GENE PRODUCTS DIFFERENTIALLY EXPRESSED IN CANCEROUS CELLS

The present invention provides polynucleotides, as well as polypeptides encoded thereby, that are differentially expressed in cancer cells. These polynucleotides are useful in a variety of diagnostic and therapeutic methods. The present invention further provides methods of reducing growth of cancer cells. These methods are useful for treating cancer.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a divisional of U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 now U.S. Pat. No. 7,700,359, filed Sep. 22, 2004, which is continuation-in-part of and claims priority to U.S. application Ser. No. 10/616,900, filed on Jul. 9, 2003, which is a continuation of U.S. application Ser. No. 09/872,850, filed on Jun. 1, 2001, now abandoned, which claims the benefit of U.S. provisional application Ser. No. 60/208,871, filed on Jun. 2, 2000. U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 is a continuation-in-part of and claims priority to U.S. application Ser. No. 10/081,519, filed on Feb. 21, 2002, now abandoned, which claims the benefit of U.S. provisional application Ser. No. 60/270,959, filed on Feb. 21, 2001. U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 is also a continuation-in-part of and claims priority to U.S. application Ser. No. 10/310,673, filed on Dec. 4, 2002, now abandoned, which claims the benefit of U.S. provisional application Ser. No. 60/336,613, filed on Dec. 4, 2001. U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 is also a continuation-in-part of and claims priority to U.S. application Ser. No. 10/501,187, filed as a National stage of international application No. PCT/US2003/000657, filed on Jan. 8, 2003, which claims the benefit of U.S. provisional application Ser. No. 60/345,637, filed on Jan. 8, 2002. U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 is also a continuation-in-part of and claims priority to U.S. application Ser. No. 10/081,124, filed on Feb. 21, 2002, now abandoned, which claims the benefit of U.S. provisional application Ser. No. 60/270,855, filed on Feb. 21, 2001. U.S. patent application Ser. No. 12/725,341, filed on Mar. 16, 2010, which is a continuation of U.S. application Ser. No. 10/948,737 is also a continuation-in-part of and claims priority to application PCT/US2004/015421, filed on May 13, 2004, which claims the benefit of U.S. provisional application Ser. No. 60/475,872, filed on Jun. 3, 2003. The contents of each of the preceding applications is incorporated by reference in its entirety.

SUBMISSION OF SEQUENCE LISTING AND TABLES ON ASCII TEXT FILES

The content of the following submission on ASCII text file is incorporated herein by reference in its entirety: a computer readable form (CRF) of the Sequence Listing (file name: 223002106810SEQLIST.txt, date recorded: Jun. 6, 2012, size: 8,697 kilobytes).

The contents of the following submissions on ASCII text files are incorporated herein by reference in their entirety: Table 7 (70 kilobytes); Table 16 (254 kilobytes); Table 17 (407 kilobytes); Table 33 (603 kilobytes); Table 35 (379 kilobytes); Table 36 (985 kilobytes); and Table 37 (518 kilobytes). These tables were recorded on Feb. 23, 2010.

FIELD OF THE INVENTION

The present invention relates to polynucleotides of human origin in substantially isolated form and gene products that are differentially expressed in cancer cells, and uses thereof.

BACKGROUND OF THE INVENTION

Cancer, like many diseases, is not the result of a single, well-defined cause, but rather can be viewed as several diseases, each caused by different aberrations in informational pathways, that ultimately result in apparently similar pathologic phenotypes. Identification of polynucleotides that correspond to genes that are differentially expressed in cancerous, pre-cancerous, or low metastatic potential cells relative to normal cells of the same tissue type, provides the basis for diagnostic tools, facilitates drug discovery by providing for targets for candidate agents, and further serves to identify therapeutic targets for cancer therapies that are more tailored for the type of cancer to be treated.

Identification of differentially expressed gene products also furthers the understanding of the progression and nature of complex diseases such as cancer, and is key to identifying the genetic factors that are responsible for the phenotypes associated with development of, for example, the metastatic phenotype. Identification of gene products that are differentially expressed at various stages, and in various types of cancers, can both provide for early diagnostic tests, and further serve as therapeutic targets. Additionally, the product of a differentially expressed gene can be the basis for screening assays to identify chemotherapeutic agents that modulate its activity (e.g. its expression, biological activity, and the like).

Early disease diagnosis is of central importance to halting disease progression, and reducing morbidity. Analysis of a patient's tumor to identify the gene products that are differentially expressed, and administration of therapeutic agent(s) designed to modulate the activity of those differentially expressed gene products, provides the basis for more specific, rational cancer therapy that may result in diminished adverse side effects relative to conventional therapies. Furthermore, confirmation that a tumor poses less risk to the patient (e.g., that the tumor is benign) can avoid unnecessary therapies. In short, identification of genes and the encoded gene products that are differentially expressed in cancerous cells can provide the basis of therapeutics, diagnostics, prognostics, therametrics, and the like.

For example, breast cancer is a leading cause of death among women. One of the priorities in breast cancer research is the discovery of new biochemical markers that can be used for diagnosis, prognosis and monitoring of breast cancer. The prognostic usefulness of these markers depends on the ability of the marker to distinguish between patients with breast cancer who require aggressive therapeutic treatment and patients who should be monitored.

While the pathogenesis of breast cancer is unclear, transformation of non-tumorigenic breast epithelium to a malignant phenotype may be the result of genetic factors, especially in women under 30 (Miki, et al., Science, 266: 66-71, 1994). However, it is likely that other, non-genetic factors are also significant in the etiology of the disease. Regardless of its origin, breast cancer morbidity increases significantly if a lesion is not detected early in its progression. Thus, considerable effort has focused on the elucidation of early cellular events surrounding transformation in breast tissue. Such effort has led to the identification of several potential breast cancer markers.

Thus, the identification of new markers associated with cancer, for example, breast cancer, and the identification of genes involved in transforming cells into the cancerous phenotype, remains a significant goal in the management of this disease. In exemplary aspects, the invention described herein provides cancer diagnostics, prognostics, therametrics, and therapeutics based upon polynucleotides and/or their encoded gene products.

SUMMARY OF THE INVENTION

The present invention provides methods and compositions useful in detection of cancerous cells, identification of agents that modulate the phenotype of cancerous cells, and identification of therapeutic targets for chemotherapy of cancerous cells. Cancerous prostate cells are of particular interest in each of these aspects of the invention. More specifically, the invention provides polynucleotides, as well as polypeptides encoded thereby, that are differentially expressed in prostate cancer cells. Also provided are antibodies that specifically bind the encoded polypeptides. These polynucleotides, polypeptides and antibodies are thus useful in a variety of diagnostic, therapeutic, and drug discovery methods. In some embodiments, a polynucleotide that is differentially expressed in prostate cancer cells can be used in diagnostic assays to detect prostate cancer cells. In other embodiments, a polynucleotide that is differentially expressed in prostate cancer cells, and/or a polypeptide encoded thereby, is itself a target for therapeutic intervention.

Accordingly, in one aspect the invention provides a method for detecting a cancerous prostate cell. In general, the method involves contacting a test sample obtained from a cell that is suspected of being a prostate cancer cell with a probe for detecting a gene product differentially expressed in prostate cancer. Many embodiments of the invention involve a gene identifiable or comprising a sequence selected from the group consisting of SEQ ID NOS: 1-13996, contacting the probe and the gene product for a time sufficient for binding of the probe to the gene product; and comparing a level of binding of the probe to the sample with a level of probe binding to a control sample obtained from a control prostate cell of known cancerous state. A modulated (i.e. increased or decreased) level of binding of the probe in the test prostate cell sample relative to the level of binding in a control sample is indicative of the cancerous state of the test prostate cell. In certain embodiments, the level of binding of the probe in the test cell sample, usually in relation to at least one control gene, is similar to binding of the probe to a cancerous cell sample. In certain other embodiments, the level of binding of the probe in the test cell sample, usually in relation to at least one control gene, is different, i.e. opposite, to binding of the probe to a non-cancerous cell sample. In specific embodiments, the probe is a polynucleotide probe and the gene product is nucleic acid. In other specific embodiments, the gene product is a polypeptide. In further embodiments, the gene product or the probe is immobilized on an array.

In another aspect, the invention provides a method for assessing the cancerous phenotype (e.g., metastasis, metatstatic potential, aberrant cellular proliferation, and the like) of a prostate cell comprising detecting expression of a gene product in a test prostate cell sample, wherein the gene comprises a sequence selected from the group consisting of SEQ ID NOS: 1-13996; and comparing a level of expression of the gene product in the test prostate cell sample with a level of expression of the gene in a control cell sample. Comparison of the level of expression of the gene in the test cell sample relative to the level of expression in the control cell sample is indicative of the cancerous phenotype of the test cell sample. In specific embodiments, detection of gene expression is by detecting a level of an RNA transcript in the test cell sample. In other specific embodiments detection of expression of the gene is by detecting a level of a polypeptide in a test sample.

In another aspect, the invention provides a method for suppressing or inhibiting a cancerous phenotype of a cancerous cell, the method comprising introducing into a mammalian cell an expression modulatory agent (e.g. an antisense molecule, small molecule, antibody, neutralizing antibody, inhibitory RNA molecule, etc.) to inhibition of expression of a gene identified by a sequence selected from the group consisting of SEQ ID NOS: 1-13996. Inhibition of expression of the gene inhibits development of a cancerous phenotype in the cell. In specific embodiments, the cancerous phenotype is metastasis, aberrant cellular proliferation relative to a normal cell, or loss of contact inhibition of cell growth. In the context of this invention “expression” of a gene is intended to encompass the expression of an activity of a gene product, and, as such, inhibiting expression of a gene includes inhibiting the activity of a product of the gene.

In another aspect, the invention provides a method for assessing the tumor burden of a subject, the method comprising detecting a level of a differentially expressed gene product in a test sample from a subject suspected of or having a tumor, the differentially expressed gene product comprising a sequence selected from the group consisting of SEQ ID NOS: 1-13996. Detection of the level of the gene product in the test sample is indicative of the tumor burden in the subject.

In another aspect, the invention provides a method for identifying a gene product as a target for a cancer therapeutic, the method comprising contacting a cancerous cell expressing a candidate gene product with an anti-cancer agent, wherein the candidate gene product corresponds to a sequence selected from the group consisting of SEQ ID NOS: 1-13996; and analyzing the effect of the anti-cancer agent upon a biological activity of the candidate gene product and/or upon a cancerous phenotype of the cancerous cell. Modulation of the biological activity of the candidate gene product and modulation of the cancerous phenotype of the cancerous cell indicates the candidate gene product is a target for a cancer therapeutic. In specific embodiments, the cancerous cell is a cancerous prostate cell. In other specific embodiments, the inhibitor is an antisense oligonucleotide. In further embodiments, the cancerous phenotype is aberrant cellular proliferation relative to a normal cell, or colony formation due to loss of contact inhibition of cell growth.

In another aspect, the invention provides a method for identifying agents that modulate (i.e. increase or decrease) the biological activity of a gene product differentially expressed in a cancerous cell, the method comprising contacting a candidate agent with a differentially expressed gene product, the differentially expressed gene product corresponding to a sequence selected from the group consisting of SEQ ID NOS: 1-13996; and detecting a modulation in a biological activity of the gene product relative to a level of biological activity of the gene product in the absence of the candidate agent. In specific embodiments, the detecting is by identifying an increase or decrease in expression of the differentially expressed gene product. In other specific embodiments, the gene product is mRNA or cDNA prepared from the mRNA gene product. In further embodiments, the gene product is a polypeptide.

In another aspect, the invention provides a method of inhibiting growth of a tumor cell by modulating expression of a gene product, where the gene product is encoded by a gene identified by a sequence selected from the group consisting of: SEQ ID NOS:1-13996.

The invention provides a method of determining the cancerous state of a cell, comprising detecting a level of a product of a gene in a test cell wherein said gene is defined by a sequence selected from a group consisting of SEQ ID NOS:1-13996 wherein the cancerous state of the test cell is indicated by detection of said level and comparison to a control level of said gene product. In certain embodiments of this method, the gene product is a nucleic acid or a polypeptide. In certain embodiments of this method, the gene product is immobilized on an array. In one embodiment of this method, the control level is a level of said gene product associated with a control cell of known cancerous state. In other embodiments of this method, the known cancerous state is a non-cancerous state. In another embodiment of this method, the level differs from the control level by at least two fold, indicating the test cell is not of the same cancerous state as that indicated by the control level.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a schematic showing the alignment of the sequences (represented by single lines) that resulted in the assembly of the contig (represented by the bars in the lower portion of the figure).

FIGS. 2-17 are graphs showing the expression profiles of the genes of Group 1.

FIGS. 18-21 are graphs showing the expression profiles of the genes of Group 2. In addition to the figures described above, the application also includes Tables 11-13A-B, as well as a Sequence Listing.

FIG. 22 is a table showing the expression of condroitin 4-O sulfotransferase 2 (C4S-2) in cancer versus normal cells, as determined by microarray analysis.

FIG. 23 is a bar graph showing C4S-2 mRNA expression in laser capture microdissected tissues, as determined by quantitative PCR analysis.

FIG. 24 is a bar graph showing C4S-2 mRNA expression in tissue samples.

FIG. 25 is a bar graph showing C4S-2 mRNA expression in prostate cell lines.

FIG. 26 is a table of antisense polynucleotides, directed against C4S-2.

FIG. 27 is a table of inhibitory RNA polynucleotides, directed against C4S-2.

FIG. 28 is two line graphs showing the effect of C4S-2 antisense molecules on growth of PC3 cells.

FIG. 29 is a line graph showing the effect of C4S-2 antisense molecules on growth of MDA PCa 2b cells.

FIG. 30 is a bar graph showing the effects of C4S-2 antisense molecules on PC3 growth in soft-agar.

FIG. 31 is two line graphs showing the effects of C4S-2 antisense molecules on growth of MDA PCa 2b cells growth in soft-agar.

FIGS. 32A-D show the effects of C4S-2 antisense molecules on MDA PCa 2b spheroids. FIGS. 32A-C are photographs of spheroids. FIG. 32D is a bar graph showing LDH ratios.

FIG. 33A-C show the effects of C4S-2 antisense molecules on MRC9 cells.

FIG. 33A is a graph of cytotoxicity. FIG. 33B is a graph showing relative mRNA expression of C4S-2 in cell lines. FIG. 33C is a panel of photographs of MRC9 cells.

FIG. 34 is a three dimensional bar graph showing effects of C4S-2 antisense molecules on 184B5 cell cytotoxicity.

FIG. 35 is a composite of graphs showing effects of C4S-2 antisense molecules on 184B5 and MRC9 cell proliferation.

FIG. 36 is a table of genes that are co-regulated with C4S-2.

FIG. 37 is a sequence alignment of mouse C4S-2 (top) and human C4S-2 (bottom).

FIG. 38 is three panels of autoradiographs showing expression of GAK polypeptide in different cell lines.

FIG. 39 is a graph of a hydropathy plot and a table showing the hydrophobic regions of DKFZp566I133.

FIG. 40 is six panels of photographs of MDA-231 cells exposed to C180-7, C180-8 and positive control antisense (AS) and control (RC) oligonucleotides.

FIG. 41 is an alignment of spot ID 22793 and spot ID 26883.

FIG. 42 is a figure of three sequence alignments showing the mapping of each of three sequences onto VMP1 (DKFZ).

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides polynucleotides, as well as polypeptides encoded thereby, that are differentially expressed in cancer cells. Methods are provided in which these polynucleotides and polypeptides are used for detecting and reducing the growth of cancer cells. Also provided are methods in which the polynucleotides and polypeptides of the invention are used in a variety of diagnostic and therapeutic applications for cancer. The invention finds use in the prevention, treatment, detection or research into any cancer, including prostrate, pancreas, colon, brain, lung, breast, bone, skin cancers. For example, the invention finds use in the prevention, treatment, detection of or research into endocrine system cancers, such as cancers of the thyroid, pituitary, and adrenal glands and the pancreatic islets; gastrointestinal cancers, such as cancer of the anus, colon, esophagus, gallbladder, stomach, liver, and rectum; genitourinary cancers such as cancer of the penis, prostate and testes; gynecological cancers, such as cancer of the ovaries, cervix, endometrium, uterus, fallopian tubes, vagina, and vulva; head and neck cancers, such as hypopharyngeal, laryngeal, oropharyngeal cancers, lip, mouth and oral cancers, cancer of the salivary gland, cancer of the digestive tract and sinus cancer; leukemia; lymphomas including Hodgkin's and non-Hodgkin's lymphoma; metastatic cancer; myelomas; sarcomas; skin cancer; urinary tract cancers including bladder, kidney and urethral cancers; and pediatric cancers, such as pediatric brain tumors, leukemia, lymphomas, sarcomas, liver cancer and neuroblastoma and retinoblastoma.

Before the present invention is described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications and patent applications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.

It must be noted that as used herein and in the appended claims, the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a polynucleotide” includes a plurality of such polynucleotides and reference to “the cancer cell” includes reference to one or more cells and equivalents thereof known to those skilled in the art, and so forth.

The publications and applications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

DEFINITIONS

The terms “polynucleotide” and “nucleic acid”, used interchangeably herein, refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxynucleotides. Thus, these terms include, but are not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. These terms further include, but are not limited to, mRNA or cDNA that comprise intronic sequences (see, e.g., Niwa et al. (1999) Cell 99(7):691-702). The backbone of the polynucleotide can comprise sugars and phosphate groups (as may typically be found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidites and thus can be an oligodeoxynucleoside phosphoramidate or a mixed phosphoramidate-phosphodiester oligomer. Peyrottes et al. (1996) Nucl. Acids Res. 24:1841-1848; Chaturvedi et al. (1996) Nucl. Acids Res. 24:2318-2323. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars, and linking groups such as fluororibose and thioate, and nucleotide branches. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or a solid support. The term “polynucleotide” also encompasses peptidic nucleic acids (Pooga et al Curr Cancer Drug Targets. (2001) 1:231-9).

A “gene product” is a biopolymeric product that is expressed or produced by a gene. A gene product may be, for example, an unspliced RNA, an mRNA, a splice variant mRNA, a polypeptide, a post-translationally modified polypeptide, a splice variant polypeptide etc. Also encompassed by this term is biopolymeric products that are made using an RNA gene product as a template (i.e. cDNA of the RNA). A gene product may be made enzymatically, recombinantly, chemically, or within a cell to which the gene is native. In many embodiments, if the gene product is proteinaceous, it exhibits a biological activity. In many embodiments, if the gene product is a nucleic acid, it can be translated into a proteinaceous gene product that exhibits a biological activity.

A composition (e.g. a polynucleotide, polypeptide, antibody, or host cell) that is “isolated” or “in substantially isolated form” refers to a composition that is in an environment different from that in which the composition naturally occurs. For example, a polynucleotide that is in substantially isolated form is outside of the host cell in which the polynucleotide naturally occurs, and could be a purified fragment of DNA, could be part of a heterologous vector, or could be contained within a host cell that is not a host cell from which the polynucleotide naturally occurs. The term “isolated” does not refer to a genomic or cDNA library, whole cell total protein or mRNA preparation, genomic DNA preparation, or an isolated human chromosome. A composition which is in substantially isolated form is usually substantially purified.

As used herein, the term “substantially purified” refers to a compound (e.g., a polynucleotide, a polypeptide or an antibody, etc.) that is removed from its natural environment and is usually at least 60% free, preferably 75% free, and most preferably 90% free from other components with which it is naturally associated. Thus, for example, a composition containing A is “substantially free of” B when at least 85% by weight of the total A+B in the composition is A. Preferably, A comprises at least about 90% by weight of the total of A+B in the composition, more preferably at least about 95% or even 99% by weight. In the case of polynucleotides, “A” and “B” may be two different genes positioned on different chromosomes or adjacently on the same chromosome, or two isolated cDNA species, for example.

The terms “polypeptide” and “protein”, interchangeably used herein, refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. The term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; and the like.

“Heterologous” refers to materials that are derived from different sources (e.g., from different genes, different species, etc.).

As used herein, the terms “a gene that is differentially expressed in a cancer cell,” and “a polynucleotide that is differentially expressed in a cancer cell” are used interchangeably herein, and generally refer to a polynucleotide that represents or corresponds to a gene that is differentially expressed in a cancerous cell when compared with a cell of the same cell type that is not cancerous, e.g., mRNA is found at levels at least about 25%, at least about 50% to about 75%, at least about 90%, at least about 1.5-fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, or at least about 50-fold or more, different (e.g., higher or lower). The comparison can be made in tissue, for example, if one is using in situ hybridization or another assay method that allows some degree of discrimination among cell types in the tissue. The comparison may also or alternatively be made between cells removed from their tissue source.

“Differentially expressed polynucleotide” as used herein refers to a nucleic acid molecule (RNA or DNA) comprising a sequence that represents a differentially expressed gene, e.g., the differentially expressed polynucleotide comprises a sequence (e.g., an open reading frame encoding a gene product; a non-coding sequence) that uniquely identifies a differentially expressed gene so that detection of the differentially expressed polynucleotide in a sample is correlated with the presence of a differentially expressed gene in a sample. “Differentially expressed polynucleotides” is also meant to encompass fragments of the disclosed polynucleotides, e.g., fragments retaining biological activity, as well as nucleic acids homologous, substantially similar, or substantially identical (e.g., having about 90% sequence identity) to the disclosed polynucleotides.

“Corresponds to” or “represents” when used in the context of, for example, a polynucleotide or sequence that “corresponds to” or “represents” a gene means that at least a portion of a sequence of the polynucleotide is present in the gene or in the nucleic acid gene product (e.g., mRNA or cDNA). A subject nucleic acid may also be “identified” by a polynucleotide if the polynucleotide corresponds to or represents the gene. Genes identified by a polynucleotide may have all or a portion of the identifying sequence wholly present within an exon of a genomic sequence of the gene, or different portions of the sequence of the polynucleotide may be present in different exons (e.g., such that the contiguous polynucleotide sequence is present in an mRNA, either pre- or post-splicing, that is an expression product of the gene). In some embodiments, the polynucleotide may represent or correspond to a gene that is modified in a cancerous cell relative to a normal cell. The gene in the cancerous cell may contain a deletion, insertion, substitution, or translocation relative to the polynucleotide and may have altered regulatory sequences, or may encode a splice variant gene product, for example. The gene in the cancerous cell may be modified by insertion of an endogenous retrovirus, a transposable element, or other naturally occurring or non-naturally occurring nucleic acid. In most cases, a polynucleotide corresponds to or represents a gene if the sequence of the polynucleotide is most identical to the sequence of a gene or its product (e.g. mRNA or cDNA) as compared to other genes or their products. In most embodiments, the most identical gene is determined using a sequence comparison of a polynucleotide to a database of polynucleotides (e.g. GenBank) using the BLAST program at default settings For example, if the most similar gene in the human genome to an exemplary polynucleotide is the protein kinase C gene, the exemplary polynucleotide corresponds to protein kinase C. In most cases, the sequence of a fragment of an exemplary polynucleotide is at least 95%, 96%, 97%, 98%, 99% or up to 100% identical to a sequence of at least 15, 20, 25, 30, 35, 40, 45, or 50 contiguous nucleotides of a corresponding gene or its product (mRNA or cDNA), when nucleotides that are “N” represent G, A, T or C.

An “identifying sequence” is a minimal fragment of a sequence of contiguous nucleotides that uniquely identifies or defines a polynucleotide sequence or its complement. In many embodiments, a fragment of a polynucleotide uniquely identifies or defines a polynucleotide sequence or its complement. In some embodiments, the entire contiguous sequence of a gene, cDNA, EST, or other provided sequence is an identifying sequence.

“Diagnosis” as used herein generally includes determination of a subject's susceptibility to a disease or disorder, determination as to whether a subject is presently affected by a disease or disorder, prognosis of a subject affected by a disease or disorder (e.g., identification of pre-metastatic or metastatic cancerous states, stages of cancer, or responsiveness of cancer to therapy), and use of therametrics (e.g., monitoring a subject's condition to provide information as to the effect or efficacy of therapy).

As used herein, the term “a polypeptide associated with cancer” refers to a polypeptide encoded by a polynucleotide that is differentially expressed in a cancer cell.

The term “biological sample” encompasses a variety of sample types obtained from an organism and can be used in a diagnostic or monitoring assay. The term encompasses blood and other liquid samples of biological origin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components. The term encompasses a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples.

The terms “treatment”, “treating”, “treat” and the like are used herein to generally refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and/or adverse effect attributable to the disease. “Treatment” as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or (c) relieving the disease symptom, i.e., causing regression of the disease or symptom.

