the vector by the supplier (Novagen). The AKAP110 protein was then separated from other proteins by SDS/PAGE, and transferred to Immobilon P as described above. This Western blot was treated with BLOTTO solution (10 mM Tris-HCl (pH 7.5), 150 mM NaCl, 5% non-fat milk, 0.1% BSA) and then incubated with the primary antibody for two hours at room temperature using antibody dilutions of about 1:5000. Antibody binding was detected using antirabbit secondary antibody conjugated to horse radish peroxidase and developed using an enhanced chemiluminescence kit (Renaissance from NEN, Boston, Mass.) according to instructions from the supplier.

[0075] Results of these experiments are shown in FIGS. 3A through 3C. FIGS. 3A and 3B are identical blots loaded with bacterial lysates from either uninduced (Control) or induced E. coli, and separated into pellet and supernatant fractions. FIG. 3A shows an RII overlay assay performed as described above, and confirms that intact, functional AKAP110 protein was produced and isolated from the E. coli. FIG. 3B is the result of probing this blot with the anti-AKAP110 antisera. These results show that the antisera specifically recognized the same protein band in the blot as the RII overlay assay. FIG. 3C shows a similar Western blot probed with the anti-AKAP110 antisera and containing 50 &mgr;g of bovine caudal sperm lysate (prepared as described in Example 1). These results demonstrate that the antisera were also capable of detecting native bovine AKAP110 in sperm protein lysates, and support the conclusion that the synthetic peptide raise antisera against native AKAP110.

[0076] Northern blots prepared using mouse polyA+ mRNA from heart, brain, spleen, lung, liver, skeletal muscle, kidney and testis were obtained from Clontech; 2 &mgr;g of each tissue-specific mRNA were contained in each lane. These blots were hybridized according to the manufacturer's instructions with either full-length mouse AKAP110 cDNA or nucleotides 838-1055, labeled with a random hexamer primer kit (Amersham) to 1.5 million cpm/mL. The blot was thereafter washed sequentially using the following protocol: twice for 5 minutes apiece at room temperature in an excess volume of 2×SSC (0.03M sodium citrate dihydride (pH 7.0), 0.3M NaCl), and 1% SDS; twice for 30 minutes apiece at room temperature in an excess volume of 0.2×SSC and 1% SDS; eight times at 46° C. in 0.1×SSC and 0.5% SDS. The blot was visualized by autoradiography by exposure to X-ray film (Kodak XAR, Eastman Kodak) overnight at −80° C.

[0077] The results of these experiments are shown in FIG. 7. A single mouse AKAP110 mRNA of about 3.6 kb in size was detected specifically and only in mRNA from testis. These results indicate that AKAP110 expression may be sperm-specific. This conclusion is supported by the finding that all ESTs having similar sequences have been isolated only from testis cDNA libraries. The blots were probed with AKAP110 nucleotides 838-1055 to ensure that the detected mRNA was not the result of cross-hybridization with AKAP82 mRNA; this portion of the AKAP110 cDNA has no significant homology to the AKAP82 sequence. These results support the conclusion that, although the proteins are related, AKAP110 and AKAP82 cDNAs do not cross-hybridize.

[0078] In situ hybridization was performed on cryosections of fresh-frozen mouse testis tissue. Said cryosections were fixed in 4% formaldehyde in 0.1M Na-phosphate (pH 7.4), and then acetylated for 15 min in 0.25% acetic anhydride in 0.1M triethanolamine (pH 8). Sense and—antisense riboprobes were synthesized in the presence of digoxigenin-labeled nucleotides (Boehringer Mannheim, Indianapolis, Ind.) by run-off transcription of linearized pCRII plasmid (Invitrogen, San Diego, Calif.) containing a 217 bp fragment of AKAP110 (residues 838-1055). Riboprobes were denatured for 5 min at 80° C., then diluted in 50% formamide, 10% dextran sulfate, 4×SSC, 1×Denhardt's reagent, 0.5 mg/mL denatured salmon sperm DNA and 0.25 mg/mL yeast tRNA. Frozen sections were hybridized at 50° C. overnight. After hybridization, slides were rinsed at room temperature with 2×SSC, rinsed again with STE (500 mM NaCl, 20 mM Tris-HCl (pH 7.5), 1 mM EDTA), and then incubated for 30 min at 37° C. in STE containing 40 &mgr;g/mL RNase A. The slides were then washed twice for 5 min at room temperature, first in 1×SSC and then in 0.5×SSC. Hybridization was detected using sheep anti-digoxigenin Fab fragments conjugated with alkaline phosphatase (Boehringer Mannheim). Staining was achieved by incubation of the hybridized, antibody-bound sections with BCIP/NBT (bromo-4-chloro-3-indolphosphate/nitroblue tetrazolium, a substrate for alkaline phosphatase) in a solution of 100 mnM Tris-HCl (pH 9.5), 50 mM magnesium chloride, and 1 mM levamisole according to manufacturer's instructions.