The terms “individual,” “subject,” “host,” and “patient,” used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans. Other subjects may include cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and the like.

A “host cell”, as used herein, refers to a microorganism or a eukaryotic cell or cell line cultured as a unicellular entity which can be, or has been, used as a recipient for a recombinant vector or other transfer polynucleotides, and include the progeny of the original cell which has been transfected. It is understood that the progeny of a single cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation.

The terms “cancer”, “neoplasm”, “tumor”, and “carcinoma”, are used interchangeably herein to refer to cells which exhibit relatively autonomous growth, so that they exhibit an aberrant growth phenotype characterized by a significant loss of control of cell proliferation. In general, cells of interest for detection or treatment in the present application include precancerous (e.g., benign), malignant, pre-metastatic, metastatic, and non-metastatic cells. Detection of cancerous cells is of particular interest.

The term “normal” as used in the context of “normal cell,” is meant to refer to a cell of an untransformed phenotype or exhibiting a morphology of a non-transformed cell of the tissue type being examined.

“Cancerous phenotype” generally refers to any of a variety of biological phenomena that are characteristic of a cancerous cell, which phenomena can vary with the type of cancer. The cancerous phenotype is generally identified by abnormalities in, for example, cell growth or proliferation (e.g., uncontrolled growth or proliferation), regulation of the cell cycle, cell mobility, cell-cell interaction, or metastasis, etc.

“Therapeutic target” generally refers to a gene or gene product that, upon modulation of its activity (e.g., by modulation of expression, biological activity, and the like), can provide for modulation of the cancerous phenotype.

As used throughout, “modulation” is meant to refer to an increase or a decrease in the indicated phenomenon (e.g., modulation of a biological activity refers to an increase in a biological activity or a decrease in a biological activity).

As used herein a “Group I type tumor” is a tumor comprising cells that, relative to a non-cancer cell of the same tissue type, exhibit increased expression of a gene product encoded by at least one or more of the following genes: IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1.

As used herein a “Group II type tumor” is a tumor comprising cells that, relative to a non-cancer cell of the same tissue type, exhibit increased expression of a gene product encoded by at least one or more of the following genes: IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1.

As used herein a “Group I+II type tumor” is a tumor comprising cells that, relative to a non-cancer cell of the same tissue type, exhibit increased expression of 1) a gene product encoded by at least one or more of the following genes: IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and a gene product encoded by at least one or more of the following genes 2) IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1.

By “chondroitin 4-O sulfotransferase” is meant any polypeptide composition that exhibits chondroitin 4-O sulfotransferase activity. Examples of chondroitin 4-O sulfotransferases include chondroitin 4-O sulfotransferase-1, -2, -3, defined by NCBI accession numbers AAF81691, AAF81692, and AAM55481, respectively. Assays for determining whether a polypeptide has chondroitin 4-O sulfotransferase activity are described in Burkart & Wong (Anal Biochem 274:131-137 (1999)), and further described below. Variants of chondroitin 4-O sulfotransferase include enzymes that retain chondroitin 4-O sulfotransferase activity, i.e. a sulfotransferase activity that is specific for chondroitin over other substrates. Variants of chondroitin 4-O sulfotransferase-1, -2, -3 that retain biological activity may be produced by substituting amino acids that are in equivalent positions between two chondroitin 4-O sulfotransferases, such as chondroitin 4-O sulfotransferase-1 and chondroitin 4-O sulfotransferase-2. A chondroitin 4-O sulfotransferase activity of interest is chondroitin 4-O sulfotransferase 2, (C4S-2).

By “chondroitin 4-O sulfotransferase 2” is meant a polypeptide that has chondroitin 4-O sulfotransferase activity and has significant sequence identity to the chondroitin 4-O sulfotransferase 2 of humans (NCBI accession number NP061111) or mouse (NCBI accession number NP067503). The alignment between these two polypeptides (mouse C4S-2 at the top and human C4S-2 at the bottom) is shown in FIG. 37 (from Hiraoaka at al JBC 2000 275: 20188-96). Conserved sequences that are active sites, important for binding phosphate and phosphosulphate groups, are underlined in this figure. Variants of chondroitin 4-O sulfotransferase 2 that have chondroitin 4-O sulfotransferase 2 activity include the human and mice chondroitin 4-O sulfotransferase 2 polypeptides, and, for example, polypeptides that contain substitutions of amino acids at equivalent positions from e.g. the mouse to the human polypeptidies. Amino acids at positions 4, 16, 17, 28 and 29 are examples of such amino acids. Chondroitin 4-O sulfotransferase 2 has specificity for certain substrates with respect to other chondroitin 4-O sulfotransferases.

With regard to chondroitin 4-O sulfotransferases, further references of interest include Hiraoaka at al JBC 2000 275: 20188-96, Ricciardelli et al. Cancer Res. 1999 May 15; 59(10):2324-8, Ricciardelli et al. Clin Cancer Res. 1997 June; 3(6):983-92, Lida et al. Semin Cancer Biol. 1996 June; 7(3):155-62, Yamori et al. J Cell Biochem. 1988 April; 36(4):405-16, Denholm et al. Eur J. Pharmacol. 2001 Mar. 30; 416(3):213-21 and Bowman and Bertozzi Chem. Biol. 1999 January; 6(1):R9-R22.

A “chondroitin 4-O sulfotransferase-related disorder” is a disorder that is associated with the abnormal expression (i.e. increased or decreased expression) of a chondroitin 4-O sulfotransferase or variant thereof. In certain embodiments, the “chondroitin 4-O sulfotransferase-related disorder” is a “chondroitin 4-O sulfotransferase-2-related disorder” associated with the abnormal expression of chondroitin 4-O sulfotransferase-2 or a variant thereof. These disorders are usually related to cancer, in particular cancers of the breast, colon, lung, brain, skin etc. In certain embodiments, the disorder relates to prostate cancer.

By “cyclin G associated kinase”, or “GAK” is meant any polypeptide composition that exhibits cyclin G associated kinase activity. Examples of cyclin G associated kinase include the polypeptide defined by NCBI accession number XM003450, NM005255, NP005246 and NM031030. Assays for determining whether a polypeptide has cyclin G associated kinase activity are described in Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY. Variants of the human cyclin G associated kinase that retain biological activity may be produced by, inter alia, substituting amino acids that are in equivalent positions between two cyclin G associated kinases, such as the cyclin G associated kinases from rat and humans.

With regard to cyclin G associated kinases, further references of interest include: Kanaoka et al, FEBS Lett. 1997 Jan. 27; 402(1):73-80; Kimura et al, Genomics. 1997 Sep. 1; 44(2):179-87; Greener et al, J Biol. Chem. 2000 Jan. 14; 275(2):1365-70; and Korolchuk et al, Traffic. 2002 June; 3(6):428-39.

“DKFZP566I133” and “DKFZ” are used interchangeably herein to refer to a polypeptide composition that exhibits DKFZP566I133 activity. Assays for determining whether a polypeptide has DKFZP566I133 activity (i.e. for determining whether DKFZP566I133 may have intracytoplasmatic vacuole promoting activity) are described in Dusetti et al, (Biochem Biophys Res Commun. 2002 Jan. 18; 290(2):641-9). Variants of the DKFZP566I133 that retain biological activity may be produced by, inter alia, substituting amino acids that are in equivalent positions between two DKFZP566I133, such as the DKFZp566I133 from rat and humans. DKFZ is also known as VMP1, or vacuole membrane protein 1.

Alternatively, “DKFZP566I133”, or “DKFZ” refers to an amino acid sequence defined by NCBI accession number NP112200, AAH09758, NM138839, and NM030938, polynucleotides encoding the amino acid sequences set forth in these accession numbers (SEQ ID NO:3017 and SEQ ID NO: 3018, respectively).

In addition, “DKFZP566I133”, or “DKFZ” refers to the polynucleotide sequences represented by Spot ID NOS 22793, 26883 and 27450 (SEQ ID NOS: 2779-2780 and SEQ ID NOS: 2781-2782 and SEQ ID NOS:2964-2965, respectively). FIG. 41 shows an alignment between Spot ID NOS: 22793, 26883 and VMP1 (NM030938) (i.e. DKFZ), identifying a VMP1 or DKFZ gene product as corresponding to these spot IDs. FIG. 42 depicts fragments of Spot ID NOS 22793, 26883, 27450 which align with VMP1 (SEQ ID NOS 3019, 3020, and 3021 respectively). These fragments, or their encoded products, may also be used as a DKFZ identifying sequence.

Polynucleotide Compositions

The present invention provides isolated polynucleotides that contain nucleic acids that are differentially expressed in cancer cells. The polynucleotides, as well as any polypeptides encoded thereby, find use in a variety of therapeutic and diagnostic methods.

The scope of the invention with respect to compositions containing the isolated polynucleotides useful in the methods described herein includes, but is not necessarily limited to, polynucleotides having (i.e., comprising) a sequence set forth in any one of the polynucleotide sequences provided herein, or fragment thereof; polynucleotides obtained from the biological materials described herein or other biological sources (particularly human sources) by hybridization under stringent conditions (particularly conditions of high stringency); genes corresponding to the provided polynucleotides; cDNAs corresponding to the provided polynucleotides; variants of the provided polynucleotides and their corresponding genes, particularly those variants that retain a biological activity of the encoded gene product (e.g., a biological activity ascribed to a gene product corresponding to the provided polynucleotides as a result of the assignment of the gene product to a protein family(ies) and/or identification of a functional domain present in the gene product). Other nucleic acid compositions contemplated by and within the scope of the present invention will be readily apparent to one of ordinary skill in the art when provided with the disclosure here. “Polynucleotide” and “nucleic acid” as used herein with reference to nucleic acids of the composition is not intended to be limiting as to the length or structure of the nucleic acid unless specifically indicated.

The invention features polynucleotides that represent genes that are expressed in human tissue, specifically polynucleotides that are differentially expressed in tissues containing cancerous cells. Nucleic acid compositions described herein of particular interest are at least about 15 bp in length, at least about 30 bp in length, at least about 50 bp in length, at least about 100 bp, at least about 200 bp in length, at least about 300 bp in length, at least about 500 bp in length, at least about 800 bp in length, at least about 1 kb in length, at least about 2.0 kb in length, at least about 3.0 kb in length, at least about 5 kb in length, at least about 10 kb in length, at least about 50 kb in length and are usually less than about 200 kb in length. These polynucleotides (or polynucleotide fragments) have uses that include, but are not limited to, diagnostic probes and primers as starting materials for probes and primers, as discussed herein.

The subject polynucleotides usually comprise a sequence set forth in any one of the polynucleotide sequences provided herein, for example, in the sequence listing, incorporated by reference in a table (e.g. by an NCBI accession number), a cDNA deposited at the A.T.C.C., or a fragment or variant thereof. A “fragment” or “portion” of a polynucleotide is a contiguous sequence of residues at least about 10 nt to about 12 nt, 15 nt, 16 nt, 18 nt or 20 nt in length, usually at least about 22 nt, 24 nt, 25 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100 nt to at least about 150 nt, 200 nt, 250 nt, 300 nt, 350 nt, 400 nt, 500 nt, 800 nt or up to about 1000 nt, 1500 or 2000 nt in length. In some embodiments, a fragment of a polynucleotide is the coding sequence of a polynucleotide. A fragment of a polynucleotide may start at position 1 (i.e. the first nucleotide) of a nucleotide sequence provided herein, or may start at about position 10, 20, 30, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1500 or 2000, or an ATG translational initiation codon of a nucleotide sequence provided herein. In this context “about” includes the particularly recited value or a value larger or smaller by several (5, 4, 3, 2, or 1) nucleotides. The described polynucleotides and fragments thereof find use as hybridization probes, PCR primers, BLAST probes, or as an identifying sequence, for example.

The subject nucleic acids may be variants or degenerate variants of a sequence provided herein. In general, a variants of a polynucleotide provided herein have a fragment of sequence identity that is greater than at least about 65%, greater than at least about 70%, greater than at least about 75%, greater than at least about 80%, greater than at least about 85%, or greater than at least about 90%, 95%, 96%, 97%, 98%, 99% or more (i.e. 100%) as compared to an identically sized fragment of a provided sequence. as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular). For the purposes of this invention, a preferred method of calculating percent identity is the Smith-Waterman algorithm. Global DNA sequence identity should be greater than 65% as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1.

The subject nucleic acid compositions include full-length cDNAs or mRNAs that encompass an identifying sequence of contiguous nucleotides from any one of the polynucleotide sequences provided herein.

As discussed above, the polynucleotides useful in the methods described herein also include polynucleotide variants having sequence similarity or sequence identity. Nucleic acids having sequence similarity are detected by hybridization under low stringency conditions, for example, at 50° C. and 10×SSC (0.9 M saline/0.09 M sodium citrate) and remain bound when subjected to washing at 55° C. in 1×SSC. Sequence identity can be determined by hybridization under high stringency conditions, for example, at 50° C. or higher and 0.1×SSC (9 mM saline/0.9 mM sodium citrate). Hybridization methods and conditions are well known in the art, see, e.g., U.S. Pat. No. 5,707,829. Nucleic acids that are substantially identical to the provided polynucleotide sequences, e.g. allelic variants, genetically altered versions of the gene, etc., bind to the provided polynucleotide sequences under stringent hybridization conditions. By using probes, particularly labeled probes of DNA sequences, one can isolate homologous or related genes. The source of homologous genes can be any species, e.g. primate species, particularly human; rodents, such as rats and mice; canines, felines, bovines, ovines, equines, yeast, nematodes, etc.

In one embodiment, hybridization is performed using a fragment of at least 15 contiguous nucleotides (nt) of at least one of the polynucleotide sequences provided herein. That is, when at least 15 contiguous nt of one of the disclosed polynucleotide sequences is used as a probe, the probe will preferentially hybridize with a nucleic acid comprising the complementary sequence, allowing the identification and retrieval of the nucleic acids that uniquely hybridize to the selected probe. Probes from more than one polynucleotide sequence provided herein can hybridize with the same nucleic acid if the cDNA from which they were derived corresponds to one mRNA.

Polynucleotides contemplated for use in the invention also include those having a sequence of naturally occurring variants of the nucleotide sequences (e.g., degenerate variants (e.g., sequences that encode the same polypeptides but, due to the degenerate nature of the genetic code, different in nucleotide sequence), allelic variants, etc.). Variants of the polynucleotides contemplated by the invention are identified by hybridization of putative variants with nucleotide sequences disclosed herein, preferably by hybridization under stringent conditions. For example, by using appropriate wash conditions, variants of the polynucleotides described herein can be identified where the allelic variant exhibits at most about 25-30% base pair (bp) mismatches relative to the selected polynucleotide probe. In general, allelic variants contain 15-25% by mismatches, and can contain as little as even 5-15%, or 2-5%, or 1-2% by mismatches, as well as a single by mismatch.

The invention also encompasses homologs corresponding to any one of the polynucleotide sequences provided herein, where the source of homologous genes can be any mammalian species, e.g., primate species, particularly human; rodents, such as rats; canines, felines, bovines, ovines, equines, yeast, nematodes, etc. Between mammalian species, e.g., human and mouse, homologs generally have substantial sequence similarity, e.g., at least 75% sequence identity, usually at least 80%%, at least 85, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identity between nucleotide sequences. Sequence similarity is calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc. A reference sequence will usually be at least about a fragment of a polynucleotide sequence and may extend to the complete sequence that is being compared. Algorithms for sequence analysis are known in the art, such as gapped BLAST, described in Altschul, et al. Nucleic Acids Res. (1997) 25:3389-3402, or TeraBLAST available from TimeLogic Corp. (Crystal Bay, Nev.).

The subject nucleic acids can be cDNAs or genomic DNAs, as well as fragments thereof, particularly fragments that encode a biologically active gene product and/or are useful in the methods disclosed herein (e.g., in diagnosis, as a unique identifier of a differentially expressed gene of interest, etc.). The term “cDNA” as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons and 3′ and 5′ non-coding regions. Normally mRNA species have contiguous exons, with the intervening introns, when present, being removed by nuclear RNA splicing, to create a continuous open reading frame encoding a polypeptide. mRNA species can also exist with both exons and introns, where the introns may be removed by alternative splicing. Furthermore it should be noted that different species of mRNAs encoded by the same genomic sequence can exist at varying levels in a cell, and detection of these various levels of mRNA species can be indicative of differential expression of the encoded gene product in the cell.

A genomic sequence of interest comprises the nucleic acid present between the initiation codon and the stop codon, as defined in the listed sequences, including all of the introns that are normally present in a native chromosome. It can further include the 3′ and 5′ untranslated regions found in the mature mRNA. It can further include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc., including about 1 kb, but possibly more, of flanking genomic DNA at either the 5′ and 3′ end of the transcribed region. The genomic DNA can be isolated as a fragment of 100 kbp or smaller; and substantially free of flanking chromosomal sequence. The genomic DNA flanking the coding region, either 3′ and 5′, or internal regulatory sequences as sometimes found in introns, contains sequences required for proper tissue, stage-specific, or disease-state specific expression.

The nucleic acid compositions of the subject invention can encode all or a part of the naturally-occurring polypeptides. Double or single stranded fragments can be obtained from the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc.

Probes specific to the polynucleotides described herein can be generated using the polynucleotide sequences disclosed herein. The probes are usually a fragment of a polynucleotide sequences provided herein. The probes can be synthesized chemically or can be generated from longer polynucleotides using restriction enzymes. The probes can be labeled, for example, with a radioactive, biotinylated, or fluorescent tag. Preferably, probes are designed based upon an identifying sequence of any one of the polynucleotide sequences provided herein. More preferably, probes are designed based on a contiguous sequence of one of the subject polynucleotides that remain unmasked following application of a masking program for masking low complexity (e.g., XBLAST, RepeatMasker, etc.) to the sequence, i.e., one would select an unmasked region, as indicated by the polynucleotides outside the poly-n stretches of the masked sequence produced by the masking program.

The polynucleotides of interest in the subject invention are isolated and obtained in substantial purity, generally as other than an intact chromosome. Usually, the polynucleotides, either as DNA or RNA, will be obtained substantially free of other naturally-occurring nucleic acid sequences that they are usually associated with, generally being at least about 50%, usually at least about 90% pure and are typically “recombinant”, e.g., flanked by one or more nucleotides with which it is not normally associated on a naturally occurring chromosome.

The polynucleotides described herein can be provided as a linear molecule or within a circular molecule, and can be provided within autonomously replicating molecules (vectors) or within molecules without replication sequences. Expression of the polynucleotides can be regulated by their own or by other regulatory sequences known in the art. The polynucleotides can be introduced into suitable host cells using a variety of techniques available in the art, such as transferrin polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome-mediated DNA transfer, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, gene gun, calcium phosphate-mediated transfection, and the like.

The nucleic acid compositions described herein can be used to, for example, produce polypeptides, as probes for the detection of mRNA in biological samples (e.g., extracts of human cells) or cDNA produced from such samples, to generate additional copies of the polynucleotides, to generate ribozymes or antisense oligonucleotides, and as single stranded DNA probes or as triple-strand forming oligonucleotides. The probes described herein can be used to, for example, determine the presence or absence of any one of the polynucleotide provided herein or variants thereof in a sample. These and other uses are described in more detail below.

Polypeptides and Variants Thereof

The present invention further provides polypeptides encoded by polynucleotides that represent genes that are differentially expressed in cancer cells. Such polypeptides are referred to herein as “polypeptides associated with cancer.” The polypeptides can be used to generate antibodies specific for a polypeptide associated with cancer, which antibodies are in turn useful in diagnostic methods, prognostics methods, therametric methods, and the like as discussed in more detail herein. Polypeptides are also useful as targets for therapeutic intervention, as discussed in more detail herein.

The polypeptides contemplated by the invention include those encoded by the disclosed polynucleotides and the genes to which these polynucleotides correspond, as well as nucleic acids that, by virtue of the degeneracy of the genetic code, are not identical in sequence to the disclosed polynucleotides. Further polypeptides contemplated by the invention include polypeptides that are encoded by polynucleotides that hybridize to polynucleotide of the sequence listing. Thus, the invention includes within its scope a polypeptide encoded by a polynucleotide having the sequence of any one of the polynucleotide sequences provided herein, or a variant thereof.

In general, the term “polypeptide” as used herein refers to both the full length polypeptide encoded by the recited polynucleotide, the polypeptide encoded by the gene represented by the recited polynucleotide, as well as portions or fragments thereof. “Polypeptides” also includes variants of the naturally occurring proteins, where such variants are homologous or substantially similar to the naturally occurring protein, and can be of an origin of the same or different species as the naturally occurring protein (e.g., human, murine, or some other species that naturally expresses the recited polypeptide, usually a mammalian species). In general, variant polypeptides have a sequence that has at least about 80%, usually at least about 90%, and more usually at least about 98% sequence identity with a differentially expressed polypeptide described herein, as measured by BLAST 2.0 using the parameters described above. The variant polypeptides can be naturally or non-naturally glycosylated, i.e., the polypeptide has a glycosylation pattern that differs from the glycosylation pattern found in the corresponding naturally occurring protein.

The invention also encompasses homologs of the disclosed polypeptides (or fragments thereof) where the homologs are isolated from other species, i.e. other animal or plant species, where such homologs, usually mammalian species, e.g. rodents, such as mice, rats; domestic animals, e.g., horse, cow, dog, cat; and humans. By “homolog” is meant a polypeptide having at least about 35%, usually at least about 40% and more usually at least about 60% amino acid sequence identity to a particular differentially expressed protein as identified above, where sequence identity is determined using the BLAST 2.0 algorithm, with the parameters described supra.

In general, the polypeptides of interest in the subject invention are provided in a non-naturally occurring environment, e.g. are separated from their naturally occurring environment. In certain embodiments, the subject protein is present in a composition that is enriched for the protein as compared to a cell or extract of a cell that naturally produces the protein. As such, isolated polypeptide is provided, where by “isolated” or “in substantially isolated form” is meant that the protein is present in a composition that is substantially free of other polypeptides, where by substantially free is meant that less than 90%, usually less than 60% and more usually less than 50% of the composition is made up of other polypeptides of a cell that the protein is naturally found.

Also within the scope of the invention are variants; variants of polypeptides include mutants, fragments, and fusions. Mutants can include amino acid substitutions, additions or deletions. The amino acid substitutions can be conservative amino acid substitutions or substitutions to eliminate non-essential amino acids, such as to alter a glycosylation site, a phosphorylation site or an acetylation site, or to minimize misfolding by substitution or deletion of one or more cysteine residues that are not necessary for function. Conservative amino acid substitutions are those that preserve the general charge, hydrophobicity/hydrophilicity, and/or steric bulk of the amino acid substituted.

Variants can be designed so as to retain or have enhanced biological activity of a particular region of the protein (e.g., a functional domain and/or, where the polypeptide is a member of a protein family, a region associated with a consensus sequence). For example, muteins can be made which are optimized for increased antigenicity, i.e. amino acid variants of a polypeptide may be made that increase the antigenicity of the polypeptide. Selection of amino acid alterations for production of variants can be based upon the accessibility (interior vs. exterior) of the amino acid (see, e.g., Go et al, Int. J. Peptide Protein Res. (1980) 15:211), the thermostability of the variant polypeptide (see, e.g., Querol et al., Prot. Eng. (1996) 9:265), desired glycosylation sites (see, e.g., Olsen and Thomsen, J. Gen. Microbiol. (1991) 137:579), desired disulfide bridges (see, e.g., Clarke et al., Biochemistry (1993) 32:4322; and Wakarchuk et al., Protein Eng. (1994) 7:1379), desired metal binding sites (see, e.g., Toma et al., Biochemistry (1991) 30:97, and Haezerbrouck et al., Protein Eng. (1993) 6:643), and desired substitutions with in proline loops (see, e.g., Masul et al., Appl. Env. Microbiol. (1994) 60:3579). Cysteine-depleted muteins can be produced as disclosed in U.S. Pat. No. 4,959,314. Variants also include fragments of the polypeptides disclosed herein, particularly biologically active fragments and/or fragments corresponding to functional domains. Fragments of interest will typically be at least about 10 aa to at least about 15 aa in length, usually at least about 50 aa in length, and can be as long as 300 aa in length or longer, but will usually not exceed about 1000 aa in length, where the fragment will have a stretch of amino acids that is identical to a polypeptide encoded by a polynucleotide having a sequence of any one of the polynucleotide sequences provided herein, or a homolog thereof. The protein variants described herein are encoded by polynucleotides that are within the scope of the invention. The genetic code can be used to select the appropriate codons to construct the corresponding variants.

A fragment of a subject polypeptide is, for example, a polypeptide having an amino acid sequence which is a portion of a subject polypeptide e.g. a polypeptide encoded by a subject polynucleotide that is identified by any one of the sequence of SEQ ID NOS: 1-13996 or its complement. The polypeptide fragments of the invention are preferably at least about 9 aa, at least about 15 aa, and more preferably at least about 20 aa, still more preferably at least about 30 aa, and even more preferably, at least about 40 aa, at least about 50 aa, at least about 75 aa, at least about 100 aa, at least about 125 aa or at least about 150 aa in length. A fragment “at least 20 aa in length,” for example, is intended to include 20 or more contiguous amino acids from, for example, the polypeptide encoded by a cDNA, in a cDNA clone contained in a deposited library, or a nucleotide sequence shown in SEQ ID NOS: 1-13996 or the complementary stand thereof. In this context “about” includes the particularly recited value or a value larger or smaller by several (5, 4, 3, 2, or 1) amino acids. These polypeptide fragments have uses that include, but are not limited to, production of antibodies as discussed herein. Of course, larger fragments (e.g., at least 150, 175, 200, 250, 500, 600, 1000, or 2000 amino acids in length) are also encompassed by the invention.

Moreover, representative examples of polypeptides fragments of the invention (useful in, for example, as antigens for antibody production), include, for example, fragments comprising, or alternatively consisting of, a sequence from about amino acid number 1-10, 5-10, 10-20, 21-31, 31-40, 41-61, 61-81, 91-120, 121-140, 141-162, 162-200, 201-240, 241-280, 281-320, 321-360, 360-400, 400-450, 451-500, 500-600, 600-700, 700-800, 800-900 and the like. In this context “about” includes the particularly recited range or a range larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either terminus or at both termini. In some embodiments, these fragments has a functional activity (e.g., biological activity) whereas in other embodiments, these fragments may be used to make an antibody.

In one example, a polynucleotide having a sequence set forth in the sequence listing, containing no flanking sequences (i.e., consisting of the sequence set forth in the sequence listing), may be cloned into an expression vector having ATG and a stop codon (e.g. any one of the pET vector from Invitrogen, or other similar vectors from other manufactures), and used to express a polypeptide of interest encoded by the polynucleotide in a suitable cell, e.g., a bacterial cell. Accordingly, the polynucleotides may be used to produce polypeptides, and these polypeptides may be used to produce antibodies by known methods described above and below. In many embodiments, the sequence of the encoded polypeptide does not have to be known prior to its expression in a cell. However, if it desirable to know the sequence of the polypeptide, this may be derived from the sequence of the polynucleotide. Using the genetic code, the polynucleotide may be translated by hand, or by computer means. Suitable software for identifying open reading frames and translating them into polypeptide sequences are well know in the art, and include: Lasergene™ from DNAStar (Madison, Wis.), and Vector NTI™ from Informax (Frederick Md.), and the like.

Further polypeptide variants may are described in PCT publications WO/00-55173, WO/01-07611 and WO/02-16429

Vectors, Host Cells and Protein Production

The present invention also relates to vectors containing the polynucleotide of the present invention, host cells, and the production of polypeptides by recombinant techniques. The vector may be, for example, a phage, plasmid, viral, or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.

The polynucleotides of the invention may be joined to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.

The polynucleotide insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan. The expression constructs will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.

As indicated, the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.

Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)); insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293, and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.

Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNHSA, pNH16a, pNH18A, pNH46A, available from Stratagene Cloning Systems, Inc.; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS available from Pharmacia Biotech, Inc. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Preferred expression vectors for use in yeast systems include, but are not limited to pYES2, pYD1, pTEF1/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, pPIC9K, and PAO815 (all available from Invitrogen, Carload, Calif.). Other suitable vectors will be readily apparent to the skilled artisan.

Nucleic acids of interest may be cloned into a suitable vector by route methods. Suitable vectors include plasmids, cosmids, recombinant viral vectors e.g. retroviral vectors, YACs, BACs and the like, phage vectors.

Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology (1986). It is specifically contemplated that the polypeptides of the present invention may in fact be expressed by a host cell lacking a recombinant vector.

A polypeptide of this invention can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.

Polypeptides of the present invention can also be recovered from: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast higher plant, insect, and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host mediated processes. Thus, it is well known in the art that the N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.

Suitable methods and compositions for polypeptide expression may be found in PCT publications WO/00-55173, WO/01-07611 and WO/02-16429, and suitable methods and compositions for production of modified polypeptides may be found in PCT publications WO/00-55173, WO/01-07611 and WO/02-16429.

Antibodies and Other Polypeptide or Polynucleotide Binding Molecules

The present invention further provides antibodies, which may be isolated antibodies, that are specific for a polypeptide encoded by a polynucleotide described herein and/or a polypeptide of a gene that corresponds to a polynucleotide described herein. Antibodies can be provided in a composition comprising the antibody and a buffer and/or a pharmaceutically acceptable excipient. Antibodies specific for a polypeptide associated with cancer are useful in a variety of diagnostic and therapeutic methods, as discussed in detail herein.

Gene products, including polypeptides, mRNA (particularly mRNAs having distinct secondary and/or tertiary structures), cDNA, or complete gene, can be prepared and used for raising antibodies for experimental, diagnostic, and therapeutic purposes. Antibodies may be used to identify a gene corresponding to a polynucleotide. The polynucleotide or related cDNA is expressed as described above, and antibodies are prepared. These antibodies are specific to an epitope on the polypeptide encoded by the polynucleotide, and can precipitate or bind to the corresponding native protein in a cell or tissue preparation or in a cell-free extract of an in vitro expression system.

Antibodies

Further polypeptides of the invention relate to antibodies and T-cell antigen receptors (TCR) which immunospecifically bind a subject polypeptide, subject polypeptide fragment, or variant thereof, and/or an epitope thereof (as determined by immunoassays well known in the art for assaying specific antibody-antigen binding). Antibodies of the invention include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab′) fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope-binding fragments of any of the above. The term “antibody,” as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds an antigen. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule. Most preferably the antibodies are human antigen-binding antibody fragments of the present invention and include, but are not limited to, Fab. Fab′ and F(ab′)2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain. Antigen-binding antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entirety or a portion of the following: hinge region, CH1, CH2, and CH3 domains. Also included in the invention are antigen-binding fragments also comprising any combination of variable region(s) with a hinge region, CH1, CH2, and CH3 domains. The antibodies of the invention may be from any animal origin including birds and mammals. Preferably, the antibodies are human, murine (e.g., mouse and rat), donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken. As used herein, “human” antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from, human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin and that do not express endogenous immunoglobulins, as described infra and, for example in, U.S. Pat. No. 5,939,598 by Kucherlapati et al.

The antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553 (1992).

Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention which they recognize or specifically bind. The epitope(s) or polypeptide portion(s) may be specified as described herein, e.g., by N-terminal and C-terminal positions, or by size in contiguous amino acid residues. Antibodies which specifically bind any epitope or polypeptide of the present invention may also be excluded. Therefore, the present invention includes antibodies that specifically bind polypeptides of the present invention, and allows for the exclusion of the same.

Antibodies of the present invention may also be described or specified in terms of their cross-reactivity. Antibodies that do not bind any other analog, ortholog, or homolog of a polypeptide of the present invention are included. Antibodies that bind polypeptides with at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, and at least 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. In specific embodiments, antibodies of the present invention cross-react with murine, rat and/or rabbit homologs of human proteins and the corresponding epitopes thereof. Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. In a specific embodiment, the above-described cross-reactivity is with respect to any single specific antigenic or immunogenic polypeptide, or combination(s) of 2, 3, 4, 5, or more of the specific antigenic and/or immunogenic polypeptides disclosed herein. Further included in the present invention are antibodies which bind polypeptides encoded by polynucleotides which hybridize to a polynucleotide of the present invention under stringent hybridization conditions (as described herein). Antibodies of the present invention may also be described or specified in terms of their binding affinity to a polypeptide of the invention. Preferred binding affinities include those with a dissociation constant or Kd less 5×10−5M, 10−5M, 5×10−6 M, 10−6M, 5×10−7 M, 10−7M, 5×10−8M, 10−8 M, 5×10−9 M, 10−9 M, 5×10−1° M, 10−10 M, etc.

The invention also provides antibodies that competitively inhibit binding of an antibody to an epitope of the invention as determined by any method known in the art for determining competitive binding, for example, the immunoassays described herein. In preferred embodiments, the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%.

Methods for making screening, assaying, humanizing, and modifying different types of antibody are well known in the art and may be found in PCT publications WO/00-55173, WO/01-07611 and WO/02-16429.

In addition, the invention further provides polynucleotides comprising a nucleotide sequence encoding an antibody of the invention and fragments thereof. The invention also encompasses polynucleotides that hybridize under stringent or alternatively, under lower stringency hybridization conditions, e.g., as defined supra, to polynucleotides that encode an antibody, preferably, that specifically binds to a polypeptide of the invention, preferably, an antibody that binds to a subject polypeptide.

The antibodies of the invention can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques. Recombinant expression of an antibody of the invention, or fragment, derivative or analog thereof, (e.g., a heavy or light chain of an antibody of the invention or a single chain antibody of the invention), requires construction of an expression vector containing a polynucleotide that encodes the antibody. Once a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof (preferably containing the heavy or light chain variable domain), of the invention has been obtained, the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The invention, thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention, or a heavy or light chain thereof, or a heavy or light chain variable domain, operably linked to a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., PCT Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy or light chain.

The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention. Thus, the invention includes host cells containing a polynucleotide encoding an antibody of the invention, or a heavy or light chain thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter. In preferred embodiments for the expression of double-chained antibodies, vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.

A variety of host-expression vector systems may be utilized to express the antibody molecules of the invention. Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ. These include but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).

Antibodies production is well known in the art. Exemplary methods and compositions for making antibodies may be found in PCT publications WO/00-55173, WO/01-07611 and WO/02-16429.

Immunophenotyping

The antibodies of the invention may be utilized for immunophenotyping of cell lines and biological samples. The translation product of the gene of the present invention may be useful as a cell specific marker, or more specifically as a cellular marker that is differentially expressed at various stages of differentiation and/or maturation of particular cell types. Monoclonal antibodies directed against a specific epitope, or combination of epitopes, will allow for the screening of cellular populations expressing the marker. Various techniques can be utilized using monoclonal antibodies to screen for cellular populations expressing the marker(s), and include magnetic separation using antibody-coated magnetic beads, “panning” with antibody attached to a solid matrix (i.e., plate), and flow cytometry (See, e.g., U.S. Pat. No. 5,985,660; and Morrison et al. Cell, 96:737-49 (1999)).

These techniques allow for the screening of particular populations of cells, such as might be found with hematological malignancies (i.e. minimal residual disease (MRD) in acute leukemic patients) and “non-self cells in transplantations to prevent Graft-versus-Host Disease (GVHD). Alternatively, these techniques allow for the screening of hematopoietic stem and progenitor cells capable of undergoing proliferation and/or differentiation, as might be found in human umbilical cord blood.

Kits

Also provided by the subject invention are kits for practicing the subject methods, as described above. The subject kits include at least one or more of: a subject nucleic acid, isolated polypeptide or an antibody thereto. Other optional components of the kit include: restriction enzymes, control primers and plasmids; buffers, cells, carriers adjuvents etc. The nucleic acids of the kit may also have restrictions sites, multiple cloning sites, primer sites, etc to facilitate their ligation other plasmids. The various components of the kit may be present in separate containers or certain compatible components may be precombined into a single container, as desired. In many embodiments, kits with unit doses of the active agent, e.g. in oral or injectable doses, are provided. In certain embodiments, controls, such as samples from a cancerous or non-cancerous cell are provided by the invention. Further embodiments of the kit include an antibody for a subject polypeptide and a chemotherapeutic agent to be used in combination with the polypeptide as a treatment.

In addition to above-mentioned components, the subject kits typically further include instructions for using the components of the kit to practice the subject methods. The instructions for practicing the subject methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. As such, the instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging) etc. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, etc. In yet other embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.

Computer-Related Embodiments

In general, a library of polynucleotides is a collection of sequence information, which information is provided in either biochemical form (e.g., as a collection of polynucleotide molecules), or in electronic form (e.g., as a collection of polynucleotide sequences stored in a computer-readable form, as in a computer system and/or as part of a computer program). The sequence information of the polynucleotides can be used in a variety of ways, e.g., as a resource for gene discovery, as a representation of sequences expressed in a selected cell type (e.g., cell type markers), and/or as markers of a given disease or disease state. For example, in the instant case, the sequences of polynucleotides and polypeptides corresponding to genes differentially expressed in cancer, as well as the nucleic acid and amino acid sequences of the genes themselves, can be provided in electronic form in a computer database.

In general, a disease marker is a representation of a gene product that is present in all cells affected by disease either at an increased or decreased level relative to a normal cell (e.g., a cell of the same or similar type that is not substantially affected by disease). For example, a polynucleotide sequence in a library can be a polynucleotide that represents an mRNA, polypeptide, or other gene product encoded by the polynucleotide, that is either overexpressed or underexpressed in a cancerous cell affected by cancer relative to a normal (i.e., substantially disease-free) cell.

The nucleotide sequence information of the library can be embodied in any suitable form, e.g., electronic or biochemical forms. For example, a library of sequence information embodied in electronic form comprises an accessible computer data file (or, in biochemical form, a collection of nucleic acid molecules) that contains the representative nucleotide sequences of genes that are differentially expressed (e.g., overexpressed or underexpressed) as between, for example, i) a cancerous cell and a normal cell; ii) a cancerous cell and a dysplastic cell; iii) a cancerous cell and a cell affected by a disease or condition other than cancer; iv) a metastatic cancerous cell and a normal cell and/or non-metastatic cancerous cell; v) a malignant cancerous cell and a non-malignant cancerous cell (or a normal cell) and/or vi) a dysplastic cell relative to a normal cell. Other combinations and comparisons of cells affected by various diseases or stages of disease will be readily apparent to the ordinarily skilled artisan. Biochemical embodiments of the library include a collection of nucleic acids that have the sequences of the genes in the library, where the nucleic acids can correspond to the entire gene in the library or to a fragment thereof, as described in greater detail below.

The polynucleotide libraries of the subject invention generally comprise sequence information of a plurality of polynucleotide sequences, where at least one of the polynucleotides has a sequence of any of sequence described herein. By plurality is meant at least 2, usually at least 3 and can include up to all of the sequences described herein. The length and number of polynucleotides in the library will vary with the nature of the library, e.g., if the library is an oligonucleotide array, a cDNA array, a computer database of the sequence information, etc.

Where the library is an electronic library, the nucleic acid sequence information can be present in a variety of media. “Media” refers to a manufacture, other than an isolated nucleic acid molecule, that contains the sequence information of the present invention. Such a manufacture provides the genome sequence or a subset thereof in a form that can be examined by means not directly applicable to the sequence as it exists in a nucleic acid. For example, the nucleotide sequence of the present invention, e.g. the nucleic acid sequences of any of the polynucleotides of the sequences described herein, can be recorded on computer readable media, e.g. any medium that can be read and accessed directly by a computer. Such media include, but are not limited to: magnetic storage media, such as a floppy disc, a hard disc storage medium, and a magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media.

One of skill in the art can readily appreciate how any of the presently known computer readable mediums can be used to create a manufacture comprising a recording of the present sequence information. “Recorded” refers to a process for storing information on computer readable medium, using any such methods as known in the art. Any convenient data storage structure can be chosen, based on the means used to access the stored information. A variety of data processor programs and formats can be used for storage, e.g. word processing text file, database format, etc. In addition to the sequence information, electronic versions of libraries comprising one or more sequence described herein can be provided in conjunction or connection with other computer-readable information and/or other types of computer-readable files (e.g., searchable files, executable files, etc, including, but not limited to, for example, search program software, etc.).

By providing the nucleotide sequence in computer readable form, the information can be accessed for a variety of purposes. Computer software to access sequence information (e.g. the NCBI sequence database) is publicly available. For example, the gapped BLAST (Altschul et al., Nucleic Acids Res. (1997) 25:3389-3402) and BLAZE (Brutlag et al., Comp. Chem. (1993) 17:203) search algorithms on a Sybase system, or the TeraBLAST (TimeLogic, Crystal Bay, Nev.) program optionally running on a specialized computer platform available from TimeLogic, can be used to identify open reading frames (ORFs) within the genome that contain homology to ORFs from other organisms.

As used herein, “a computer-based system” refers to the hardware means, software means, and data storage means used to analyze the nucleotide sequence information of the present invention. The minimum hardware of the computer-based systems of the present invention comprises a central processing unit (CPU), input means, output means, and data storage means. A skilled artisan can readily appreciate that any one of the currently available computer-based system are suitable for use in the present invention. The data storage means can comprise any manufacture comprising a recording of the present sequence information as described above, or a memory access means that can access such a manufacture.

“Search means” refers to one or more programs implemented on the computer-based system, to compare a target sequence or target structural motif, or expression levels of a polynucleotide in a sample, with the stored sequence information. Search means can be used to identify fragments or regions of the genome that match a particular target sequence or target motif. A variety of known algorithms are publicly known and commercially available, e.g. MacPattern (EMBL), TeraBLAST (TimeLogic), BLASTN and BLASTX (NCBI). A “target sequence” can be any polynucleotide or amino acid sequence of six or more contiguous nucleotides or two or more amino acids, preferably from about 10 to 100 amino acids or from about 30 to 300 nt. A variety of means for comparing nucleic acids or polypeptides may be used to compare accomplish a sequence comparison (e.g., to analyze target sequences, target motifs, or relative expression levels) with the data storage means. A skilled artisan can readily recognize that any one of the publicly available homology search programs can be used to search the computer based systems of the present invention to compare of target sequences and motifs. Computer programs to analyze expression levels in a sample and in controls are also known in the art.

A “target structural motif,” or “target motif,” refers to any rationally selected sequence or combination of sequences in which the sequence(s) are chosen based on a three-dimensional configuration that is formed upon the folding of the target motif, or on consensus sequences of regulatory or active sites. There are a variety of target motifs known in the art. Protein target motifs include, but are not limited to, enzyme active sites and signal sequences, kinase domains, receptor binding domains, SH2 domains, SH3 domains, phosphorylation sites, protein interaction domains, transmembrane domains, etc. Nucleic acid target motifs include, but are not limited to, hairpin structures, promoter sequences and other expression elements such as binding sites for transcription factors.

A variety of structural formats for the input and output means can be used to input and output the information in the computer-based systems of the present invention. One format for an output means ranks the relative expression levels of different polynucleotides. Such presentation provides a skilled artisan with a ranking of relative expression levels to determine a gene expression profile. A gene expression profile can be generated from, for example, a cDNA library prepared from mRNA isolated from a test cell suspected of being cancerous or pre-cancerous, comparing the sequences or partial sequences of the clones against the sequences in an electronic database, where the sequences of the electronic database represent genes differentially expressed in a cancerous cell, e.g., a cancerous breast cell. The number of clones having a sequence that has substantial similarity to a sequence that represents a gene differentially expressed in a cancerous cell is then determined, and the number of clones corresponding to each of such genes is determined. An increased number of clones that correspond to differentially expressed gene is present in the cDNA library of the test cell (relative to, for example, the number of clones expected in a cDNA of a normal cell) indicates that the test cell is cancerous.

As discussed above, the “library” as used herein also encompasses biochemical libraries of the polynucleotides of the sequences described herein, e.g., collections of nucleic acids representing the provided polynucleotides. The biochemical libraries can take a variety of forms, e.g., a solution of cDNAs, a pattern of probe nucleic acids stably associated with a surface of a solid support (i.e., an array) and the like. Of particular interest are nucleic acid arrays in which one or more of the genes described herein is represented by a sequence on the array. By array is meant an article of manufacture that has at least a substrate with at least two distinct nucleic acid targets on one of its surfaces, where the number of distinct nucleic acids can be considerably higher, typically being at least 10 nt, usually at least 20 nt and often at least 25 nt. A variety of different array formats have been developed and are known to those of skill in the art. The arrays of the subject invention find use in a variety of applications, including gene expression analysis, drug screening, mutation analysis and the like, as disclosed in the above-listed exemplary patent documents.

In addition to the above nucleic acid libraries, analogous libraries of polypeptides are also provided, where the polypeptides of the library will represent at least a portion of the polypeptides encoded by a gene corresponding to a sequence described herein.

Diagnostic and Other Methods Involving Detection of Differentially Expressed Genes

The present invention provides methods of using the polynucleotides described herein in, for example, diagnosis of cancer and classification of cancer cells according to expression profiles. In specific non-limiting embodiments, the methods are useful for detecting cancer cells, facilitating diagnosis of cancer and the severity of a cancer (e.g., tumor grade, tumor burden, and the like) in a subject, facilitating a determination of the prognosis of a subject, and assessing the responsiveness of the subject to therapy (e.g., by providing a measure of therapeutic effect through, for example, assessing tumor burden during or following a chemotherapeutic regimen). Detection can be based on detection of a polynucleotide that is differentially expressed in a cancer cell, and/or detection of a polypeptide encoded by a polynucleotide that is differentially expressed in a cancer cell (“a polypeptide associated with cancer”). The detection methods of the invention can be conducted in vitro or in vivo, on isolated cells, or in whole tissues or a bodily fluid, e.g., blood, plasma, serum, urine, and the like).

In general, methods of the invention involving detection of a gene product (e.g., mRNA, cDNA generated from such mRNA, and polypeptides) involve contacting a sample with a probe specific for the gene product of interest. “Probe” as used herein in such methods is meant to refer to a molecule that specifically binds a gene product of interest (e.g., the probe binds to the target gene product with a specificity sufficient to distinguish binding to target over non-specific binding to non-target (background) molecules). “Probes” include, but are not necessarily limited to, nucleic acid probes (e.g., DNA, RNA, modified nucleic acid, and the like), antibodies (e.g., antibodies, antibody fragments that retain binding to a target epitope, single chain antibodies, and the like), or other polypeptide, peptide, or molecule (e.g., receptor ligand) that specifically binds a target gene product of interest.

The probe and sample suspected of having the gene product of interest are contacted under conditions suitable for binding of the probe to the gene product. For example, contacting is generally for a time sufficient to allow binding of the probe to the gene product (e.g., from several minutes to a few hours), and at a temperature and conditions of osmolarity and the like that provide for binding of the probe to the gene product at a level that is sufficiently distinguishable from background binding of the probe (e.g., under conditions that minimize non-specific binding). Suitable conditions for probe-target gene product binding can be readily determined using controls and other techniques available and known to one of ordinary skill in the art.

In this embodiment, the probe can be an antibody or other polypeptide, peptide, or molecule (e.g., receptor ligand) that specifically binds a target polypeptide of interest.

The detection methods can be provided as part of a kit. Thus, the invention further provides kits for detecting the presence and/or a level of a polynucleotide that is differentially expressed in a cancer cell (e.g., by detection of an mRNA encoded by the differentially expressed gene of interest), and/or a polypeptide encoded thereby, in a biological sample. Procedures using these kits can be performed by clinical laboratories, experimental laboratories, medical practitioners, or private individuals. The kits of the invention for detecting a polypeptide encoded by a polynucleotide that is differentially expressed in a cancer cell comprise a moiety that specifically binds the polypeptide, which may be a specific antibody. The kits of the invention for detecting a polynucleotide that is differentially expressed in a cancer cell comprise a moiety that specifically hybridizes to such a polynucleotide. The kit may optionally provide additional components that are useful in the procedure, including, but not limited to, buffers, developing reagents, labels, reacting surfaces, means for detection, control samples, standards, instructions, and interpretive information.

Detecting a Polypeptide Encoded by a Polynucleotide that is Differentially Expressed in a Cancer Cell

In some embodiments, methods are provided for a detecting cancer cell by detecting in a cell, a polypeptide encoded by a gene differentially expressed in a cancer cell. Any of a variety of known methods can be used for detection, including, but not limited to, immunoassay, using an antibody specific for the encoded polypeptide, e.g., by enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and the like; and functional assays for the encoded polypeptide, e.g., binding activity or enzymatic activity.

For example, an immunofluorescence assay can be easily performed on cells without first isolating the encoded polypeptide. The cells are first fixed onto a solid support, such as a microscope slide or microtiter well. This fixing step can permeabilize the cell membrane. The permeablization of the cell membrane permits the polypeptide-specific probe (e.g, antibody) to bind. Alternatively, where the polypeptide is secreted or membrane-bound, or is otherwise accessible at the cell-surface (e.g., receptors, and other molecule stably-associated with the outer cell membrane or otherwise stably associated with the cell membrane, such permeabilization may not be necessary.