[0079] The results of these assays are shown in FIGS. 8A and 8B. Antisense AKAP110 riboprobe specifically hybridized to the seminiferous epithelium, and no hybridization was detected in either the interstitial tissue or in the peritubular and Sertoli cells of the seminiferous tubules, as shown in FIG. 8A produced by hybridization with the antisense probe. AKAP110 exhibited a stage-specific expression pattern in germ cells. No hybridization signal was detected in spermatogonia or spermatocytes, but expression was evident in round spermatids (FIG. 8B). FIG. 8C, which was hybridized with a sense-oriented probe showed no hybridization, as expected.

[0080] Intracellular localization of AKAP110 in sperm was determined by immunostaining. Ejaculated and epididymal caudal bovine sperm were collected by centrifugation at 1000×g for 10 min, then washed twice by resuspension in Hanks' saline or phosphate buffered saline (PBS) followed by centrifugation as above. Sperm were permeabilized either before or after fixation; no difference was found in the experimental results obtained. For permeabilizing sperm before fixation, the sperm were incubated at 4° C. for 30 min in a solution of 0.25% Triton X-100, 10 mm DTT, 150 mM NaCl, 25 mM Tris-HCl (pH 7.5), 2 mM benzamidine, 1 &mgr;g/mL leupeptin, and 1 &mgr;g/mL pepstatin, and then fixed in 4% formaldehyde in 0.1M sodium phosphate (pH 7.4). For permeabilizing sperm after fixation, sperm were fixed in 4% formaldehyde in 0.1M sodium phosphate (pH 7.4) at 4° C., then permeabilized for 30 min by the addition of Triton X-100 to a final concentration of 0.25%. Sperm were then attached to a poly-lysine coated coverglass which was then incubated in absolute acetone at 20° C. for 10 min and air-dried; alternatively, the coverglass was used directly for immunostaining

[0081] Immunostaining was performed as follows. Sperm prepared as described above were rinsed in a solution of 10 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 0.1% Tween 20 (termed “TNT solution”), then incubated for 1 h in a blocking solution of TNT containing 5% normal donkey serum and 2.5% BSA. In parallel, coverslips were incubated at least 1 h in equal dilutions of preimmune serum or anti-AKAP110 antisera diluted in blocking solution. After incubation, slides were rinsed three times in TNT containing 1% donkey serum; the slides were then incubated 1 h with cy3-conjugated, affinity-purified, donkey anti-rabbit IgG (obtained from Jackson ImmunoResearch Labs, West Grove, Pa.). The slide was then rinsed three times in TNT and observed by fluorescence and phase contrast microscopy; these results are shown in FIG. 9.

[0082] Ejaculated and caudal epididymal sperm exhibited identical specific staining patterns with anti-AKAP110 antisera, and no differences in staining were detected if the sperm were permeabilized before or after formaldehyde fixation. The flagellum and acrosomal regions were specifically stained with anti-AKAP110 antibody. Intense fluorescence was detected in the anterior acrosomal segment (shown in FIG. 9 and designated AC), but no staining was detected over the equatorial or post acrosomal segments of the head. Detached acrosomal caps also exhibited intense fluorescence (shown in FIG. 9 and designated AC*), and no fluorescence was detected on sperm heads after release of the acrosomal cap (shown in FIG. 9 and designated H). Specific fluorescence was detected over the full extent of the flagellum. No fluorescence staining was detected in matched sample incubated with preimmune serum (shown in FIG. 9 and designated B).