Next, the fixed cells are exposed to an antibody specific for the encoded polypeptide. To increase the sensitivity of the assay, the fixed cells may be further exposed to a second antibody, which is labeled and binds to the first antibody, which is specific for the encoded polypeptide. Typically, the secondary antibody is detectably labeled, e.g., with a fluorescent marker. The cells which express the encoded polypeptide will be fluorescently labeled and easily visualized under the microscope. See, for example, Hashido et al. (1992) Biochem. Biophys. Res. Comm. 187:1241-1248.

As will be readily apparent to the ordinarily skilled artisan upon reading the present specification, the detection methods and other methods described herein can be varied. Such variations are within the intended scope of the invention. For example, in the above detection scheme, the probe for use in detection can be immobilized on a solid support, and the test sample contacted with the immobilized probe. Binding of the test sample to the probe can then be detected in a variety of ways, e.g., by detecting a detectable label bound to the test sample.

The present invention further provides methods for detecting the presence of and/or measuring a level of a polypeptide in a biological sample, which polypeptide is encoded by a polynucleotide that represents a gene differentially expressed in cancer, particularly in a polynucleotide that represents a gene differentially cancer cell, using a probe specific for the encoded polypeptide. In this embodiment, the probe can be a an antibody or other polypeptide, peptide, or molecule (e.g., receptor ligand) that specifically binds a target polypeptide of interest.

The methods generally comprise: a) contacting the sample with an antibody specific for a differentially expressed polypeptide in a test cell; and b) detecting binding between the antibody and molecules of the sample. The level of antibody binding (either qualitative or quantitative) indicates the cancerous state of the cell. For example, where the differentially expressed gene is increased in cancerous cells, detection of an increased level of antibody binding to the test sample relative to antibody binding level associated with a normal cell indicates that the test cell is cancerous.

Suitable controls include a sample known not to contain the encoded polypeptide; and a sample contacted with an antibody not specific for the encoded polypeptide, e.g., an anti-idiotype antibody. A variety of methods to detect specific antibody-antigen interactions are known in the art and can be used in the method, including, but not limited to, standard immunohistological methods, immunoprecipitation, an enzyme immunoassay, and a radioimmunoassay.

In general, the specific antibody will be detectably labeled, either directly or indirectly. Direct labels include radioisotopes; enzymes whose products are detectable (e.g., luciferase, β-galactosidase, and the like); fluorescent labels (e.g., fluorescein isothiocyanate, rhodamine, phycoerythrin, and the like); fluorescence emitting metals, e.g., 152Eu, or others of the lanthanide series, attached to the antibody through metal chelating groups such as EDTA; chemiluminescent compounds, e.g., luminol, isoluminol, acridinium salts, and the like; bioluminescent compounds, e.g., luciferin, aequorin (green fluorescent protein), and the like.

The antibody may be attached (coupled) to an insoluble support, such as a polystyrene plate or a bead. Indirect labels include second antibodies specific for antibodies specific for the encoded polypeptide (“first specific antibody”), wherein the second antibody is labeled as described above; and members of specific binding pairs, e.g., biotin-avidin, and the like. The biological sample may be brought into contact with and immobilized on a solid support or carrier, such as nitrocellulose, that is capable of immobilizing cells, cell particles, or soluble proteins. The support may then be washed with suitable buffers, followed by contacting with a detectably-labeled first specific antibody. Detection methods are known in the art and will be chosen as appropriate to the signal emitted by the detectable label. Detection is generally accomplished in comparison to suitable controls, and to appropriate standards.

In some embodiments, the methods are adapted for use in vivo, e.g., to locate or identify sites where cancer cells are present. In these embodiments, a detectably-labeled moiety, e.g., an antibody, which is specific for a cancer-associated polypeptide is administered to an individual (e.g., by injection), and labeled cells are located using standard imaging techniques, including, but not limited to, magnetic resonance imaging, computed tomography scanning, and the like. In this manner, cancer cells are differentially labeled.

Detecting a Polynucleotide that Represents a Gene Differentially Expressed in a Cancer Cell

In some embodiments, methods are provided for detecting a cancer cell by detecting expression in the cell of a transcript or that is differentially expressed in a cancer cell. Any of a variety of known methods can be used for detection, including, but not limited to, detection of a transcript by hybridization with a polynucleotide that hybridizes to a polynucleotide that is differentially expressed in a cancer cell; detection of a transcript by a polymerase chain reaction using specific oligonucleotide primers; in situ hybridization of a cell using as a probe a polynucleotide that hybridizes to a gene that is differentially expressed in a cancer cell and the like.

In many embodiments, the levels of a subject gene product are measured. By measured is meant qualitatively or quantitatively estimating the level of the gene product in a first biological sample either directly (e.g. by determining or estimating absolute levels of gene product) or relatively by comparing the levels to a second control biological sample. In many embodiments the second control biological sample is obtained from an individual not having not having cancer. As will be appreciated in the art, once a standard control level of gene expression is known, it can be used repeatedly as a standard for comparison. Other control samples include samples of cancerous tissue.

The methods can be used to detect and/or measure mRNA levels of a gene that is differentially expressed in a cancer cell. In some embodiments, the methods comprise: a) contacting a sample with a polynucleotide that corresponds to a differentially expressed gene described herein under conditions that allow hybridization; and b) detecting hybridization, if any. Detection of differential hybridization, when compared to a suitable control, is an indication of the presence in the sample of a polynucleotide that is differentially expressed in a cancer cell. Appropriate controls include, for example, a sample that is known not to contain a polynucleotide that is differentially expressed in a cancer cell. Conditions that allow hybridization are known in the art, and have been described in more detail above.

Detection can also be accomplished by any known method, including, but not limited to, in situ hybridization, PCR (polymerase chain reaction), RT-PCR (reverse transcription-PCR), and “Northern” or RNA blotting, arrays, microarrays, etc, or combinations of such techniques, using a suitably labeled polynucleotide. A variety of labels and labeling methods for polynucleotides are known in the art and can be used in the assay methods of the invention. Specific hybridization can be determined by comparison to appropriate controls.

Polynucleotides described herein are used for a variety of purposes, such as probes for detection of and/or measurement of, transcription levels of a polynucleotide that is differentially expressed in a cancer cell. Additional disclosure about preferred regions of the disclosed polynucleotide sequences is found in the Examples. A probe that hybridizes specifically to a polynucleotide disclosed herein should provide a detection signal at least 2-, 5-, 10-, or 20-fold higher than the background hybridization provided with other unrelated sequences. It should be noted that “probe” as used in this context of detection of nucleic acid is meant to refer to a polynucleotide sequence used to detect a differentially expressed gene product in a test sample. As will be readily appreciated by the ordinarily skilled artisan, the probe can be detectably labeled and contacted with, for example, an array comprising immobilized polynucleotides obtained from a test sample (e.g., mRNA). Alternatively, the probe can be immobilized on an array and the test sample detectably labeled. These and other variations of the methods of the invention are well within the skill in the art and are within the scope of the invention.

Labeled nucleic acid probes may be used to detect expression of a gene corresponding to the provided polynucleotide. In Northern blots, mRNA is separated electrophoretically and contacted with a probe. A probe is detected as hybridizing to an mRNA species of a particular size. The amount of hybridization can be quantitated to determine relative amounts of expression, for example under a particular condition. Probes are used for in situ hybridization to cells to detect expression. Probes can also be used in vivo for diagnostic detection of hybridizing sequences. Probes are typically labeled with a radioactive isotope. Other types of detectable labels can be used such as chromophores, fluorophores, and enzymes. Other examples of nucleotide hybridization assays are described in WO92/02526 and U.S. Pat. No. 5,124,246.

PCR is another means for detecting small amounts of target nucleic acids, methods for which may be found in Sambrook, et al. Molecular Cloning: A Laboratory Manual, CSH Press 1989, pp. 14.2-14.33.

A detectable label may be included in the amplification reaction. Suitable detectable labels include fluorochromes, (e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyfluorescein, 6-carboxy-X-rhodamine (ROX), 6-carboxy-2′,4′,7′,4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA)), radioactive labels, (e.g. 32P, 35S, 3H, etc.), and the like. The label may be a two stage system, where the polynucleotides is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label. The label may be conjugated to one or both of the primers. Alternatively, the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.

Arrays

Polynucleotide arrays provide a high throughput technique that can assay a large number of polynucleotides or polypeptides in a sample. This technology can be used as a tool to test for differential expression.

A variety of methods of producing arrays, as well as variations of these methods, are known in the art and contemplated for use in the invention. For example, arrays can be created by spotting polynucleotide probes onto a substrate (e.g., glass, nitrocellulose, etc.) in a two-dimensional matrix or array having bound probes. The probes can be bound to the substrate by either covalent bonds or by non-specific interactions, such as hydrophobic interactions.

Samples of polynucleotides can be detectably labeled (e.g., using radioactive or fluorescent labels) and then hybridized to the probes. Double stranded polynucleotides, comprising the labeled sample polynucleotides bound to probe polynucleotides, can be detected once the unbound portion of the sample is washed away. Alternatively, the polynucleotides of the test sample can be immobilized on the array, and the probes detectably labeled. Techniques for constructing arrays and methods of using these arrays are described in, for example, Schena et al. (1996) Proc Natl Acad Sci USA. 93(20):10614-9; Schena et al. (1995) Science 270(5235):467-70; Shalon et al. (1996) Genome Res. 6(7):639-45, U.S. Pat. No. 5,807,522, EP 799 897; WO 97/29212; WO 97/27317; EP 785 280; WO 97/02357; U.S. Pat. No. 5,593,839; U.S. Pat. No. 5,578,832; EP 728 520; U.S. Pat. No. 5,599,695; EP 721 016; U.S. Pat. No. 5,556,752; WO 95/22058; and U.S. Pat. No. 5,631,734. In most embodiments, the “probe” is detectably labeled. In other embodiments, the probe is immobilized on the array and not detectably labeled.

Arrays can be used, for example, to examine differential expression of genes and can be used to determine gene function. For example, arrays can be used to detect differential expression of a gene corresponding to a polynucleotide described herein, where expression is compared between a test cell and control cell (e.g., cancer cells and normal cells). For example, high expression of a particular message in a cancer cell, which is not observed in a corresponding normal cell, can indicate a cancer specific gene product. Exemplary uses of arrays are further described in, for example, Pappalarado et al., Sem. Radiation Oncol. (1998) 8:217; and Ramsay, Nature Biotechnol. (1998) 16:40. Furthermore, many variations on methods of detection using arrays are well within the skill in the art and within the scope of the present invention. For example, rather than immobilizing the probe to a solid support, the test sample can be immobilized on a solid support which is then contacted with the probe.

Diagnosis, Prognosis, Assessment of Therapy (Therametrics), and Management of Cancer

The polynucleotides described herein, as well as their gene products and corresponding genes and gene products, are of particular interest as genetic or biochemical markers (e.g., in blood or tissues) that will detect the earliest changes along the carcinogenesis pathway and/or to monitor the efficacy of various therapies and preventive interventions.

For example, the level of expression of certain polynucleotides can be indicative of a poorer prognosis, and therefore warrant more aggressive chemo- or radio-therapy for a patient or vice versa. The correlation of novel surrogate tumor specific features with response to treatment and outcome in patients can define prognostic indicators that allow the design of tailored therapy based on the molecular profile of the tumor. These therapies include antibody targeting, antagonists (e.g., small molecules), and gene therapy.

Determining expression of certain polynucleotides and comparison of a patient's profile with known expression in normal tissue and variants of the disease allows a determination of the best possible treatment for a patient, both in terms of specificity of treatment and in terms of comfort level of the patient. Surrogate tumor markers, such as polynucleotide expression, can also be used to better classify, and thus diagnose and treat, different forms and disease states of cancer. Two classifications widely used in oncology that can benefit from identification of the expression levels of the genes corresponding to the polynucleotides described herein are staging of the cancerous disorder, and grading the nature of the cancerous tissue.

The polynucleotides that correspond to differentially expressed genes, as well as their encoded gene products, can be useful to monitor patients having or susceptible to cancer to detect potentially malignant events at a molecular level before they are detectable at a gross morphological level. In addition, the polynucleotides described herein, as well as the genes corresponding to such polynucleotides, can be useful as therametrics, e.g., to assess the effectiveness of therapy by using the polynucleotides or their encoded gene products, to assess, for example, tumor burden in the patient before, during, and after therapy.

Furthermore, a polynucleotide identified as corresponding to a gene that is differentially expressed in, and thus is important for, one type of cancer can also have implications for development or risk of development of other types of cancer, e.g., where a polynucleotide represents a gene differentially expressed across various cancer types. Thus, for example, expression of a polynucleotide corresponding to a gene that has clinical implications for cancer can also have clinical implications for metastatic breast cancer, colon cancer, or ovarian cancer, etc.

Staging.

Staging is a process used by physicians to describe how advanced the cancerous state is in a patient. Staging assists the physician in determining a prognosis, planning treatment and evaluating the results of such treatment. Staging systems vary with the types of cancer, but generally involve the following “TNM” system: the type of tumor, indicated by T; whether the cancer has metastasized to nearby lymph nodes, indicated by N; and whether the cancer has metastasized to more distant parts of the body, indicated by M. Generally, if a cancer is only detectable in the area of the primary lesion without having spread to any lymph nodes it is called Stage I. If it has spread only to the closest lymph nodes, it is called Stage II. In Stage III, the cancer has generally spread to the lymph nodes in near proximity to the site of the primary lesion. Cancers that have spread to a distant part of the body, such as the liver, bone, brain or other site, are Stage IV, the most advanced stage.

The polynucleotides and corresponding genes and gene products described herein can facilitate fine-tuning of the staging process by identifying markers for the aggressiveness of a cancer, e.g. the metastatic potential, as well as the presence in different areas of the body. Thus, a Stage II cancer with a polynucleotide signifying a high metastatic potential cancer can be used to change a borderline Stage II tumor to a Stage III tumor, justifying more aggressive therapy. Conversely, the presence of a polynucleotide signifying a lower metastatic potential allows more conservative staging of a tumor.

One type of breast cancer is ductal carcinoma in situ (DCIS): DCIS is when the breast cancer cells are completely contained within the breast ducts (the channels in the breast that carry milk to the nipple), and have not spread into the surrounding breast tissue. This may also be referred to as non-invasive or intraductal cancer, as the cancer cells have not yet spread into the surrounding breast tissue and so usually have not spread into any other part of the body.

Lobular carcinoma in situ breast cancer (LCIS) means that cell changes are found in the lining of the lobules of the breast. It can be present in both breasts. It is also referred to as non-invasive cancer as it has not spread into the surrounding breast tissue.

Invasive breast cancer can be staged as follows: Stage 1 tumours: these measure less than two centimetres. The lymph glands in the armpit are not affected and there are no signs that the cancer has spread elsewhere in the body; Stage 2 tumours: these measure between two and five centimetres, or the lymph glands in the armpit are affected, or both. However, there are no signs that the cancer has spread further; Stage 3 tumours: these are larger than five centimetres and may be attached to surrounding structures such as the muscle or skin. The lymph glands are usually affected, but there are no signs that the cancer has spread beyond the breast or the lymph glands in the armpit; Stage 4 tumours: these are of any size, but the lymph glands are usually affected and the cancer has spread to other parts of the body. This is secondary breast cancer.

Grading of Cancers.

Grade is a term used to describe how closely a tumor resembles normal tissue of its same type. The microscopic appearance of a tumor is used to identify tumor grade based on parameters such as cell morphology, cellular organization, and other markers of differentiation. As a general rule, the grade of a tumor corresponds to its rate of growth or aggressiveness, with undifferentiated or high-grade tumors generally being more aggressive than well-differentiated or low-grade tumors.

The polynucleotides of the Sequence Listing, and their corresponding genes and gene products, can be especially valuable in determining the grade of the tumor, as they not only can aid in determining the differentiation status of the cells of a tumor, they can also identify factors other than differentiation that are valuable in determining the aggressiveness of a tumor, such as metastatic potential.

Low grade means that the cancer cells look very like the normal cells. They are usually slowly growing and are less likely to spread. In high grade tumors the cells look very abnormal. They are likely to grow more quickly and are more likely to spread.

Assessment of Proliferation of Cells in Tumor.

The differential expression level of the polynucleotides described herein can facilitate assessment of the rate of proliferation of tumor cells, and thus provide an indicator of the aggressiveness of the rate of tumor growth. For example, assessment of the relative expression levels of genes involved in cell cycle can provide an indication of cellular proliferation, and thus serve as a marker of proliferation.

Detection of Cancer.

The polynucleotides corresponding to genes that exhibit the appropriate expression pattern can be used to detect cancer in a subject. The expression of appropriate polynucleotides can be used in the diagnosis, prognosis and management of cancer. Detection of cancer can be determined using expression levels of any of these sequences alone or in combination with the levels of expression of other known cancer genes. Determination of the aggressive nature and/or the metastatic potential of a cancer can be determined by comparing levels of one or more gene products of the genes corresponding to the polynucleotides described herein, and comparing total levels of another sequence known to vary in cancerous tissue, e.g., expression of p53, DCC, ras, FAP (see, e.g., Fearon E R, et al., Cell (1990) 61(5):759; Hamilton S R et al., Cancer (1993) 72:957; Bodmer W, et al., Nat. Genet. (1994) 4(3):217; Fearon ER, Ann N Y Acad. Sci. (1995) 768:101). For example, development of cancer can be detected by examining the level of expression of a gene corresponding to a polynucleotides described herein to the levels of oncogenes (e.g. ras) or tumor suppressor genes (e.g. FAP or p53). Thus expression of specific marker polynucleotides can be used to discriminate between normal and cancerous tissue, to discriminate between cancers with different cells of origin, to discriminate between cancers with different potential metastatic rates, etc. For a review of other markers of cancer, see, e.g., Hanahan et al. (2000) Cell 100:57-70.

Treatment of Cancer

The invention further provides methods for reducing growth of cancer cells. The methods provide for decreasing the expression of a gene that is differentially expressed in a cancer cell or decreasing the level of and/or decreasing an activity of a cancer-associated polypeptide. In general, the methods comprise contacting a cancer cell with a substance that modulates (1) expression of a gene that is differentially expressed in cancer; or (2) a level of and/or an activity of a cancer-associated polypeptide.

“Reducing growth of cancer cells” includes, but is not limited to, reducing proliferation of cancer cells, and reducing the incidence of a non-cancerous cell becoming a cancerous cell. Whether a reduction in cancer cell growth has been achieved can be readily determined using any known assay, including, but not limited to, [3H]-thymidine incorporation; counting cell number over a period of time; detecting and/or measuring a marker associated with breast cancer (e.g., PSA).

The present invention provides methods for treating cancer, generally comprising administering to an individual in need thereof a substance that reduces cancer cell growth, in an amount sufficient to reduce cancer cell growth and treat the cancer. Whether a substance, or a specific amount of the substance, is effective in treating cancer can be assessed using any of a variety of known diagnostic assays for cancer, including, but not limited to, proctoscopy, rectal examination, biopsy, contrast radiographic studies, CAT scan, and detection of a tumor marker associated with cancer in the blood of the individual (e.g., PSA (breast-specific antigen)). The substance can be administered systemically or locally. Thus, in some embodiments, the substance is administered locally, and cancer growth is decreased at the site of administration. Local administration may be useful in treating, e.g., a solid tumor.

A substance that reduces cancer cell growth can be targeted to a cancer cell. Thus, in some embodiments, the invention provides a method of delivering a drug to a cancer cell, comprising administering a drug-antibody complex to a subject, wherein the antibody is specific for a cancer-associated polypeptide, and the drug is one that reduces cancer cell growth, a variety of which are known in the art. Targeting can be accomplished by coupling (e.g., linking, directly or via a linker molecule, either covalently or non-covalently, so as to form a drug-antibody complex) a drug to an antibody specific for a cancer-associated polypeptide. Methods of coupling a drug to an antibody are well known in the art and need not be elaborated upon herein.

Tumor Classification and Patient Stratification

The invention further provides for methods of classifying tumors, and thus grouping or “stratifying” patients, according to the expression profile of selected differentially expressed genes in a tumor. Differentially expressed genes can be analyzed for correlation with other differentially expressed genes in a single tumor type or across tumor types. Genes that demonstrate consistent correlation in expression profile in a given cancer cell type (e.g., in a cancer cell or type of cancer) can be grouped together, e.g., when one gene is overexpressed in a tumor, a second gene is also usually overexpressed. Tumors can then be classified according to the expression profile of one or more genes selected from one or more groups.

The tumor of each patient in a pool of potential patients can be classified as described above. Patients having similarly classified tumors can then be selected for participation in an investigative or clinical trial of a cancer therapeutic where a homogeneous population is desired. The tumor classification of a patient can also be used in assessing the efficacy of a cancer therapeutic in a heterogeneous patient population. In addition, therapy for a patient having a tumor of a given expression profile can then be selected accordingly.

In another embodiment, differentially expressed gene products (e.g., polypeptides or polynucleotides encoding such polypeptides) may be effectively used in treatment through vaccination. The growth of cancer cells is naturally limited in part due to immune surveillance. Stimulation of the immune system using a particular tumor-specific antigen enhances the effect towards the tumor expressing the antigen. An active vaccine comprising a polypeptide encoded by the cDNA of this invention would be appropriately administered to subjects having an alteration, e.g., overabundance, of the corresponding RNA, or those predisposed for developing cancer cells with an alteration of the same RNA. Polypeptide antigens are typically combined with an adjuvant as part of a vaccine composition. The vaccine is preferably administered first as a priming dose, and then again as a boosting dose, usually at least four weeks later. Further boosting doses may be given to enhance the effect. The dose and its timing are usually determined by the person responsible for the treatment.

The invention also encompasses the selection of a therapeutic regimen based upon the expression profile of differentially expressed genes in the patient's tumor. For example, a tumor can be analyzed for its expression profile of the genes corresponding to SEQ ID NOS: 1-13996 as described herein, e.g., the tumor is analyzed to determine which genes are expressed at elevated levels or at decreased levels relative to normal cells of the same tissue type. The expression patterns of the tumor are then compared to the expression patterns of tumors that respond to a selected therapy. Where the expression profiles of the test tumor cell and the expression profile of a tumor cell of known drug responsivity at least substantially match (e.g., selected sets of genes at elevated levels in the tumor of known drug responsivity and are also at elevated levels in the test tumor cell), then the therapeutic agent selected for therapy is the drug to which tumors with that expression pattern respond.

Pattern Matching in Diagnosis Using Arrays

In another embodiment, the diagnostic and/or prognostic methods of the invention involve detection of expression of a selected set of genes in a test sample to produce a test expression pattern (TEP). The TEP is compared to a reference expression pattern (REP), which is generated by detection of expression of the selected set of genes in a reference sample (e.g., a positive or negative control sample). The selected set of genes includes at least one of the genes of the invention, which genes correspond to the polynucleotide sequences described herein. Of particular interest is a selected set of genes that includes gene differentially expressed in the disease for which the test sample is to be screened.

Identification of Therapeutic Targets and Anti-Cancer Therapeutic Agents

The present invention also encompasses methods for identification of agents having the ability to modulate activity of a differentially expressed gene product, as well as methods for identifying a differentially expressed gene product as a therapeutic target for treatment of cancer.

Identification of compounds that modulate activity of a differentially expressed gene product can be accomplished using any of a variety of drug screening techniques. Such agents are candidates for development of cancer therapies. Of particular interest are screening assays for agents that have tolerable toxicity for normal, non-cancerous human cells. The screening assays of the invention are generally based upon the ability of the agent to modulate an activity of a differentially expressed gene product and/or to inhibit or suppress phenomenon associated with cancer (e.g., cell proliferation, colony formation, cell cycle arrest, metastasis, and the like).

Screening of Candidate Agents

Screening assays can be based upon any of a variety of techniques readily available and known to one of ordinary skill in the art. In general, the screening assays involve contacting a cancerous cell with a candidate agent, and assessing the effect upon biological activity of a differentially expressed gene product. The effect upon a biological activity can be detected by, for example, detection of expression of a gene product of a differentially expressed gene (e.g., a decrease in mRNA or polypeptide levels, would in turn cause a decrease in biological activity of the gene product). Alternatively or in addition, the effect of the candidate agent can be assessed by examining the effect of the candidate agent in a functional assay. For example, where the differentially expressed gene product is an enzyme, then the effect upon biological activity can be assessed by detecting a level of enzymatic activity associated with the differentially expressed gene product. The functional assay will be selected according to the differentially expressed gene product. In general, where the differentially expressed gene is increased in expression in a cancerous cell, agents of interest are those that decrease activity of the differentially expressed gene product.

Assays described infra can be readily adapted in the screening assay embodiments of the invention. Exemplary assays useful in screening candidate agents include, but are not limited to, hybridization-based assays (e.g., use of nucleic acid probes or primers to assess expression levels), antibody-based assays (e.g., to assess levels of polypeptide gene products), binding assays (e.g., to detect interaction of a candidate agent with a differentially expressed polypeptide, which assays may be competitive assays where a natural or synthetic ligand for the polypeptide is available), and the like. Additional exemplary assays include, but are not necessarily limited to, cell proliferation assays, antisense knockout assays, assays to detect inhibition of cell cycle, assays of induction of cell death/apoptosis, and the like. Generally such assays are conducted in vitro, but many assays can be adapted for in vivo analyses, e.g., in an animal model of the cancer.

Identification of Therapeutic Targets

In another embodiment, the invention contemplates identification of differentially expressed genes and gene products as therapeutic targets. In some respects, this is the converse of the assays described above for identification of agents having activity in modulating (e.g., decreasing or increasing) activity of a differentially expressed gene product.

In this embodiment, therapeutic targets are identified by examining the effect(s) of an agent that can be demonstrated or has been demonstrated to modulate a cancerous phenotype (e.g., inhibit or suppress or prevent development of a cancerous phenotype). Such agents are generally referred to herein as an “anti-cancer agent”, which agents encompass chemotherapeutic agents. For example, the agent can be an antisense oligonucleotide that is specific for a selected gene transcript. For example, the antisense oligonucleotide may have a sequence corresponding to a sequence of a differentially expressed gene described herein, e.g., a sequence of one of SEQ ID NOS: 1-13996.

Assays for identification of therapeutic targets can be conducted in a variety of ways using methods that are well known to one of ordinary skill in the art. For example, a test cancerous cell that expresses or overexpresses a differentially expressed gene is contacted with an anti-cancer agent, the effect upon a cancerous phenotype and a biological activity of the candidate gene product assessed. The biological activity of the candidate gene product can be assayed be examining, for example, modulation of expression of a gene encoding the candidate gene product (e.g., as detected by, for example, an increase or decrease in transcript levels or polypeptide levels), or modulation of an enzymatic or other activity of the gene product. The cancerous phenotype can be, for example, cellular proliferation, loss of contact inhibition of growth (e.g., colony formation), tumor growth (in vitro or in vivo), and the like. Alternatively or in addition, the effect of modulation of a biological activity of the candidate target gene upon cell death/apoptosis or cell cycle regulation can be assessed.

Inhibition or suppression of a cancerous phenotype, or an increase in cell death or apoptosis as a result of modulation of biological activity of a candidate gene product indicates that the candidate gene product is a suitable target for cancer therapy. Assays described infra can be readily adapted for assays for identification of therapeutic targets. Generally such assays are conducted in vitro, but many assays can be adapted for in vivo analyses, e.g., in an appropriate, art-accepted animal model of the cancer.

Candidate Agents

The term “agent” as used herein describes any molecule, e.g. protein or pharmaceutical, with the capability of modulating a biological activity of a gene product of a differentially expressed gene. Generally a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.

Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons. Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including, but not limited to: peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.

Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts (including extracts from human tissue to identify endogenous factors affecting differentially expressed gene products) are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.

Exemplary candidate agents of particular interest include, but are not limited to, antisense and RNAi polynucleotides, and antibodies, soluble receptors, and the like. Antibodies and soluble receptors are of particular interest as candidate agents where the target differentially expressed gene product is secreted or accessible at the cell-surface (e.g., receptors and other molecule stably-associated with the outer cell membrane).

For method that involve RNAi (RNA interference), a double stranded RNA (dsRNA) molecule is usually used. The dsRNA is prepared to be substantially identical to at least a segment of a subject polynucleotide (e.g. a cDNA or gene). In general, the dsRNA is selected to have at least 70%, 75%, 80%, 85% or 90% sequence identity with the subject polynucleotide over at least a segment of the candidate gene. In other instances, the sequence identity is even higher, such as 95%, 97% or 99%, and in still other instances, there is 100% sequence identity with the subject polynucleotide over at least a segment of the subject polynucleotide. The size of the segment over which there is sequence identity can vary depending upon the size of the subject polynucleotide. In general, however, there is substantial sequence identity over at least 15, 20, 25, 30, 35, 40 or 50 nucleotides. In other instances, there is substantial sequence identity over at least 100, 200, 300, 400, 500 or 1000 nucleotides; in still other instances, there is substantial sequence identity over the entire length of the subject polynucleotide, i.e., the coding and non-coding region of the candidate gene.

Because only substantial sequence similarity between the subject polynucleotide and the dsRNA is necessary, sequence variations between these two species arising from genetic mutations, evolutionary divergence and polymorphisms can be tolerated. Moreover, as described further infra, the dsRNA can include various modified or nucleotide analogs.

Usually the dsRNA consists of two separate complementary RNA strands. However, in some instances, the dsRNA may be formed by a single strand of RNA that is self-complementary, such that the strand loops back upon itself to form a hairpin loop. Regardless of form, RNA duplex formation can occur inside or outside of a cell.

The size of the dsRNA that is utilized varies according to the size of the subject polynucleotide whose expression is to be suppressed and is sufficiently long to be effective in reducing expression of the subject polynucleotide in a cell. Generally, the dsRNA is at least 10-15 nucleotides long. In certain applications, the dsRNA is less than 20, 21, 22, 23, 24 or 25 nucleotides in length. In other instances, the dsRNA is at least 50, 100, 150 or 200 nucleotides in length. The dsRNA can be longer still in certain other applications, such as at least 300, 400, 500 or 600 nucleotides. Typically, the dsRNA is not longer than 3000 nucleotides. The optimal size for any particular subject polynucleotide can be determined by one of ordinary skill in the art without undue experimentation by varying the size of the dsRNA in a systematic fashion and determining whether the size selected is effective in interfering with expression of the subject polynucleotide.

dsRNA can be prepared according to any of a number of methods that are known in the art, including in vitro and in vivo methods, as well as by synthetic chemistry approaches.

In Vitro Methods.

Certain methods generally involve inserting the segment corresponding to the candidate gene that is to be transcribed between a promoter or pair of promoters that are oriented to drive transcription of the inserted segment and then utilizing an appropriate RNA polymerase to carry out transcription. One such arrangement involves positioning a DNA fragment corresponding to the candidate gene or segment thereof into a vector such that it is flanked by two opposable polymerase-specific promoters that can be same or different. Transcription from such promoters produces two complementary RNA strands that can subsequently anneal to form the desired dsRNA. Exemplary plasmids for use in such systems include the plasmid (PCR 4.0 TOPO) (available from Invitrogen). Another example is the vector pGEM-T (Promega, Madison, Wis.) in which the oppositely oriented promoters are T7 and SP6; the T3 promoter can also be utilized.

In a second arrangement, DNA fragments corresponding to the segment of the subject polynucleotide that is to be transcribed is inserted both in the sense and antisense orientation downstream of a single promoter. In this system, the sense and antisense fragments are cotranscribed to generate a single RNA strand that is self-complementary and thus can form dsRNA.

Various other in vitro methods have been described. Examples of such methods include, but are not limited to, the methods described by Sadher et al. (Biochem. Int. 14:1015, 1987); by Bhattacharyya (Nature 343:484, 1990); and by Livache, et al. (U.S. Pat. No. 5,795,715), each of which is incorporated herein by reference in its entirety.

Single-stranded RNA can also be produced using a combination of enzymatic and organic synthesis or by total organic synthesis. The use of synthetic chemical methods enable one to introduce desired modified nucleotides or nucleotide analogs into the dsRNA.

In Vivo Methods.

dsRNA can also be prepared in vivo according to a number of established methods (see, e.g., Sambrook, et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed.; Transcription and Translation (B. D. Hames, and S. J. Higgins, Eds., 1984); DNA Cloning, volumes I and II (D. N. Glover, Ed., 1985); and Oligonucleotide Synthesis (M. J. Gait, Ed., 1984, each of which is incorporated herein by reference in its entirety).

Once the single-stranded RNA has been formed, the complementary strands are allowed to anneal to form duplex RNA. Transcripts are typically treated with DNAase and further purified according to established protocols to remove proteins. Usually such purification methods are not conducted with phenol:chloroform. The resulting purified transcripts are subsequently dissolved in RNAase free water or a buffer of suitable composition.

dsRNA is generated by annealing the sense and anti-sense RNA in vitro. Generally, the strands are initially denatured to keep the strands separate and to avoid self-annealing. During the annealing process, typically certain ratios of the sense and antisense strands are combined to facilitate the annealing process. In some instances, a molar ratio of sense to antisense strands of 3:7 is used; in other instances, a ratio of 4:6 is utilized; and in still other instances, the ratio is 1:1.

The buffer composition utilized during the annealing process can in some instances affect the efficacy of the annealing process and subsequent transfection procedure. While some have indicated that the buffered solution used to carry out the annealing process should include a potassium salt such as potassium chloride (e.g. at a concentration of about 80 mM). In some embodiments, the buffer is substantially potassium free. Once single-stranded RNA has annealed to form duplex RNA, typically any single-strand overhangs are removed using an enzyme that specifically cleaves such overhangs (e.g., RNAase A or RNAase T).

Once the dsRNA has been formed, it is introduced into a reference cell, which can include an individual cell or a population of cells (e.g., a tissue, an embryo and an entire organism). The cell can be from essentially any source, including animal, plant, viral, bacterial, fungal and other sources. If a tissue, the tissue can include dividing or nondividing and differentiated or undifferentiated cells. Further, the tissue can include germ line cells and somatic cells. Examples of differentiated cells that can be utilized include, but are not limited to, neurons, glial cells, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, adipocytes, osteoblasts, osteoclasts, hepatocytes, cells of the endocrine or exocrine glands, fibroblasts, myocytes, cardiomyocytes, and endothelial cells. The cell can be an individual cell of an embryo, and can be a blastocyte or an oocyte.

Certain methods are conducted using model systems for particular cellular states (e.g., a disease). For instance, certain methods provided herein are conducted with a cancer cell lines that serves as a model system for investigating genes that are correlated with various cancers.

A number of options can be utilized to deliver the dsRNA into a cell or population of cells such as in a cell culture, tissue or embryo. For instance, RNA can be directly introduced intracellularly. Various physical methods are generally utilized in such instances, such as administration by microinjection (see, e.g., Zernicka-Goetz, et al. (1997) Development 124:1133-1137; and Wianny, et al. (1998) Chromosoma 107: 430-439).

Other options for cellular delivery include permeabilizing the cell membrane and electroporation in the presence of the dsRNA, liposome-mediated transfection, or transfection using chemicals such as calcium phosphate. A number of established gene therapy techniques can also be utilized to introduce the dsRNA into a cell. By introducing a viral construct within a viral particle, for instance, one can achieve efficient introduction of an expression construct into the cell and transcription of the RNA encoded by the construct.

If the dsRNA is to be introduced into an organism or tissue, gene gun technology is an option that can be employed. This generally involves immobilizing the dsRNA on a gold particle which is subsequently fired into the desired tissue. Research has also shown that mammalian cells have transport mechanisms for taking in dsRNA (see, e.g., Asher, et al. (1969) Nature 223:715-717). Consequently, another delivery option is to administer the dsRNA extracellularly into a body cavity, interstitial space or into the blood system of the mammal for subsequent uptake by such transport processes. The blood and lymph systems and the cerebrospinal fluid are potential sites for injecting dsRNA. Oral, topical, parenteral, rectal and intraperitoneal administration are also possible modes of administration.

The composition introduced can also include various other agents in addition to the dsRNA. Examples of such agents include, but are not limited to, those that stabilize the dsRNA, enhance cellular uptake and/or increase the extent of interference. Typically, the dsRNA is introduced in a buffer that is compatible with the composition of the cell into which the RNA is introduced to prevent the cell from being shocked. The minimum size of the dsRNA that effectively achieves gene silencing can also influence the choice of delivery system and solution composition.

Sufficient dsRNA is introduced into the tissue to cause a detectable change in expression of a target gene (assuming the candidate gene is in fact being expressed in the cell into which the dsRNA is introduced) using available detection methodologies. Thus, in some instances, sufficient dsRNA is introduced to achieve at least a 5-10% reduction in candidate gene expression as compared to a cell in which the dsRNA is not introduced. In other instances, inhibition is at least 20, 30, 40 or 50%. In still other instances, the inhibition is at least 60, 70, 80, 90 or 95%. Expression in some instances is essentially completely inhibited to undetectable levels.

The amount of dsRNA introduced depends upon various factors such as the mode of administration utilized, the size of the dsRNA, the number of cells into which dsRNA is administered, and the age and size of an animal if dsRNA is introduced into an animal. An appropriate amount can be determined by those of ordinary skill in the art by initially administering dsRNA at several different concentrations for example, for example. In certain instances when dsRNA is introduced into a cell culture, the amount of dsRNA introduced into the cells varies from about 0.5 to 3 μg per 106 cells.

A number of options are available to detect interference of candidate gene expression (i.e., to detect candidate gene silencing). In general, inhibition in expression is detected by detecting a decrease in the level of the protein encoded by the candidate gene, determining the level of mRNA transcribed from the gene and/or detecting a change in phenotype associated with candidate gene expression.

Use of Polypeptides to Screen for Peptide Analogs and Antagonists

Polypeptides encoded by differentially expressed genes identified herein can be used to screen peptide libraries to identify binding partners, such as receptors, from among the encoded polypeptides. Peptide libraries can be synthesized according to methods known in the art (see, e.g., U.S. Pat. No. 5,010,175 and WO 91/17823).

Agonists or antagonists of the polypeptides of the invention can be screened using any available method known in the art, such as signal transduction, antibody binding, receptor binding, mitogenic assays, chemotaxis assays, etc. The assay conditions ideally should resemble the conditions under which the native activity is exhibited in vivo, that is, under physiologic pH, temperature, and ionic strength. Suitable agonists or antagonists will exhibit strong inhibition or enhancement of the native activity at concentrations that do not cause toxic side effects in the subject. Agonists or antagonists that compete for binding to the native polypeptide can require concentrations equal to or greater than the native concentration, while inhibitors capable of binding irreversibly to the polypeptide can be added in concentrations on the order of the native concentration.

Such screening and experimentation can lead to identification of a polypeptide binding partner, such as a receptor, encoded by a gene or a cDNA corresponding to a polynucleotide described herein, and at least one peptide agonist or antagonist of the binding partner. Such agonists and antagonists can be used to modulate, enhance, or inhibit receptor function in cells to which the receptor is native, or in cells that possess the receptor as a result of genetic engineering. Further, if the receptor shares biologically important characteristics with a known receptor, information about agonist/antagonist binding can facilitate development of improved agonists/antagonists of the known receptor.

Vaccines and Uses

The differentially expressed nucleic acids and polypeptides produced by the nucleic acids of the invention can also be used to modulate primary immune response to prevent or treat cancer. Every immune response is a complex and intricately regulated sequence of events involving several cell types. It is triggered when an antigen enters the body and encounters a specialized class of cells called antigen-presenting cells (APCs). These APCs capture a minute amount of the antigen and display it in a form that can be recognized by antigen-specific helper T lymphocytes. The helper (Th) cells become activated and, in turn, promote the activation of other classes of lymphocytes, such as B cells or cytotoxic T cells. The activated lymphocytes then proliferate and carry out their specific effector functions, which in many cases successfully activate or eliminate the antigen. Thus, activating the immune response to a particular antigen associated with a cancer cell can protect the patient from developing cancer or result in lymphocytes eliminating cancer cells expressing the antigen.

Gene products, including polypeptides, mRNA (particularly mRNAs having distinct secondary and/or tertiary structures), cDNA, or complete gene, can be prepared and used in vaccines for the treatment or prevention of hyperproliferative disorders and cancers. The nucleic acids and polypeptides can be utilized to enhance the immune response, prevent tumor progression, prevent hyperproliferative cell growth, and the like. Methods for selecting nucleic acids and polypeptides that are capable of enhancing the immune response are known in the art. Preferably, the gene products for use in a vaccine are gene products which are present on the surface of a cell and are recognizable by lymphocytes and antibodies.

The gene products may be formulated with pharmaceutically acceptable carriers into pharmaceutical compositions by methods known in the art. The composition is useful as a vaccine to prevent or treat cancer. The composition may further comprise at least one co-immunostimulatory molecule, including but not limited to one or more major histocompatibility complex (MHC) molecules, such as a class I or class II molecule, preferably a class I molecule. The composition may further comprise other stimulator molecules including B7.1, B7.2, ICAM-1, ICAM-2, LFA-1, LFA-3, CD72 and the like, immunostimulatory polynucleotides (which comprise an 5′-CG-3′ wherein the cytosine is unmethylated), and cytokines which include but are not limited to IL-1 through IL-15, TNF-α, IFN-γ, RANTES, G-CSF, M-CSF, IFN-α, CTAP III, ENA-78, GRO, 1-309, PF-4, IP-10, LD-78, MGSA, MIP-1α, MIP-1β, or combination thereof, and the like for immunopotentiation. In one embodiment, the immunopotentiators of particular interest are those that facilitate a Th1 immune response.

The gene products may also be prepared with a carrier that will protect the gene products against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid, and the like. Methods for preparation of such formulations are known in the art.

In the methods of preventing or treating cancer, the gene products may be administered via one of several routes including but not limited to transdermal, transmucosal, intravenous, intramuscular, subcutaneous, intradermal, intraperitoneal, intrathecal, intrapleural, intrauterine, rectal, vaginal, topical, intratumor, and the like. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, administration bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate permeation. Transmucosal administration may be by nasal sprays or suppositories. For oral administration, the gene products are formulated into conventional oral administration form such as capsules, tablets, elixirs and the like.

The gene product is administered to a patient in an amount effective to prevent or treat cancer. In general, it is desirable to provide the patient with a dosage of gene product of at least about 1 pg per Kg body weight, preferably at least about 1 ng per Kg body weight, more preferably at least about 1 μg or greater per Kg body weight of the recipient. A range of from about 1 ng per Kg body weight to about 100 mg per Kg body weight is preferred although a lower or higher dose may be administered. The dose is effective to prime, stimulate and/or cause the clonal expansion of antigen-specific T lymphocytes, preferably cytotoxic T lymphocytes, which in turn are capable of preventing or treating cancer in the recipient. The dose is administered at least once and may be provided as a bolus or a continuous administration. Multiple administrations of the dose over a period of several weeks to months may be preferable. Subsequent doses may be administered as indicated.

In another method of treatment, autologous cytotoxic lymphocytes or tumor infiltrating lymphocytes may be obtained from a patient with cancer. The lymphocytes are grown in culture, and antigen-specific lymphocytes are expanded by culturing in the presence of the specific gene products alone or in combination with at least one co-immunostimulatory molecule with cytokines. The antigen-specific lymphocytes are then infused back into the patient in an amount effective to reduce or eliminate the tumors in the patient. Cancer vaccines and their uses are further described in U.S. Pat. No. 5,961,978; U.S. Pat. No. 5,993,829; U.S. Pat. No. 6,132,980; and WO 00/38706.

Pharmaceutical Compositions and Uses

Pharmaceutical compositions can comprise polypeptides, receptors that specifically bind a polypeptide produced by a differentially expressed gene (e.g., antibodies, or polynucleotides (including antisense nucleotides and ribozymes) of the claimed invention in a therapeutically effective amount. The compositions can be used to treat primary tumors as well as metastases of primary tumors. In addition, the pharmaceutical compositions can be used in conjunction with conventional methods of cancer treatment, e.g., to sensitize tumors to radiation or conventional chemotherapy.

Where the pharmaceutical composition comprises a receptor (such as an antibody) that specifically binds to a gene product encoded by a differentially expressed gene, the receptor can be coupled to a drug for delivery to a treatment site or coupled to a detectable label to facilitate imaging of a site comprising cancer cells. Methods for coupling antibodies to drugs and detectable labels are well known in the art, as are methods for imaging using detectable labels.

The term “therapeutically effective amount” as used herein refers to an amount of a therapeutic agent to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect. The effect can be detected by, for example, chemical markers or antigen levels. Therapeutic effects also include reduction in physical symptoms, such as decreased body temperature.

The precise effective amount for a subject will depend upon the subject's size and health, the nature and extent of the condition, and the therapeutics or combination of therapeutics selected for administration. Thus, it is not useful to specify an exact effective amount in advance. However, the effective amount for a given situation is determined by routine experimentation and is within the judgment of the clinician. For purposes of the present invention, an effective dose will generally be from about 0.01 mg/kg to 50 mg/kg or 0.05 mg/kg to about 10 mg/kg of the DNA constructs in the individual to which it is administered.

A pharmaceutical composition can also contain a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent, such as antibodies or a polypeptide, genes, and other therapeutic agents. The term refers to any pharmaceutical carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition, and which can be administered without undue toxicity. Suitable carriers can be large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates and inactive virus particles. Such carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in therapeutic compositions can include liquids such as water, saline, glycerol and ethanol. Auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, can also be present in such vehicles.

Typically, the therapeutic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared. Liposomes are included within the definition of a pharmaceutically acceptable carrier. Pharmaceutically acceptable salts can also be present in the pharmaceutical composition, e.g., mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. A thorough discussion of pharmaceutically acceptable excipients is available in Remington: The Science and Practice of Pharmacy (1995) Alfonso Gennaro, Lippincott, Williams, & Wilkins.

Delivery Methods

Once formulated, the compositions contemplated by the invention can be (1) administered directly to the subject (e.g., as polynucleotide, polypeptides, small molecule agonists or antagonists, and the like); or (2) delivered ex vivo, to cells derived from the subject (e.g., as in ex vivo gene therapy). Direct delivery of the compositions will generally be accomplished by parenteral injection, e.g., subcutaneously, intraperitoneally, intravenously or intramuscularly, intratumoral or to the interstitial space of a tissue. Other modes of administration include oral and pulmonary administration, suppositories, and transdermal applications, needles, and gene guns or hyposprays. Dosage treatment can be a single dose schedule or a multiple dose schedule.

Methods for the ex vivo delivery and reimplantation of transformed cells into a subject are known in the art and described in e.g., International Publication No. WO 93/14778. Examples of cells useful in ex vivo applications include, for example, stem cells, particularly hematopoetic, lymph cells, macrophages, dendritic cells, or tumor cells. Generally, delivery of nucleic acids for both ex vivo and in vitro applications can be accomplished by, for example, dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the DNA into nuclei, all well known in the art.

Once differential expression of a gene corresponding to a polynucleotide described herein has been found to correlate with a proliferative disorder, such as neoplasia, dysplasia, and hyperplasia, the disorder can be amenable to treatment by administration of a therapeutic agent based on the provided polynucleotide, corresponding polypeptide or other corresponding molecule (e.g., antisense, ribozyme, etc.). In other embodiments, the disorder can be amenable to treatment by administration of a small molecule drug that, for example, serves as an inhibitor (antagonist) of the function of the encoded gene product of a gene having increased expression in cancerous cells relative to normal cells or as an agonist for gene products that are decreased in expression in cancerous cells (e.g., to promote the activity of gene products that act as tumor suppressors).

The dose and the means of administration of the inventive pharmaceutical compositions are determined based on the specific qualities of the therapeutic composition, the condition, age, and weight of the patient, the progression of the disease, and other relevant factors. For example, administration of polynucleotide therapeutic composition agents includes local or systemic administration, including injection, oral administration, particle gun or catheterized administration, and topical administration. In general, the therapeutic polynucleotide composition contains an expression construct comprising a promoter operably linked to a polynucleotide of at least 12, 22, 25, 30, or 35 contiguous nt of the polynucleotide disclosed herein. Various methods can be used to administer the therapeutic composition directly to a specific site in the body. For example, a small metastatic lesion is located and the therapeutic composition injected several times in several different locations within the body of the tumor. Alternatively, arteries which serve a tumor are identified, and the therapeutic composition injected into such an artery, in order to deliver the composition directly into the tumor. A tumor that has a necrotic center is aspirated and the composition injected directly into the now empty center of the tumor. The antisense composition is directly administered to the surface of the tumor, for example, by topical application of the composition. X-ray imaging is used to assist in certain of the above delivery methods.