[0083] This pattern of AKAP110 localization is consistent with this protein being a dual AKAP, that is, being capable of binding to both the RI (found predominantly in sperm head) and RII (found predominantly in sperm flagellum) isoforms. The localization of AKAP in the acrosomal region of the sperm head suggests that disruption of this interaction may be a useful way of preventing fertilization.

EXAMPLE 6

Disruption of AKAP110/PKA Binding to Achieve Contraception in Adults

[0084] Isolation of mammalian AKAP110 cDNA as disclosed above enabled production of AKAP110 by recombinant genetic means. As described above, the cDNA inserts were cloned into an expression vector, pET30A, and introduced into E. coli cells. pET30A contains a Histidine tag sequence that was used to purify the fusion protein. Recombinant AKAP110 protein was recovered from said E. coli cells transformed with recombinant expression constructs comprising AKAP110-encoding cDNA.

[0085] The observation that disruption of AKAP:PKA binding inhibits sperm motility suggested that a high throughput in vitro screening system for detecting compounds that inhibit the AKAP:PKA interaction is useful for developing compounds useful as contraceptives. For example, a pharmaceutical compound directed at preventing or inhibiting sperm motility would provide for the first time a “male” contraceptive. This approach is particularly attractive, since Northern blot analysis of AKAP110 mRNA expression in a variety of tissues indicated that AKAP110 was specifically and exclusively expressed in male germ cells such as spermatogonia. Thus, any compound directed at specifically disrupting AKAP110:PKA binding has the potential for being used to develop a male contraceptive having minimal side effects on AKAP:PKA interactions in cell types other than sperm.

[0086] One embodiment of a high throughput analytical system comprises using a variant of the RII overlay assay described above to screen compounds for the capacity to prevent binding of a detectably-labeled RII protein. Recombinant RII&agr; is commercially available (Promega, Madison, Wis.), and can be detectably labeled with a radioactive, fluorescent or antigenic label. Alternatively, RII binding can be detected using RII-specific antibodies, which are also commercially available (Transduction Labs, Lexington, Ky.). Such assays are performed whereby the anti-RII antibodies are labeled directly, or in so-called “sandwich” assays using a labeled antibody specific for the anti-RII antibody (such as a using a labeled goat anti-rabbit antibody to detect rabbit polyclonal antisera as described above in Example 5). RII binding, and the disruption of RII binding in the presence of a test compound, can thereby be detected using either detectably-labeled recombinant RII or antibodies therefore, in binding assays using the recombinantly-produced AKAP110 proteins of the invention.

[0087] In alternative embodiments of these types of assays, recombinantly available AKAP110 or PKA is attached to a solid substrate, covalently or otherwise, and RII binding of said substrate is assayed analogous to either ELISA or radioimmune assay. In other embodiments, said solid substrate comprises materials such as chromatographic beads and other supports to which binding can be detected. These embodiments are particularly adapted for developing automated assays for screening a large number of compounds simultaneously. Also provided are competitive assays used to characterize binding affinities and inhibition constants of various binding inhibitors.

[0088] Alternatively, antisense oligonucleotides are used to inhibit, disrupt or prevent expression of AKAP110 in testis cells. An example of such an antisense oligonucleotide is one complementary to the sequence surrounding the initiation codon of AKAP110:

[0089] GCTTTGTAACCAGTCAACCTTTTCTGACAT (SEQ ID No. 18).

[0090] It should be understood that the foregoing disclosure emphasizes certain specific embodiments of the invention and that all modifications or alternatives equivalent thereto are within the spirit and scope of the invention as set forth in the appended claims.

Claims

1. A homogeneous composition of a mammalian sperm-specific protein kinase A anchoring protein having an apparent molecular weight of about 110 kildaltons.

2. A homogeneous composition of a human sperm-specific protein kinase A anchoring protein according to claim 1, having an amino acid sequence identified by Seq. ID No. 16.

3. A homogeneous composition of a bovine sperm-specific protein kinase A anchoring protein according to claim 1, having an amino acid sequence identified by Seq. ID No. 14.