Targeted delivery of therapeutic compositions containing an antisense polynucleotide, subgenomic polynucleotides, or antibodies to specific tissues can also be used. Receptor-mediated DNA delivery techniques are described in, for example, Findeis et al., Trends Biotechnol. (1993) 11:202; Chiou et al., Gene Therapeutics: Methods And Applications Of Direct Gene Transfer (J. A. Wolff, ed.) (1994); Wu et al., J. Biol. Chem. (1988) 263:621; Wu et al., J. Biol. Chem. (1994) 269:542; Zenke et al., Proc. Natl. Acad. Sci. (USA) (1990) 87:3655; Wu et al., J. Biol. Chem. (1991) 266:338. Therapeutic compositions containing a polynucleotide are administered in a range of about 100 ng to about 200 mg of DNA for local administration in a gene therapy protocol. Concentration ranges of about 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100:g of DNA can also be used during a gene therapy protocol. Factors such as method of action (e.g., for enhancing or inhibiting levels of the encoded gene product) and efficacy of transformation and expression are considerations that will affect the dosage required for ultimate efficacy of the antisense subgenomic polynucleotides.

The therapeutic polynucleotides and polypeptides of the present invention can be delivered using gene delivery vehicles. The gene delivery vehicle can be of viral or non-viral origin (see generally, Jolly, Cancer Gene Therapy (1994) 1:51; Kimura, Human Gene Therapy (1994) 5:845; Connelly, Human Gene Therapy (1995) 1:185; and Kaplitt, Nature Genetics (1994) 6:148). Expression of such coding sequences can be induced using endogenous mammalian or heterologous promoters. Expression of the coding sequence can be either constitutive or regulated.

Viral-based vectors for delivery of a desired polynucleotide and expression in a desired cell are well known in the art. Exemplary viral-based vehicles include, but are not limited to, recombinant retroviruses (see, e.g., WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Pat. No. 5,219,740; WO 93/11230; WO 93/10218; U.S. Pat. No. 4,777,127; GB Patent No. 2,200,651; EP 0 345 242; and WO 91/02805), alphavirus-based vectors (e.g., Sindbis virus vectors, Semliki forest virus (ATCC VR-67; ATCC VR-1247), Ross River virus (ATCC VR-373; ATCC VR-1246) and Venezuelan equine encephalitis virus (ATCC VR-923; ATCC VR-1250; ATCC VR 1249; ATCC VR-532), and adeno-associated virus (AAV) vectors (see, e.g., WO 94/12649, WO 93/03769; WO 93/19191; WO 94/28938; WO 95/11984 and WO 95/00655). Administration of DNA linked to killed adenovirus as described in Curiel, Hum. Gene Ther. (1992) 3:147 can also be employed.

Non-viral delivery vehicles and methods can also be employed, including, but not limited to, polycationic condensed DNA linked or unlinked to killed adenovirus alone (see, e.g., Curiel, Hum. Gene Ther. (1992) 3:147); ligand-linked DNA (see, e.g., Wu, J. Biol. Chem. (1989) 264:16985); eukaryotic cell delivery vehicles cells (see, e.g., U.S. Pat. No. 5,814,482; WO 95/07994; WO 96/17072; WO 95/30763; and WO 97/42338) and nucleic charge neutralization or fusion with cell membranes. Naked DNA can also be employed. Exemplary naked DNA introduction methods are described in WO 90/11092 and U.S. Pat. No. 5,580,859. Liposomes that can act as gene delivery vehicles are described in U.S. Pat. No. 5,422,120; WO 95/13796; WO 94/23697; WO 91/14445; and EP 0524968. Additional approaches are described in Philip, Mol. Cell. Biol. (1994) 14:2411, and in Woffendin, Proc. Natl. Acad. Sci. (1994) 91:1581.

Tumor Classification and Patient Stratification

The invention further provides for methods of classifying tumors, and thus grouping or “stratifying” patients, according to the expression profile of selected differentially expressed genes in a tumor. The expression patterns of differentially expressed genes can be analyzed for correlation with the expression patterns of other differentially expressed genes in a single tumor type or across tumor types. Genes that demonstrate consistent correlation can be grouped together, e.g., genes are grouped together where if one gene is overexpressed in a tumor, a second gene is also usually overexpressed. Tumors can then be classified according to the expression profile of one or more genes selected from one or more groups.

For example, a colon tumor can be classified according to expression level of a gene product of one or more genes selected from one or more of the following groups: 1) Group I, which comprises the genes IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and 2) Group II, which comprises the genes IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1.

A Group I-type colon tumor has increased expression of at least one, usually at least two, more usually at least three, even more usually at least four, preferably at least five, more preferably at least six or more, but usually not more than 12, 10, or 8, Group I genes relative to a non-cancerous colon cell, where the expression is increased at least about 1.5-fold, at least about 2-fold, at least about 5-fold, or at least about 10-fold, and can be as high 50-fold, but is usually not more than 20-fold or 30-fold.

A Group II-type colon tumor is increased in expression of at least one, usually at least two, more usually at least three, Group II genes relative to a non-cancerous colon cells, where the expression is increased at least about 1.5-fold, at least about 2-fold, at least about 5-fold, or at least about 10-fold, and can be as high 50-fold, but is usually not more than 20-fold or 30-fold.

A Group I+II-type colon tumor is increased in expression of at least one, usually at least two, more usually at least three, even more usually at least four, preferably at least five, more preferably at least six or more, but usually not more than 12, 10, or 8, Group I genes relative to a non-cancerous colon cell, and has increased expression of at least one, usually at least two, more usually at least three, Group II genes relative to a non-cancerous colon cells, where expression of both the Group I and Group II genes is increased at least about 1.5-fold, at least about 2-fold, at least about 5-fold, or at least about 10-fold, and can be as high 50-fold, but is usually not more than 20-fold or 30-fold.

The tumor of each patient in a pool of potential patients for a clinical trial can be classified as described above. Patients having similarly classified tumors can then be selected for participation in an investigative or clinical trial of a cancer therapeutic where a homogeneous population is desired. The tumor classification of a patient can also be used in assessing the efficacy of a cancer therapeutic in a heterogeneous patient population. Thus, comparison of an individual's expression profile to the population profile for a type of cancer, permits the selection or design of drugs or other therapeutic regimens that are expected to be safe and efficacious for a particular patient or patient population (i.e., a group of patients having the same type of cancer).

In addition, the ability to target populations expected to show the most clinical benefit, based on expression profile can enable: 1) the repositioning of already marketed drugs; 2) the rescue of drug candidates whose clinical development has been discontinued as a result of safety or efficacy limitations, which are patient subgroup-specific; and 3) an accelerated and less costly development for candidate therapeutics and more optimal drug labeling (e.g. since measuring the effect of various doses of an agent on patients with a particular expression profile is useful for optimizing effective dose).

A certain embodiment of the invention is based on the discovery of genes differentially expressed in cancerous colon cells relative to normal cells, particularly metastatic or pre-metastatic cancerous colon cells relative to normal cells of the same tissue type. The genes of particular interest are those described in the Examples below. The invention is further based on the discovery that colon tumors can be classified according to the expression pattern of one or more of genes, and that patients can thus be classified and diagnosed, and therapy selected accordingly, according to these expression patterns. The gene(s) for analysis of expression of a gene product encoded by at least one gene selected from at least one of the following groups: 1) Group I, which comprises the genes IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and 2) Group II, which comprises the genes IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1. A tumor can then be classified as a Group I-type, Group II-type, or Group I+II-type tumor based on the expression profile of the tumor. The expression patterns associated with colon cancer, and which provide the basis for tumor classification and patient stratification, are described in the Examples below.

The methods of the invention can be carried out using any suitable probe for detection of a gene product that is differentially expressed in colon cancer cells. For example, mRNA (or cDNA generated from mRNA) expressed from a differentially expressed gene can be detected using polynucleotide probes. In another example, the differentially expressed gene product is a polypeptide, which polypeptides can be detected using, for example, antibodies that specifically bind such polypeptides or an antigenic portion thereof.

The present invention relates to methods and compositions useful in diagnosis of colon cancer, design of rational therapy, and the selection of patient populations for the purposes of clinical trials. The invention is based on the discovery that colon tumors of a patient can be classified according to an expression profile of one or more selected genes, which genes are differentially expressed in tumor cells relative to normal cells of the same tissue. Polynucleotides that correspond to the selected differentially expressed genes can be used in diagnostic assays to provide for diagnosis of cancer at the molecular level, and to provide for the basis for rational therapy (e.g., therapy is selected according to the expression pattern of a selected set of genes in the tumor). The gene products encoded by differentially expressed genes can also serve as therapeutic targets, and candidate agents effective against such targets screened by, for example, analyzing the ability of candidate agents to modulate activity of differentially expressed gene products.

In one aspect, the selected gene(s) for tumor cell (and thus patient) analysis of expression of a gene product encoded by at least one gene selected from at least one of the following groups: 1) Group I, which comprises the genes IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and 2) Group II, which comprises the genes IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1.

In another aspect, the invention provides a method for classifying a tumor that shares selected characteristics with respect to a tumor expression profile. In one embodiment, the invention provides a method for classifying a tumor according to an expression profile of one or more genes comprising detecting expression of at least a first Group I gene in a test colon cell sample. Detection of increased expression of the first gene in the test colon cell sample relative to expression of the gene in a control non-cancer cell sample indicates that the tumor is a Group I-type tumor.

In one embodiment, the first Group I gene is an IGF2 gene. In other specific embodiments, the method further comprises detecting expression of a second Group I gene in the test colon cell sample. Detection of increased expression of the first and second genes in the test colon cell sample relative to expression of the first and second genes, respectively, in a control non-cancer cell sample indicates that the tumor is a Group I-type tumor.

In another embodiment, the method further comprises detecting expression of a second and third Group I gene in the test colon cell sample. Detection of increased expression of the first, second, and third genes in the test colon cell sample relative to expression of the first, second, and third genes, respectively, in a control non-cancer cell sample indicates that the tumor is a Group I-type tumor. In other embodiments, the expression of the gene(s) is increased about 1.5-fold, about 2-fold, about 5-fold, or about 10-fold in the test sample relative to the control sample.

In another embodiment, the invention provides a method for classifying a tumor according to an expression profile of one or more genes comprising detecting expression of at least a first Group II gene in a test colon cell sample. Detection of increased expression of the first gene in the test colon cell sample relative to expression of the gene in a control non-cancer cell sample indicates that the tumor is a Group II-type tumor.

In another embodiment, the first Group II gene is a member of the IFITM family of genes. In other specific embodiments, the method further comprises detecting expression of a second Group II gene in the test colon cell sample. Detection of increased expression of the first and second genes in the test colon cell sample relative to expression of the first and second genes, respectively, in a control non-cancer cell sample indicates that the tumor is a Group II-type tumor. In other embodiments, the expression of the gene(s) is increased about 1.5-fold, about 2-fold, about 5-fold, or about 10-fold in the test sample relative to the control sample. In yet other specific embodiments, the first Group II gene is 1-8U, 1-8D, or 9-27.

In another embodiment, the invention provides a method for classifying a tumor according to an expression profile of two or more genes, the method comprising analyzing a test colon cell sample for expression of at least one Group I gene and at least one Group II gene. Detection of increased expression of the at least one Group I gene and the at least one Group II gene in the test cell sample relative to expression of the at least one Group I gene and the at least one Group II gene, respectively, in a control non-cancer cell sample indicates the tumor is a Group I+II-type tumor. In other embodiments, the Group I gene is an IGF2 gene and the Group II gene is a member of the IFITM family of genes. In yet other embodiments, the expression of the genes is increased about 1.5-fold, about 2-fold, about 5-fold, or about 10-fold in the test sample relative to the control sample.

In another aspect, the invention provides methods for selection of a patient population having a tumor that shares selected characteristics with respect to a tumor expression profile. This method, referred to herein as “patient stratification,” can be used to improve the design of a clinical trial by providing a patient population that is more homogenous with respect to the tumor type that is to be tested for responsiveness to a new therapy; and in selecting the best therapeutic regiment for a patient in view of an expression profile of the subject's tumor (e.g., rational therapy).

In another aspect, the invention provides a method for selecting an individual for inclusion in a clinical trial, the method comprising the steps of: detecting a level of expression of a gene product in a test colon cell sample or serum obtained from a subject, the gene product being encoded by at least one gene selected from the group consisting of IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and comparing the level of expression of the gene product in the test sample to a level of expression in a normal colon cell; wherein detection of a level of expression of the gene product that is significantly higher in the test sample than in a normal cell is a positive indicator for inclusion of the subject in the test population for the clinical trial.

In another aspect the invention provides a method for selecting an individual for inclusion in a clinical trial, the method comprising the steps of: detecting a level of expression of a gene product in a test colon cell sample obtained from a subject, the gene product being encoded by at least one gene selected from the group consisting of: IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1; and comparing the level of expression of the gene product in the test sample to a level of expression in a normal colon cell; wherein detection of a level of expression of the gene product that is significantly higher in the test sample than in a normal cell is a positive indicator for inclusion of the subject in the test population for the clinical trial.

In related aspects the invention provides methods of reducing growth of cancerous colon cells by modulation of expression of one or more gene products corresponding to a gene selected from: 1) Group I, which comprises the genes IGF2, TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1; and 2) Group II, which comprises the genes IFITM (1-8U; 1-8D; 9-27), ITAK, and BIRC3/H-IAP1. These methods are useful for treating colon cancer.

In another aspect, the present invention provides methods for disease detection by analysis of gene expression. In general, diagnostic and prognostic methods of the invention can involve obtaining a test cell from a subject, e.g., colon cells; detecting the level of expression of any one gene or a selected set of genes in the test cell, where the gene(s) are differentially expressed in a colon tumor cell relative to a normal colon cell; and comparing the expression levels of the gene(s) in the test cell to a control level (e.g., a level of expression in a normal (non-cancerous) colon cell). Detection of a level of expression in the test cell that differs from that found in a normal cell indicates that the test cell is a cancerous cell. The method of the invention permits, for example, detection of a small increase or decrease in gene product production from a gene whose overexpression or underexpression (compared to a reference gene) is associated with cancer or the predisposition for a cancer.

In another aspect the invention provides a method for detecting a cancerous colon cell comprising contacting a sample obtained from a test colon cell with a probe for detection of a gene product of a gene differentially expressed in colon cancer, wherein the gene corresponds to a polynucleotide having a sequence selected from the group consisting of SEQ ID NOS: 1-20, and where contacting is for a time sufficient for binding of the probe to the gene product; and comparing a level of binding of the probe to the sample with a level of probe binding to a control sample obtained from a control colon cell, wherein the control colon cell is of known cancerous state. An increased level of binding of the probe in the test colon cell sample relative to the level of binding in a control sample is indicative of the cancerous state of the test colon cell. In specific embodiments, the probe is a polynucleotide probe and the gene product is nucleic acid. In other specific embodiments, the gene product is a polypeptide. In further embodiments, the gene product or the probe is immobilized on an array.

In another aspect, the invention provides a method for assessing the cancerous phenotype (e.g., metastasis, aberrant cellular proliferation, and the like) of a colon cell comprising detecting expression of a gene product in a test colon cell sample, wherein the gene comprises a sequence selected from the group consisting of SEQ ID NOS: 1-20; and comparing a level of expression of the gene product in the test colon cell sample with a level of expression of the gene in a control cell sample. Comparison of the level of expression of the gene in the test cell sample relative to the level of expression in the control cell sample is indicative of the cancerous phenotype of the test cell sample. In specific embodiments, detection of expression of the gene is by detecting a level of an RNA transcript in the test cell sample. In other specific embodiments detection of expression of the gene is by detecting a level of a polypeptide in a test sample.

In another aspect, the invention provides a method for suppressing or inhibiting a cancerous phenotype of a cancerous cell, the method comprising introducing into a mammalian cell an antisense polynucleotide for inhibition of expression of a gene comprising a sequence selected from the group consisting of SEQ ID NOS: 1-20. Inhibition of expression of the gene inhibits development of a cancerous phenotype in the cell. In specific embodiments, the cancerous phenotype is metastasis, aberrant cellular proliferation relative to a normal cell, or loss of contact inhibition of cell growth.

In another aspect, the invention provides a method for assessing the tumor burden of a subject, the method comprising detecting a level of a differentially expressed gene product in a test sample from a subject suspected of or having a tumor, the differentially expressed gene product comprising a sequence selected from the group consisting of SEQ ID NOS: 1-20. Detection of the level of the gene product in the test sample is indicative of the tumor burden in the subject.

In another aspect, the invention provides a method for identifying a gene product as a target for a cancer therapeutic, the method comprising contacting a cancerous cell expressing a candidate gene product with an anti-cancer agent, wherein the candidate gene product corresponds to a sequence selected from the group consisting of SEQ ID NOS: 1-20; and analyzing the effect of the anti-cancer agent upon a biological activity of the candidate gene product and upon a cancerous phenotype of the cancerous cell. Modulation of the biological activity of the candidate gene product and modulation of the cancerous phenotype of the cancerous cell indicates the candidate gene product is a target for a cancer therapeutic. In specific embodiments, the cancerous cell is a cancerous colon cell. In other specific embodiments, the inhibitor is an antisense oligonucleotide. In further embodiments, the cancerous phenotype is aberrant cellular proliferation relative to a normal cell, or colony formation due to loss of contact inhibition of cell growth.

In another aspect, the invention provides a method for identifying agents that decrease biological activity of a gene product differentially expressed in a cancerous cell, the method comprising contacting a candidate agent with a differentially expressed gene product, the differentially expressed gene product corresponding to a sequence selected from the group consisting of SEQ ID NOS: 1-20; and detecting a decrease in a biological activity of the gene product relative to a level of biological activity of the gene product in the absence of the candidate agent. In specific embodiments, the detecting is by detection of a decrease in expression of the differentially expressed gene product. In other specific embodiments, the gene product is mRNA or cDNA prepared from the mRNA gene product. In further embodiments, the gene product is a polypeptide.

In all embodiments of the invention, analysis of expression of a gene product of a selected gene can be accomplished by analysis of gene transcription (e.g., by generating cDNA clones from mRNAs isolated from a cell suspected of being cancerous and comparing the number of cDNA clones corresponding to the gene in the sample relative to a number of clones present in a non-cancer cell of the same tissue type), detection of an encoded gene product (e.g., assessing a level of polypeptide encoded by a selected gene present in the test cell suspected of being cancerous relative to a level of the polypeptide in a non-cancer cell of the same tissue type), detection of a biological activity of a gene product encoded by a selected gene, and the like.

In all embodiments of the invention, comparison of gene product expression of a selected gene in a tumor cell can involve, for example, comparison to an “internal” control cell (e.g., a non-cancer cell of the same tissue type obtained from the same patient from whom the sample suspected of having a tumor cell was obtained), comparison to a control cell analyzed in parallel in the assay (e.g., a non-cancer cell, normally of the same tissue type as the test cell or a cancerous cell, normally of the same tissue type as the test cell), or comparison to a level of gene product expression known to be associated with a normal cell or a cancerous cell, normally of the same tissue type (e.g., a level of gene product expression is compared to a known level or range of levels of gene product expression for a normal cell or a cancerous cell, which can be provided in the form of, for example, a standard).

The sequences disclosed in this patent application were disclosed in several earlier patent applications. The relationship between the SEQ ID NOS in those earlier applications and the SEQ ID NOS disclosed herein is as follows. SEQ ID NOS: 1-321 of parent case 15805CON (Ser. No. 10/616,900, filed Jul. 9, 2003) correspond to SEQ ID NOS: 1-321 of the present application. SEQ ID NOS: 1-20 of parent case 16335 (Ser. No. 10/081,519, filed Feb. 21, 2002) correspond to SEQ ID NOS: 322-341 of the present application. SEQ ID NOS: 1-2164 of parent case 18095 (Ser. No. 10/310,673, filed Dec. 4, 2002) correspond to SEQ ID NOS: 342-2505 of the present application. SEQ ID NOS: 1-516 of parent case 17767 (Ser. No. 10/501,187, filed Jul. 8, 2004) correspond to SEQ ID NOS: 2506-3021 of the present application. SEQ ID NOS: 1-1303 of parent case 16336 (Ser. No. 10/081,124, filed Feb. 21, 2002) correspond to SEQ ID NOS: 3022-4324 of the present application. SEQ ID NOS: 1-9672 of parent case 18376 (US04/15421, filed May 13, 2004) correspond to SEQ ID NOS: 4325-13996 of the present application.

The disclosures of all prior U.S. applications to which the present application claims priority, which includes those U.S. applications referenced in the table above as well as their respective priority applications, are each incorporated herein by referenced in their entireties for all purposes, including the disclosures found in the Sequence Listings, tables, figures and Examples.

EXAMPLES

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.

Example 1 Source of Biological Materials and Isolation of Polynucleotides Expressed by the Biological Materials

Candidate polynucleotides that may represent genes differentially expressed in cancer were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues. In order to obtain the latter polynucleotides, mRNA was isolated from several selected cell lines and patient tissues, and used to construct cDNA libraries. The cells and tissues that served as sources for these cDNA libraries are summarized in Table 1 below.

TABLE 1 Description of cDNA Libraries Number of Library Clones in (lib #) Description Library 1 Human Colon Cell Line Km12 L4: High Metastatic 308731 Potential (derived from Km12C) 2 Human Colon Cell Line Km12C: Low Metastatic 284771 Potential 3 Human Breast Cancer Cell Line MDA-MB-231: 326937 High Metastatic Potential; micro-mets in lung 4 Human Breast Cancer Cell Line MCF7: Non 318979 Metastatic 8 Human Lung Cancer Cell Line MV-522: High 223620 Metastatic Potential 9 Human Lung Cancer Cell Line UCP-3: Low 312503 Metastatic Potential 12 Human microvascular endothelial cells (HMVEC) - 41938 UNTREATED (PCR (OligodT) cDNA library) 13 Human microvascular endothelial cells (HMVEC) - 42100 bFGF TREATED (PCR (OligodT) cDNA library) 14 Human microvascular endothelial cells (HMVEC) - 42825 VEGF TREATED (PCR (OligodT) cDNA library) 15 Normal Colon - UC#2 Patient (MICRODISSECTED 248436 PCR (OligodT) cDNA library) 16 Colon Tumor - UC#2 Patient (MICRODISSECTED 263206 PCR (OligodT) cDNA library) 17 Liver Metastasis from Colon Tumor of UC#2 266482 Patient (MICRODISSECTED PCR (OligodT) cDNA library) 18 Normal Colon - UC#3 Patient (MICRODISSECTED 36216 PCR (OligodT) cDNA library) 19 Colon Tumor - UC#3 Patient (MICRODISSECTED 41388 PCR (OligodT) cDNA library) 20 Liver Metastasis from Colon Tumor of UC#3 30956 Patient (MICRODISSECTED PCR (OligodT) cDNA library) 21 GRRpz Cells derived from normal prostate 164801 epithelium 22 WOca Cells derived from Gleason Grade 4 prostate 162088 cancer epithelium 23 Normal Lung Epithelium of Patient #1006 306197 (MICRODISSECTED PCR (OligodT) cDNA library) 24 Primary tumor, Large Cell Carcinoma of Patient 309349 #1006 (MICRODISSECTED PCR (OligodT) cDNA library)

The human colon cancer cell line Km12L4-A (Morikawa, et al., Cancer Research (1988) 48:6863) is derived from the KM12C cell line. The KM12C cell line (Morikawa et al. Cancer Res. (1988) 48:1943-1948), which is poorly metastatic (low metastatic) was established in culture from a Dukes' stage B2 surgical specimen (Morikawa et al. Cancer Res. (1988) 48:6863). The KML4-A is a highly metastatic subline derived from KM12C (Yeatman et al. Nucl. Acids. Res. (1995) 23:4007; Bao-Ling et al. Proc. Annu. Meet. Am. Assoc. Cancer. Res. (1995) 21:3269). The KM12C and KM12C-derived cell lines (e.g., KM12L4, KM12L4-A, etc.) are well-recognized in the art as a model cell line for the study of colon cancer (see, e.g., Moriakawa et al., supra; Radinsky et al. Clin. Cancer Res. (1995) 1:19; Yeatman et al., (1995) supra; Yeatman et al. Clin. Exp. Metastasis (1996) 14:246).