4. A homogeneous composition of a murine sperm-specific protein kinase A anchoring protein according to claim 1, having an amino acid sequence identified by Seq. ID No. 12.

5. A method of screening a compound as an inhibitor of binding between a mammalian sperm-specific protein kinase A anchoring protein having an apparent molecular weight of about 110 kilodaltons and a regulatory subunit of protein kinase A, the method comprising the following steps:

(a) providing a first preparation of an isolated mammalian sperm-specific protein kinase A anchoring protein having an apparent molecular weight of about 110 kilodaltons;

(b) providing a second preparation of an isolated regulatory subunit of protein kinase A;

(c) contacting the first and second preparations under conditions permissible for binding of the protein kinase A anchoring protein and the regulatory subunit of protein kinase A in the presence or absence of the compound; and

(d) detecting a reduction in binding between the protein kinase A anchoring protein and the regulatory subunit of protein kinase A in the presence of the compound compared with binding in the absence of the compound.

6. The method of claim 5, wherein either the protein kinase A anchoring protein or the regulatory subunit of protein kinase A is detectably-labeled.

7. The method of claim 5, wherein the protein kinase A anchoring protein has an amino acid sequence identified by Seq. ID No. 16.

8. The method of claim 5, wherein the protein kinase A anchoring protein has an amino acid sequence identified by Seq. ID No. 14.

9. The method of claim 5, wherein the protein kinase A anchoring protein has an amino acid sequence identified by Seq. ID No. 12.

10. The method of claim 5, wherein either the protein kinase A anchoring protein or the regulatory subunit of protein kinase A is covalently attached to a solid substrate.

11. An antibody or fragment thereof that is immunologically reactive to a mammalian sperm-specific protein kinase A anchoring protein having an apparent molecular weight of 110 kilodaltons.

12. The antibody or fragment thereof according to claim 11, wherein the antibody is a monoclonal antibody.

13. The antibody or fragment thereof according to claim 11, wherein the protein kinase A anchoring protein is human sperm-specific protein kinase A anchoring protein having amino acid sequence identified by Seq. ID No. 16.

14. The antibody or fragment thereof according to claim 11, wherein the protein kinase A anchoring protein is bovine sperm-specific protein kinase A anchoring protein having amino acid sequence identified by Seq. ID No. 14.

15. The antibody or fragment thereof according to claim 11, wherein the protein kinase A anchoring protein is murine sperm-specific protein kinase A anchoring protein having amino acid sequence identified by Seq. ID No. 12.

16. A cell line which produces an antibody or fragment thereof that is immunologically reactive to a mammalian sperm-specific protein kinase A anchoring protein having an apparent molecular weight of 110 kilodaltons.

17. The cell line according to claim 17, wherein the antibody is a monoclonal antibody.

18. The cell line according to claim 17, wherein the mammalian protein kinase A anchoring protein is human sperm-specific protein kinase A anchoring protein having amino acid sequence identified by Seq. ID No. 16.

19. The cell line according to claim 17, wherein the mammalian protein kinase A anchoring protein is bovine sperm-specific protein kinase A anchoring protein having amino acid sequence identified by Seq. ID No. 14.

20. The cell line according to claim 17, wherein the mammalian protein kinase A anchoring protein is murine sperm-specific protein kinase A anchoring protein having amino acid sequence identified by Seq. ID No. 12.

21. An epitope of a mammalian protein kinase A anchoring protein is murine sperm-specific protein kinase A wherein the epitope is immunologically reactive to the antibody or fragment thereof according to claim 11.

22. The epitope according to claim 21 wherein the mammalian protein kinase A anchoring protein is human sperm-specific protein kinase A.

23. The epitope according to claim 21 wherein the mammalian protein kinase A anchoring protein is murine sperm-specific protein kinase A.

24. The epitope according to claim 21 wherein the mammalian protein kinase A anchoring protein is bovine sperm-specific protein kinase A.

25. The epitope according to claim 24 wherein the epitope has an amino acid sequence identified selected from the group consisting of Seq. ID Nos.: 1, 2, 3, 4, 5, 6, 7, 16 and 17.