The MDA-MB-231 cell line (Brinkley et al. Cancer Res. (1980) 40:3118-3129) was originally isolated from pleural effusions (Cailleau, J. Natl. Cancer. Inst. (1974) 53:661), is of high metastatic potential, and forms poorly differentiated adenocarcinoma grade II in nude mice consistent with breast carcinoma. The MCF7 cell line was derived from a pleural effusion of a breast adenocarcinoma and is non-metastatic. The MV-522 cell line is derived from a human lung carcinoma and is of high metastatic potential. The UCP-3 cell line is a low metastatic human lung carcinoma cell line; the MV-522 is a high metastatic variant of UCP-3. These cell lines are well-recognized in the art as models for the study of human breast and lung cancer (see, e.g., Chandrasekaran et al., Cancer Res. (1979) 39:870 (MDA-MB-231 and MCF-7); Gastpar et al., J Med Chem (1998) 41:4965 (MDA-MB-231 and MCF-7); Ranson et al., Br J Cancer (1998) 77:1586 (MDA-MB-231 and MCF-7); Kuang et al., Nucleic Acids Res (1998) 26:1116 (MDA-MB-231 and MCF-7); Varki et al., Int J Cancer (1987) 40:46 (UCP-3); Varki et al., Tumour Biol. (1990) 11:327; (MV-522 and UCP-3); Varki et al., Anticancer Res. (1990) 10:637; (MV-522); Kelner et al., Anticancer Res (1995) 15:867 (MV-522); and Zhang et al., Anticancer Drugs (1997) 8:696 (MV522)).

The samples of libraries 15-20 are derived from two different patients (UC#2, and UC#3). The bFGF-treated HMVEC were prepared by incubation with bFGF at 10 ng/ml for 2 hrs; the VEGF-treated HMVEC were prepared by incubation with 20 ng/ml VEGF for 2 hrs. Following incubation with the respective growth factor, the cells were washed and lysis buffer added for RNA preparation. The GRRpz and WOca cell lines were provided by Dr. Donna M. Peehl, Department of Medicine, Stanford University School of Medicine. GRRpz was derived from normal prostate epithelium. The WOca cell line is a Gleason Grade 4 cell line.

Characterization of Sequences in the Libraries

The sequences of the isolated polynucleotides were first masked to eliminate low complexity sequences using the XBLAST masking program (Claverie “Effective Large-Scale Sequence Similarity Searches,” In: Computer Methods for Macromolecular Sequence Analysis, Doolittle, ed., Meth. Enzymol. 266:212-227 Academic Press, NY, N.Y. (1996); see particularly Claverie, in “Automated DNA Sequencing and Analysis Techniques” Adams et al., eds., Chap. 36, p. 267 Academic Press, San Diego, 1994 and Claverie et al. Comput. Chem. (1993) 17:191). Generally, masking does not influence the final search results, except to eliminate sequences of relative little interest due to their low complexity, and to eliminate multiple “hits” based on similarity to repetitive regions common to multiple sequences, e.g., Alu repeats. Masking resulted in the elimination of several sequences. The remaining sequences were then used in a BLASTN vs. GenBank search. Gene assignment for the query sequences was determined based on best hit from the GenBank database; expectancy values are provided with the hit.

Summary of Polynucleotides Described Herein

Table 2 provides a summary of polynucleotides isolated as described above and identified as corresponding to a differentially expressed gene (see Example 2 below), as well as those polynucleotides obtained from publicly available sources. Specifically, Table 2 provides: 1) the SEQ ID NO assigned to each sequence for use in the present specification; 2) the Candidate Identification Number (“CID”) to which the sequence is assigned and which number is based on the selection of the candidate for further evaluation in the differential expression in cancerous cells relative to normal cells; 3) the Sequence Name assigned to each sequence; and 4) the name assigned to the sample or clone from which the sequence was isolated. The sequences corresponding to SEQ ID NOS are provided in the Sequence Listing. Because at least some of the provided polynucleotides represent partial mRNA transcripts, two or more polynucleotides may represent different regions of the same mRNA transcript and the same gene and/or may be contained within the same clone. Thus, if two or more SEQ ID NOS are identified as belonging to the same clone, then either sequence can be used to obtain the full-length mRNA or gene. It should be noted that not all cDNA libraries described above are represented on an array in the examples described below.

TABLE 2 SEQ ID NO CID Sequence Name Sample Name or Clone Name 1 114 016824.Seq M00003814C:C11 2 123 019.G3.sp6_128473 M00006883D:H12 3 114 020.B11.sp6_128613 M00003814C:C11 4 1 1222317 I:1222317:15A02:C02 5 2 1227385 I:1227385:14B01:G05 6 3 1297179 I:1297179:05A02:F02 7 4 1298021 I:1298021:05A01:G10 8 5 1358285 I:1358285:04A02:F11 9 6 1384823 I:1384823:01B02:F08 10 7 1395918 I:1395918:04A01:G10 11 8 1402615 I:1402615:09A02:E03 12 9 1421929 I:1421929:05A01:D02 13 10 1431819 I:1431819:14B01:D05 14 11 1443877 I:1443877:03B02:B08 15 12 1450639 I:1450639:03B02:E09 16 13 1480159 I:1480159:06B02:E03 17 14 1509602 I:1509602:04A01:A11 18 15 1516301 I:1516301:05B01:C10 19 167 1598.C19.gz43_212821 M00055583C:B07 20 16 1600586 I:1600586:05B02:F04 21 17 1609538 I:1609538:06A02:F04 22 18 1613615 I:1613615:03B01:D10 23 19 1630804 I:1630804:06A02:F10 24 20 1633286 I:1633286:06A02:E04 25 21 1666080 I:1666080:07B02:D04 26 22 1699587 I:1699587:06A02:F11 27 23 1702266 I:1702266:02B01:D09 28 24 1712592 I:1712592:04A01:E03 29 25 1723834 I:1723834:01A01:C02 30 26 1743234 I:1743234:16B01:D09 31 170 1744.K05.gz43_221934 M00056250C:B02 32 27 1749417 I:1749417:04A02:D10 33 28 1749883 I:1749883:05B01:D04 34 29 1750782 I:1750782:02A01:A08 35 30 1758241 I:1758241:15B02:G04 36 31 1809385 I:1809385:02A02:G04 37 32 1810640 I:1810640:01A02:D06 38 33 1817434 I:1817434:02B01:C02 39 34 1833191 I:1833191:14A01:G05 40 35 1854245 I:1854245:02B02:E10 41 36 1854558 I:1854558:03A01:C11 42 37 1857563 I:1857563:05B02:D01 43 38 1920522 I:1920522:15B02:F02 44 39 1920650 I:1920650:16A01:B01 45 41 1923490 I:1923490:18B01:H08 46 42 1923769 I:1923769:16B01:F01 47 43 1926006 I:1926006:15A01:F09 48 44 1931371 I:1931371:02B02:D12 49 45 1960722 I:1960722:13B02:D11 50 46 1963753 I:1963753:18B01:E07 51 47 1965257 I:1965257:18B02:B04 52 48 1967543 I:1967543:16B02:F06 53 49 1968921 I:1968921:15A02:D06 54 50 1969044 I:1969044:18B01:E12 56 53 1996180 I:1996180:19B01:C11 57 54 2054678 I:2054678:19A01:F10 58 55 2055926 I:2055926:14A01:F11 59 56 2056395 I:2056395:13A02:B07 60 58 2060725 I:2060725:13A01:G10 61 59 2079906 I:2079906:01A02:A06 62 60 2152363 I:2152363:04A02:A08 63 63 2239819 I:2239819:04A02:B11 64 64 2359588 I:2359588:18A01:F03 65 65 2458926 I:2458926:03B01:C07 66 66 2483109 I:2483109:05A01:A06 67 67 2499479 I:2499479:05A01:D06 68 68 2499976 I:2499976:01B02:E09 70 71 2615513 I:2615513:04B01:D09 71 74 2675481 I:2675481:05A01:G06 73 100 268.H2.sp6_144757 M00001341B:A11 74 105 270.B6.sp6_145073 M00001402B:C12 75 106 270.C6.sp6_145085 M00001402C:B01 76 104 270.H3.sp6_145142 M00001393D:F01 77 75 2759046 I:2759046:19B02:C05 78 76 2825369 I:2825369:07A02:F09 79 77 2840195 I:2840195:01B02:G11 80 78 2902903 I:2902903:12A02:F02 81 79 2914605 I:2914605:04B01:G06 82 80 2914719 I:2914719:04B02:B05 83 81 3229778 I:3229778:02B01:B07 84 109 323.B1.sp6_145452 M00001489B:G04 85 110 323.C3.sp6_145466 M00001496A:G03 86 111 324.H1.sp6_145716 M00001558C:B06 87 121 325.H11.sp6_145918 M00005360A:A07 88 118 325.H4.sp6_145911 M00004031B:D12 89 41 344.B2.sp6_146237 M00022742A:F08 90 139 344.C4.sp6_146251 M00023363C:A04 91 83 3518380 I:3518380:16A01:B07 92 85 4072558 I:4072558:12B01:A07 93 117 414.A11.sp6_149879 M00003961B:H05 94 113 414.F2.sp6_149930 M00001675B:G05 95 87  549299 I:549299:17B02:F06 96 88  605019 I:605019:13B02:D03 97 89  620494 I:620494:16A01:C10 98 125 626.D8.sp6_157447 M00007965C:G08 99 128 627.E8.sp6_157651 M00007987D:D04 100 127 627.G6.sp6_157673 M00007985B:A03 101 129 628.D12.sp6_157835 M00008049B:A12 102 130 634.H4.sp6_155966 M00008099D:A05 104 136 642.C6.sp6_156292 M00022168B:F02 106 5 642.D8.sp6_156306 M00022180D:E11 107 137 642.H11.sp6_156357 M00022215C:A10 108 138 653.A3.sp6_158944 M00023283C:C06 109 141 655.B4.sp6_156470 M00023431B:A01 110 90  659143 I:659143:16B01:E06 111 145 661.B5.sp6_159726 M00027066B:E09 112 91  750899 I:750899:16A01:D04 113 92  763607 I:763607:16A01:E09 114 93  901317 I:901317:16A01:G01 116 100 919.H2.SP6_168750 M00001341B:A11 118 123 956.B04.sp6_177996 M00006883D:H12 119 94  956077 I:956077:14B01:H04 120 95  970933 I:970933:14B01:D03 121 96  986558 I:986558:18A01:C09 122 98  998612 I:998612:14B02:G06 123 103 A061.ga43_378496 M00001374A:A06 124 103 A062.ga43_378497 M00001374A:A06 125 133 A121.ga43_378498 M00022009A:A12 126 133 A122.ga43_378499 M00022009A:A12 130 115 G022a.ga43_378503 M00003852B:C01 131 106 RTA00000179AF.k.22.1.Seq M00001402C:B01 132 113 RTA00000187AF.g.2.1.Seq M00001675B:G05 133 113 RTA00000187AR.g.2.2.Seq M00001675B:G05 134 106 RTA00000348R.j.10.1.Seq M00001402C:B01 135 116 RTA00000588F.l.02.2.Seq M00003853B:G11 136 117 RTA00000588F.o.23.1.Seq M00003961B:H05 138 123 RTA00000603F.d.06.1.Seq M00006883D:H12 140 140 RTA00000847F.n.19.3.Seq M00023371A:G03 141 143 RTA00000922F.g.12.1.Seq M00026900D:F02 142 121 RTA00001042F.o.18.1.Seq M00005360A:A07 143 121 RTA00001064F.c.16.1.Seq M00005360A:A07 144 139 RTA00001069F.c.03.1.Seq M00023363C:A04 145 112 RTA00002890F.d.16.1.P.Seq M00001600C:B11 147 166 RTA22200002F.b.15.1.P.Seq M00055435B:A12 148 167 RTA22200003F.b.13.1.P.Seq M00055583C:B07 149 169 RTA22200005F.d.14.1.P.Seq M00055873C:B06 150 30 RTA22200007F.j.17.2.P.Seq M00056227B:G06 151 170 RTA22200007F.m.02.1.P.Sequence M00056250C:B02 152 171 RTA22200008F.a.24.1.P.Seq M00056301D:A04 153 171 RTA22200008F.b.01.1.P.Seq M00056301D:A04 154 172 RTA22200008F.b.22.1.P.Sequence M00056308A:F02 155 147 RTA22200009F.b.03.2.P.Sequence M00042439D:C11 156 149 RTA22200009F.c.22.2.P.Seq M00042756A:H02 157 150 RTA22200009F.e.10.1.P.Seq M00042770D:G04 158 151 RTA22200009F.i.17.2.P.Seq M00042818A:D05 159 173 RTA22200009F.p.21.1.P.Seq M00056350B:B03 161 175 RTA22200010F.k.02.1.P.Seq M00056478D:B07 162 176 RTA22200010F.k.19.1.P.Seq M00056483D:G07 163 177 RTA22200010F.m.13.1.P.Seq M00056500C:A07 164 178 RTA22200011F.b.05.1.P.Seq M00056533D:G07 165 179 RTA22200011F.b.09.1.P.Seq M00056534C:E08 166 180 RTA22200011F.g.21.1.P.Seq M00056585B:F04 168 182 RTA22200011F.l.06.1.P.Seq M00056619A:H02 169 183 RTA22200011F.l.15.1.P.Seq M00056622B:F12 170 184 RTA22200011F.m.13.1.P.Seq M00056632B:H10 171 185 RTA22200011F.n.24.1.P.Seq M00056645C:D11 172 185 RTA22200011F.o.01.1.P.Seq M00056645C:D11 173 186 RTA22200011F.o.03.1.P.Seq M00056646B:F07 174 187 RTA22200012F.c.01.1.P.Seq M00056679B:H03 176 189 RTA22200012F.f.15.1.P.Seq M00056709B:D03 177 190 RTA22200012F.i.14.1.P.Seq M00056728C:G02 179 192 RTA22200013F.b.20.1.P.Seq M00056810A:A02 180 193 RTA22200013F.c.06.1.P.Seq M00056812D:A08 181 194 RTA22200013F.d.15.1.P.Seq M00056822A:E08 182 195 RTA22200013F.o.17.1.P.Seq M00056908A:H05 183 196 RTA22200013F.p.24.1.P.Seq M00056918C:F09 184 197 RTA22200014F.b.18.1.P.Seq M00056937C:C10 185 197 RTA22200014F.b.18.2.P.Seq M00056937C:C10 190 199 RTA22200014F.j.08.1.P.Seq M00056992C:F12 191 199 RTA22200014F.j.08.2.P.Seq M00056992C:F12 192 200 RTA22200015F.a.18.1.P.Seq M00057044D:G03 193 176 RTA22200015F.a.23.1.P.Seq M00057046A:G09 194 201 RTA22200015F.f.17.1.P.Seq M00057081B:H03 196 118 RTA22200015F.k.10.1.P.Seq M00057112B:E11 198 204 RTA22200015F.m.15.1.P.Seq M00057127B:B09 200 206 RTA22200016F.i.21.1.P.Seq M00057231A:G04 201 207 RTA22200016F.k.08.1.P.Seq M00057241C:F03 202 152 RTA22200019F.h.04.1.P.Seq M00054500D:C08 204 151 RTA22200019F.j.24.1.P.Seq M00054520A:D04 205 151 RTA22200019F.k.01.1.P.Seq M00054520A:D04 206 153 RTA22200019F.m.05.1.P.Seq M00054538C:C01 207 154 RTA22200020F.i.12.1.P.Seq M00054639D:F05 208 155 RTA22200020F.j.09.1.P.Seq M00054647A:A09 209 156 RTA22200020F.j.24.1.P.Seq M00054650D:E04 210 157 RTA22200021F.d.09.2.P.Seq M00054742C:B12 211 158 RTA22200021F.g.18.3.P.Seq M00054769A:E05 212 159 RTA22200021F.h.15.3.P.Seq M00054777D:E09 213 160 RTA22200021F.i.23.3.P.Seq M00054806B:G03 214 161 RTA22200022F.d.04.1.P.Seq M00054893C:D03 215 162 RTA22200022F.m.09.1.P.Seq M00054971D:D07 217 195 RTA22200024F.i.11.1.P.Seq M00055209C:B07 218 164 RTA22200024F.p.03.1.P.Seq M00055258B:D12 220 65 RTA22200026F.d.17.1.P.Seq M00055423A:C07 222 124 RTA22200231F.b.20.1.P.Seq M00007935D:A05 223 126 RTA22200231F.l.22.1.P.Seq M00007985A:B08 224 132 RTA22200232F.d.23.1.P.Seq M00021956B:A09 225 291 RTA22200232F.m.17.1.P.Seq M00022140A:E11 226 142 RTA22200241F.e.15.1.P.Seq M00026888A:A03 227 144 RTA22200241F.g.22.1.P.Seq M00026903D:D11 228 115 X2.ga43_378506 M00003852B:C01 230 255 gb|AA024920.1|AA024920 RG:364972:10009:B06 231 262 gb|AA033519.1|AA033519 RG:471154:10009:H04 232 256 gb|AA039790.1|AA039790 RG:376554:10009:B12 233 263 gb|AA043829.1|AA043829 RG:487171:10009:H09 234 265 gb|AA070046.1|AA070046 RG:530002:10002:A08 235 264 gb|AA128438.1|AA128438 RG:526536:10002:A02 236 266 gb|AA179757.1|AA179757 RG:612874:10002:G02 239 269 gb|AA232253.1|AA232253 RG:666323:10010:B07 240 270 gb|AA234451.1|AA234451 RG:669110:10010:B12 242 273 gb|AA399596.1|AA399596 RG:729913:10010:G11 243 276 gb|AA400338.1|AA400338 RG:742764:10011:A06 247 236 gb|AA431134.1|AA431134 RG:781507:10011:E01 248 277 gb|AA446295.1|AA446295 RG:781028:10011:D08 249 278 gb|AA448898.1|AA448898 RG:785368:10011:E11 250 278 gb|AA449542.1|AA449542 RG:785846:10011:F02 252 274 gb|AA477696.1|AA477696 RG:740831:10010:H12 253 280 gb|AA530983.1|AA530983 RG:985973:10012:B09 254 259 gb|AA679027.1|AA679027 RG:432960:10009:E11 255 210 gb|AA723679.1|AA723679 RG:1325847:10012:H07 256 213 gb|AA829074.1|AA829074 RG:1374447:20004:G01 257 212 gb|AA830348.1|AA830348 RG:1353123:10013:A06 258 214 gb|AA885302.1|AA885302 RG:1461567:10013:E03 260 216 gb|AA926951.1|AA926951 RG:1552386:10013:G04 262 219 gb|AI004332.1|AI004332 RG:1631867:10014:B06 263 252 gb|AI015644.1|AI015644 RG:1635546:10014:B08 264 220 gb|AI017336.1|AI017336 RG:1638979:10014:C04 265 218 gb|AI018495.1|AI018495 RG:1630930:10014:B05 266 221 gb|AI031810.1|AI031810 RG:1645945:10014:D05 267 226 gb|AI054129.1|AI054129 RG:1861510:20001:B03 268 212 gb|AI066521.1|AI066521 RG:1637619:10014:C02 269 223 gb|AI076187.1|AI076187 RG:1674098:10014:H01 270 221 gb|AI079570.1|AI079570 RG:1674393:10014:H02 271 206 gb|AI123832.1|AI123832 RG:1651303:10014:E01 272 225 gb|AI207972.1|AI207972 RG:1838677:10015:E10 273 231 gb|AI224731.1|AI224731 RG:2002384:20003:E01 274 233 gb|AI265824.1|AI265824 RG:2006592:20003:F12 275 232 gb|AI279390.1|AI279390 RG:2006302:20003:F08 276 227 gb|AI298668.1|AI298668 RG:1895716:10015:G09 277 229 gb|AI305997.1|AI305997 RG:1996788:20003:C10 278 230 gb|AI306323.1|AI306323 RG:1996901:20003:D01 279 239 gb|AI335279.1|AI335279 RG:2055807:10016:B09 280 238 gb|AI336511.1|AI336511 RG:2051667:20003:H05 281 228 gb|AI347995.1|AI347995 RG:1927470:10015:H08 282 235 gb|AI356632.1|AI356632 RG:2012168:10016:B05 283 237 gb|AI375104.1|AI375104 RG:2048081:10016:B08 284 241 gb|AI421409.1|AI421409 RG:2097257:10016:C07 285 242 gb|AI421521.1|AI421521 RG:2097294:10016:C08 286 243 gb|AI523571.1|AI523571 RG:2117694:10016:E01 287 258 gb|H00135.1|H00135 RG:43296:10005:C03 288 261 gb|H08424.1|H08424 RG:45623:10005:D09 289 260 gb|H12948.1|H12948 RG:43534:10005:C04 290 236 gb|H54104.1|H54104 RG:203031:10007:A09 293 246 gb|N55598.1|N55598 RG:244601:10007:E02 294 245 gb|N75655.1|N75655 RG:244132:10007:E01 295 248 gb|N98702.1|N98702 RG:278409:10008:B10 296 129 gb|R12138.1|R12138 RG:25258:10004:D09 298 2 gb|R17980.1|R17980 RG:32281:10004:G05 299 254 gb|R21293.1|R21293 RG:35892:10004:H10 300 249 gb|R41558.1|R41558 RG:29739:10004:F02 301 2 gb|R56713.1|R56713 RG:41097:10005:B10 302 224 gb|R85309.1|R85309 RG:180296:10006:G03 303 222 gb|R87679.1|R87679 RG:166410:10006:F01 304 208 gb|T83145.1|T83145 RG:110764:10005:H04 305 250 gb|W16960.1|W16960 RG:301608:10008:D09 306 251 gb|W24201.1|W24201 RG:306813:10008:E12 307 252 gb|W45587.1|W45587 RG:323425:10008:F11 308 253 gb|W69496.1|W69496 RG:343821:10008:H05 309 257 gb|W87460.1|W87460 RG:417109:10009:D09

Summary of Blast Search Results

Table 3 provides the results of BLASTN searches of the Genbank database using the sequences of the polynucleotides as described above. Table 3 includes 1) the SEQ ID NO; 2) the “CID” or Candidate Identification Number to which the sequence is assigned; 3) the GenBank accession number of the Blast hit; 4) a description of the gene encoded by the Blast hit (“HitDesc”) having the closest sequence homology to the sequence on the array (and in some instances contains a sequence identical to the sequence on the array); 5) the Blast score (“Score”), which value is obtained by adding the similarities and differences of an alignment between the sequence and a database sequence, wherein a “match” is a positive value and a “mismatch” or “non-match” is a negative value; 6) the “Length” of the sequence, which represents the number of nucleotides in the database “hit”; 7) the Expect value (E) which describes the number of hits or matches “expected” if the database was random sequence, i.e. the E value describes the random background noise that exists for matches between sequences; and 8) the “Identities” ratio which is a ratio of number of bases in the query sequence that exactly match the number of bases in the database sequence when aligned.

TABLE 3 SEQ GenBank ID Accession NO CID No. HitDesc Score Length Expect Identities 1 114 D29958 gi|473948|dbj|D29958.1|HUMORFA10 573 1011 1E−162 289/289 Human mRNA for KIAA0116 gene, partial cds 2 123 NM_020510 gi|10048405|ref|NM_020510.1| Mus 77.8 2112 3E−12  39/39 musculus frizzled homolog 10 (Drosophila) (Fzd10), mRNA 3 114 D29958 gi|473948|dbj|D29958.1|HUMORFA10 969 1011 0 559/575 Human mRNA for KIAA0116 gene, partial cds 4 1 XM_001344 gi|11421753|ref|XM_001344.1| Homo 464 512 1E−129 234/234 sapiens S100 calcium-binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) (S100A4), mRNA 5 2 NM_004443 gi|4758287|ref|NM_004443.1| Homo 194 3805 3E−48  137/145 sapiens EphB3 (EPHB3) mRNA 6 3 BC001014 gi|12654380|gb|BC001014.1|BC001014 444 1378 1E−123 224/224 Homo sapiens, Similar to methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase, clone IMAGE: 3344724, mRNA, partial cds 7 4 NM_001363 gi|4503336|ref|NM_001363.1| Homo 513 2422 1E−144 259/259 sapiens dyskeratosis congenita 1, dyskerin (DKC1), mRNA 8 5 NM_001699 gi|11863124|ref|NM_001699.2| Homo 543 4986 1E−153 281/282 sapiens AXL receptor tyrosine kinase (AXL), transcript variant 2, mRNA 9 6 NM_001827 gi|4502858|ref|NM_001827.1| Homo 535 627 1E−150 279/282 sapiens CDC28 protein kinase 2 (CKS2), mRNA 10 7 XM_011126 gi|12730374|ref|XM_011126.1| Homo 515 2219 1E−144 260/260 sapiens Arg/Abl-interacting protein ArgBP2 (ARGBP2), mRNA 11 8 BC002718 gi|12803760|gb|BC002718.1|BC002718 299 1028 1E−79  223/236 Homo sapiens, type I transmembrane protein Fn14, clone MGC: 3386, mRNA, complete cds 12 9 XM_007891 gi|11430799|ref|XM_007891.1| Homo 317 3171 3E−85  160/160 sapiens cadherin 3, type 1, P-cadherin (placental) (CDH3), mRNA 13 10 BC001883 gi|12804870|gb|BC001883.1|BC001883 490 2464 1E−137 255/259 Homo sapiens, nucleolar phosphoprotein p130, clone MGC: 1494, mRNA, complete cds 14 11 XM_002532 gi|11429973|ref|XM_002532.1| Homo 440 1132 1E−122 244/255 sapiens 26S proteasome-associated pad1 homolog (POH1), mRNA 15 12 BC005334 gi|13529121|gb|BC005334.1|BC005334 494 1047 1E−138 258/260 Homo sapiens, centrin, EF-hand protein, 2, clone MGC: 12421, mRNA, complete cds 16 13 XM_009001 gi|12742166|ref|XM_009001.2| Homo 462 1506 1E−128 233/233 sapiens kallikrein 6 (neurosin, zyme) (KLK6), mRNA 17 14 XM_005818 gi|12735488|ref|XM_005818.2| Homo 373 2420 1E−102 188/188 sapiens arachidonate 5-lipoxygenase (ALOX5), mRNA 18 15 XM_012273 gi|12737900|ref|XM_012273.1| Homo 396 3314 1E−109 200/200 sapiens forkhead box M1 (FOXM1), mRNA 19 167 AK000140 gi|7020034|dbj|AK000140.1|AK000140 1114 1403 0 587/596 Homo sapiens cDNA FLJ20133 fis, clone COL06539 20 16 BC003146 gi|13111946|gb|BC003146.1|BC003146 432 1720 1E−119 218/218 Homo sapiens, splicing factor 3b, subunit 3, 130 kD, clone MGC: 3924, mRNA, complete cds 21 17 BC001763 gi|12804676|gb|BC001763.1|BC001763 404 1917 1E−111 206/207 Homo sapiens, Similar to translocase of outer mitochondrial membrane 34, clone MGC: 1252, mRNA, complete cds 22 18 XM_007326 gi|11434291|ref|XM_007326.1| Homo 404 1944 1E−111 204/204 sapiens bone morphogenetic protein 4 (BMP4), mRNA 23 19 XM_005376 gi|12734932|ref|XM_005376.2| Homo 371 1503 1E−101 192/194 sapiens Friedreich ataxia (FRDA), mRNA 24 20 XM_010945 gi|12729201|ref|XM_010945.1| Homo 452 614 1E−125 228/228 sapiens hypothetical gene supported by XM_010945 (LOC65371), mRNA 25 21 AK018953 gi|12858931|dbj|AK018953.1|AK018953 174 1297 5E−42  174/203 Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone: 1700111D04, full insert sequence 26 22 BC003635 gi|13177711|gb|BC003635.1|BC003635 456 1140 1E−127 230/230 Homo sapiens, matrix metalloproteinase 7 (matrilysin, uterine), clone MGC: 3913, mRNA, complete cds 27 23 XM_008589 gi|11427373|ref|XM_008589.1| Homo 440 1790 1E−122 224/225 sapiens pyrroline-5-carboxylate reductase 1 (PYCR1), mRNA 28 24 BC001880 gi|12804864|gb|BC001880.1|BC001880 379 1469 1E−103 191/191 Homo sapiens, Similar to insulin induced gene 1, clone MGC: 1405, mRNA, complete cds 29 25 XM_003047 gi|12729625|ref|XM_003047.2| Homo 353 3383 7E−96  178/178 sapiens minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin) (MCM2), mRNA 30 26 NC_002548 gi|10314009|ref|NC_002548.1| Acute bee 38.2 9491 0.68 19/19 paralysis virus, complete genome 31 170 NM_004219 gi|11038651|ref|NM_004219.2| Homo 1314 728 0 667/669 sapiens pituitary tumor-transforming 1 (PTTG1), mRNA 32 27 BC002479 gi|12803322|gb|BC002479.1|BC002479 613 1479 1E−174 309/309 Homo sapiens, cathepsin H, clone MGC: 1519, mRNA, complete cds 33 28 BC000123 gi|12652744|gb|BC000123.1|BC000123 545 1331 1E−153 275/275 Homo sapiens, pyridoxal (pyridoxine, vitamin B6) kinase, clone MGC: 3128, mRNA, complete cds 34 29 AK000836 gi|7021154|dbj|AK000836.1|AK000836 406 1703 1E−112 205/205 Homo sapiens cDNA FLJ20829 fis, clone ADKA03163, highly similar to D26488 Human mRNA for KIAA0007 gene 35 30 BC001425 gi|12655140|gb|BC001425.1|BC001425 504 2499 1E−141 256/257 Homo sapiens, Similar to differential display and activated by p53, clone MGC: 1780, mRNA, complete cds 36 31 BC005301 gi|13529028|gb|BC005301.1|BC005301 442 998 1E−122 225/226 Homo sapiens, integrin beta 3 binding protein (beta3-endonexin), clone MGC: 12370, mRNA, complete cds 37 32 Z27409 gi|482916|emb|Z27409.1|HSRTKEPH 529 2398 1E−149 276/278 H. sapiens mRNA for receptor tyrosine kinase eph (partial) 38 33 XM_003107 gi|12729732|ref|XM_003107.2| Homo 436 1985 1E−120 227/228 sapiens transketolase (Wernicke- Korsakoff syndrome) (TKT), mRNA 39 34 AB002297 gi|2224538|dbj|AB002297.1|AB002297 387 8063 1E−106 208/211 Human mRNA for KIAA0299 gene, partial cds 40 35 XM_002591 gi|12728749|ref|XM_002591.2| Homo 502 4732 1E−140 253/253 sapiens KIAA0173 gene product (KIAA0173), mRNA 41 36 XM_009101 gi|11425196|ref|XM_009101.1| Homo 523 3374 1E−147 271/272 sapiens fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included) (FUT1), mRNA 42 37 AF082858 gi|4587463|gb|AF082858.1|AF082858 494 829 1E−138 249/249 Homo sapiens pterin carbinolamine dehydratase (PCD) mRNA, complete cds 43 38 BC001600 gi|12804396|gb|BC001600.1|BC001600 533 1316 1E−150 269/269 Homo sapiens, D123 gene product, clone MGC: 1935, mRNA, complete cds 44 39 BC000871 gi|12654114|gb|BC000871.1|BC000871 609 1489 1E−172 307/307 Homo sapiens, annexin A3, clone MGC: 5043, mRNA, complete cds 45 41 AL136600 gi|13276700|emb|AL136600.1|HSM801574 504 1552 1E−141 254/254 Homo sapiens mRNA; cDNA DKFZp564I1216 (from clone DKFZp564I1216); complete cds 46 42 AK024772 gi|10437149|dbj|AK024772.1|AK024772 484 864 1E−135 246/247 Homo sapiens cDNA: FLJ21119 fis, clone CAS05644, highly similar to HSA272196 Homo sapiens mRNA for hypothetical protein 47 43 BC004246 gi|13279007|gb|BC004246.1|BC004246 438 4249 1E−121 221/221 Homo sapiens, mutS (E. coli) homolog 6, clone MGC: 10498, mRNA, complete cds 48 44 X92474 gi|1045056|emb|X92474.1|HSCHTOG 238 6449 2E−61  122/123 H. sapiens mRNA for ch-TOG protein 49 45 BC002994 gi|12804270|gb|BC002994.1|BC002994 476 2238 1E−132 246/248 Homo sapiens, clone MGC: 3823, mRNA, complete cds 50 46 AK025062 gi|10437501|dbj|AK025062.1|AK025062 327 2692 4E−88  174/176 Homo sapiens cDNA: FLJ21409 fis, clone COL03924 51 47 AP001247 gi|10121151|dbj|AP001247.3|AP001247 36.2 16950 2.8 20/21 Homo sapiens genomic DNA, chromosome 2p11.2, clone: lambda316 52 48 AF131838 gi|4406677|gb|AF131838.1|AF131838 498 1462 1E−139 251/251 Homo sapiens clone 25107 mRNA sequence 53 49 XM_007647 gi|11432476|ref|XM_007647.1| Homo 531 2111 1E−149 268/268 sapiens immunoglobulin superfamily containing leucine-rich repeat (ISLR), mRNA 54 50 AB048286 gi|13537296|dbj|AB048286.1|AB048286 476 2713 1E−132 247/248 Homo sapiens GS1999full mRNA, complete cds 56 53 AK001515 gi|7022818|dbj|AK001515.1|AK001515 333 884 6E−90  168/168 Homo sapiens cDNA FLJ10653 fis, clone NT2RP2005890 57 54 AB023156 gi|4589521|dbj|AB023156.1|AB023156 42.1 5537 0.055 24/25 Homo sapiens mRNA for KIAA0939 protein, partial cds 58 55 XM_008622 gi|12740774|ref|XM_008622.2| Homo 507 1427 1E−142 256/256 sapiens thymidine kinase 1, soluble (TK1), mRNA 59 56 XM_003758 gi|11416585|ref|XM_003758.1| Homo 422 2691 1E−116 215/216 sapiens transforming growth factor, beta- induced, 68 kD (TGFBI), mRNA 60 58 XM_001732 gi|11423748|ref|XM_001732.1| Homo 500 2435 1E−140 252/252 sapiens calcyclin binding protein (CACYBP), mRNA 61 59 BC001866 gi|12804840|gb|BC001866.1|BC001866 396 2097 1E−109 239/256 Homo sapiens, replication factor C (activator 1) 5 (36.5 kD), clone MGC: 1155, mRNA, complete cds 62 60 BC000293 gi|12653056|gb|BC000293.1|BC000293 87.7 733 2E−16  58/65 Homo sapiens, non-metastatic cells 1, protein (NM23A) expressed in, clone MGC: 8334, mRNA, complete cds 63 63 XM_008043 gi|12739769|ref|XM_008043.2| Homo 519 1739 1E−146 262/262 sapiens dipeptidase 1 (renal) (DPEP1), mRNA 64 64 AB052751 gi|11967903|dbj|AB052751.1|AB052751 527 1863 1E−148 266/266 Homo sapiens Axin2 mRNA for conductin, partial cds and 3′UTR 65 65 BC005832 gi|13543336|gb|BC005832.1|BC005832 460 1444 1E−128 232/232 Homo sapiens, KIAA0101 gene product, clone MGC: 2250, mRNA, complete cds 66 66 XM_002190 gi|11428365|ref|XM_002190.1| Homo 472 3152 1E−131 238/238 sapiens chromosome 1 open reading frame 2 (C1ORF2), mRNA 67 67 XM_010360 gi|12743462|ref|XM_010360.2| Homo 505 3746 1E−141 255/255 sapiens transcription factor NRF (NRF), mRNA 68 68 AL122064 gi|6102857|emb|AL122064.1|HSM801208 502 1320 1E−140 257/259 Homo sapiens mRNA; cDNA DKFZp434M231 (from clone DKFZp434M231); partial cds 70 71 XM_005226 gi|11425871|ref|XM_005226.1| Homo 507 2619 1E−142 256/256 sapiens antizyme inhibitor (LOC51582), mRNA 71 74 BC002956 gi|12804196|gb|BC002956.1|BC002956 484 1185 1E−135 244/244 Homo sapiens, ClpP (caseinolytic protease, ATP-dependent, proteolytic subunit, E. coli) homolog, clone MGC: 1379, mRNA, complete cds 73 100 NM_014791 gi|7661973|ref|NM_014791.1| Homo 1211 2470 0 691/708 sapiens KIAA0175 gene product (KIAA0175), mRNA 74 105 BC005864 gi|13543414|gb|BC005864.1|BC005864 1108 1430 0 621/635 Homo sapiens, cyclin-dependent kinase 4, clone MGC: 3719, mRNA, complete cds 75 106 XM_005404 gi|11428250|ref|XM_005404.1| Homo 1203 2446 0 631/638 sapiens catenin (cadherin-associated protein), alpha-like 1 (CTNNAL1), mRNA 76 104 BC002362 gi|12803116|gb|BC002362.1|BC002362 1269 1318 0 643/644 Homo sapiens, lactate dehydrogenase B, clone MGC: 8627, mRNA, complete cds 77 75 AF065389 gi|3152702|gb|AF065389.1|AF065389 434 1405 1E−120 236/244 Homo sapiens tetraspan NET-4 mRNA, complete cds 78 76 BC004863 gi|13436073|gb|BC004863.1|BC004863 587 2229 1E−166 303/304 Homo sapiens, Similar to phosphoserine aminotransferase, clone MGC: 10519, mRNA, complete cds 79 77 XM_011917 gi|12735709|ref|XM_011917.1| Homo 509 1414 1E−143 259/260 sapiens adenosine kinase (ADK), mRNA 80 78 BC000897 gi|12654158|gb|BC000897.1|BC000897 143 683 8E−33  102/107 Homo sapiens, interferon induced transmembrane protein 1 (9-27), clone MGC: 5195, mRNA, complete cds 81 79 NM_014641 gi|7661965|ref|NM_014641.1| Homo 335 6940 3E−90  196/206 sapiens KIAA0170 gene product (KIAA0170), mRNA 82 80 XM_012967 gi|12742527|ref|XM_012967.1| Homo 430 1188 1E−119 231/233 sapiens RAE1 (RNA export 1, S. pombe) homolog (RAE1), mRNA 83 81 XM_003913 gi|12719136|ref|XM_003913.2| Homo 571 5348 1E−161 288/288 sapiens integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) (ITGA2), mRNA 84 109 AK024039 gi|10436304|dbj|AK024039.1|AK024039 422 2224 1E−116 377/443 Homo sapiens cDNA FLJ13977 fis, clone Y79AA1001603, weakly similar to POLYPEPTIDE N- ACETYLGALACTOSAMINYLTRANS- FERASE (EC 2.4.1.41) 85 110 XM_009492 gi|11420665|ref|XM_009492.1| Homo 852 2627 0 440/444 sapiens v-myb avian myeloblastosis viral oncogene homolog-like 2 (MYBL2), mRNA 86 111 XM_009587 gi|12742401|ref|XM_009587.2| Homo 749 2108 0 392/394 sapiens TH1 drosophila homolog (HSPC130), mRNA 87 121 NM_001408 gi|13325063|ref|NM_001408.1| Homo 1067 10531 0 627/660 sapiens cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog (CELSR2), mRNA 88 118 AF226998 gi|12655885|gb|AF226998.1|AF226998 775 734 0 391/391 Homo sapiens dpy-30-like protein mRNA, complete cds 89 41 BC001106 gi|12654544|gb|BC001106.1|BC001106 416 1542 1E−114 214/216 Homo sapiens, hypothetical protein, clone MGC: 891, mRNA, complete cds 90 139 XM_009005 gi|11424670|ref|XM_009005.1| Homo 1112 1186 0 617/630 sapiens kallikrein 11 (KLK11), mRNA 91 83 XM_006067 gi|12736004|ref|XM_006067.2| Homo 321 2525 4E−86  189/194 sapiens 7-dehydrocholesterol reductase (DHCR7), mRNA 92 85 AF092569 gi|3986473|gb|AF092569.1|HSEIFP1 87.7 299 2E−16  74/79 Homo sapiens translation initiation factor eIF3 p40 subunit gene, exon 1 93 117 BC004264 gi|13279061|gb|BC004264.1|BC004264 1021 3138 0 564/582 Homo sapiens, Similar to EphB4, clone IMAGE: 3611312, mRNA, partial cds 94 113 BC000277 gi|12802987|gb|BC000277.1|BC000277 1011 2947 0 586/618 Homo sapiens, clone MGC: 1892, mRNA, complete cds 95 87 NM_015339 gi|12229216|ref|NM_015339.1| Homo 599 4713 1E−169 302/302 sapiens activity-dependent neuroprotective protein (ADNP), mRNA 96 88 XM_009845 gi|11526339|ref|XM_009845.1| Homo 505 1291 1E−141 255/255 sapiens catechol-O-methyltransferase (COMT), mRNA 97 89 BC000509 gi|12653474|gb|BC000509.1|BC000509 517 1008 1E−145 261/261 Homo sapiens, proteasome (prosome, macropain) subunit, beta type, 7, clone MGC: 8507, mRNA, complete cds 98 125 AK024618 gi|10436934|dbj|AK024618.1|AK024618 1199 1804 0 662/676 Homo sapiens cDNA: FLJ20965 fis, clone ADSH01104 99 128 D80001 gi|1136417|dbj|D80001.1|D80001 1138 4994 0 639/663 Human mRNA for KIAA0179 gene, partial cds 100 127 BC004899 gi|13436169|gb|BC004899.1|BC004899 930 1688 0 579/619 Homo sapiens, sigma receptor (SR31747 binding protein 1), clone MGC: 3851, mRNA, complete cds 101 129 BC003129 gi|13111916|gb|BC003129.1|BC003129 1043 1882 0 583/602 Homo sapiens, non-POU-domain- containing, octamer-binding, clone MGC: 3380, mRNA, complete cds 102 130 XM_009690 gi|12742251|ref|XM_009690.2| Homo 438 2277 1E−121 367/404 sapiens hypothetical protein FLJ10850 (FLJ10850), mRNA 104 136 XM_005908 gi|11432093|ref|XM_005908.1| Homo 1235 2237 0 642/646 sapiens hypothetical protein FLJ10540 (FLJ10540), mRNA 106 5 NM_001699 gi|11863124|ref|NM_001699.2| Homo 922 4986 0 550/572 sapiens AXL receptor tyrosine kinase (AXL), transcript variant 2, mRNA 107 137 NM_025927 gi|13385417|ref|NM_025927.1| Mus 228 1486 1E−57  223/259 musculus RIKEN cDNA 2600005P05 gene (2600005P05Rik), mRNA 108 138 AK023154 gi|10434948|dbj|AK023154.1|AK023154 924 3040 0 524/541 Homo sapiens cDNA FLJ13092 fis, clone NT2RP3002147 109 141 AB017710 gi|5821114|dbj|AB017710.1|AB017710 1067 2353 0 570/582 Homo sapiens U50HG genes for U50′ snoRNA and U50 snoRNA, complete sequence 110 90 NM_011775 gi|6756080|ref|NM_011775.1| Mus 40.1 2185 0.21 20/20 musculus zona pellucida glycoprotein 2 (Zp2), mRNA 111 145 AF086315 gi|3483660|gb|AF086315.1|HUMZD52F10 841 600 0 467/480 Homo sapiens full length insert cDNA clone ZD52F10 112 91 XM_002596 gi|12728741|ref|XM_002596.2| Homo 361 2877 4E−98  201/209 sapiens protein tyrosine phosphatase, receptor type, N (PTPRN), mRNA 113 92 XM_004484 gi|11418942|ref|XM_004484.1| Homo 482 1325 1E−134 243/243 sapiens tumor protein D52-like 1 (TPD52L1), mRNA 114 93 BC000331 gi|12653128|gb|BC000331.1|BC000331 583 935 1E−165 305/310 Homo sapiens, proteasome (prosome, macropain) subunit, beta type, 4, clone MGC: 8522, mRNA, complete cds 116 100 NM_014791 gi|7661973|ref|NM_014791.1| Homo 1185 2470 0 644/664 sapiens KIAA0175 gene product (KIAA0175), mRNA 118 123 XM_004185 gi|12731991|ref|XM_004185.2| Homo 751 4092 0 463/481 sapiens valyl-tRNA synthetase 2 (VARS2), mRNA 119 94 XM_004750 gi|12733059|ref|XM_004750.2| Homo 484 629 1E−135 244/244 sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 1 (NUDT1), mRNA 120 95 XM_006928 gi|12737727|ref|XM_006928.2| Homo 412 4870 1E−113 239/248 sapiens FOXJ2 forkhead factor (LOC55810), mRNA 121 96 AL133104 gi|6453587|emb|AL133104.1|HSM801384 601 1186 1E−170 303/303 Homo sapiens mRNA; cDNA DKFZp434E1822 (from clone DKFZp434E1822); partial cds 122 98 BC004528 gi|13528647|gb|BC004528.1|BC004528 466 2751 1E−129 244/246 Homo sapiens, clone MGC: 3017, mRNA, complete cds 123 103 AF097514 gi|4808600|gb|AF097514.1|AF097514 1302 5221 0 721/738 Homo sapiens stearoyl-CoA desaturase (SCD) mRNA, complete cds 124 103 AF097514 gi|4808600|gb|AF097514.1|AF097514 1328 5221 0 720/734 Homo sapiens stearoyl-CoA desaturase (SCD) mRNA, complete cds 125 133 AF220656 gi|7107358|gb|AF220656.1|AF220656 936 3227 0 529/539 Homo sapiens apoptosis-associated nuclear protein PHLDA1 (PHLDA1) mRNA, partial cds 126 133 AF220656 gi|7107358|gb|AF220656.1|AF220656 969 3227 0 544/555 Homo sapiens apoptosis-associated nuclear protein PHLDA1 (PHLDA1) mRNA, partial cds 130 115 AF019770 gi|2674084|gb|AF019770.1|AF019770 1277 1202 0 735/751 Homo sapiens macrophage inhibitory cytokine-1 (MIC-1) mRNA, complete cds 131 106 AK022926 gi|10434597|dbj|AK022926.1|AK022926 589 2455 1E−166 299/300 Homo sapiens cDNA FLJ12864 fis, clone NT2RP2003604, highly similar to Homo sapiens alpha-catenin-like protein (CTNNAL1) mRNA 132 113 BC000277 gi|12802987|gb|BC000277.1|BC000277 513 2947 1E−144 262/263 Homo sapiens, clone MGC: 1892, mRNA, complete cds 133 113 XM_006213 gi|12736410|ref|XM_006213.2| Homo 579 6477 1E−163 299/300 sapiens KIAA0712 gene product (KIAA0712), mRNA 134 106 XM_005404 gi|11428250|ref|XM_005404.1| Homo 561 2446 1E−158 300/306 sapiens catenin (cadherin-associated protein), alpha-like 1 (CTNNAL1), mRNA 135 116 BC001068 gi|12654476|gb|BC001068.1|BC001068 595 2333 1E−168 300/300 Homo sapiens, clone IMAGE: 2823731, mRNA, partial cds 136 117 BC004264 gi|13279061|gb|BC004264.1|BC004264 486 3138 1E−135 250/252 Homo sapiens, Similar to EphB4, clone IMAGE: 3611312, mRNA, partial cds 138 123 Y09668 gi|1834428|emb|Y09668.1|DRTKLELF1 36.2 2272 3.5 18/18 D. rerio mRNA for tyrosine kinase ligand (elf-1) 140 140 XM_008802 gi|12741169|ref|XM_008802.2| Homo 710 3185 0 358/358 sapiens retinoblastoma-binding protein 8 (RBBP8), mRNA 141 143 XM_009111 gi|12741675|ref|XM_009111.2| Homo 672 1453 0 362/367 sapiens sulfotransferase family, cytosolic, 2B, member 1 (SULT2B1), mRNA 142 121 NM_001408 gi|13325063|ref|NM_001408.1| Homo 755 10531 0 388/389 sapiens cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog (CELSR2), mRNA 143 121 NM_001408 gi|13325063|ref|NM_001408.1| Homo 741 10531 0 376/377 sapiens cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog (CELSR2), mRNA 144 139 XM_009005 gi|11424670|ref|XM_009005.1| Homo 622 1186 1E−176 340/346 sapiens kallikrein 11 (KLK11), mRNA 145 112 XM_003733 gi|12731080|ref|XM_003733.2| Homo 753 2088 0 380/380 sapiens DEAD-box protein abstrakt (ABS), mRNA 147 166 AF216754 gi|6707650|gb|AF216754.1|AF216754 567 354 1E−160 296/298 Homo sapiens over-expressed breast tumor protein (OBTP) mRNA, complete cds 148 167 XM_003384 gi|12730453|ref|XM_003384.2| Homo 640 748 0 323/323 sapiens hypothetical protein (LOC51316), mRNA 149 169 XM_009527 gi|11420875|ref|XM_009527.1| Homo 751 594 0 382/383 sapiens secretory leukocyte protease inhibitor (antileukoproteinase) (SLPI), mRNA 150 30 AF279897 gi|12751120|gb|AF279897.1|AF279897 654 727 0 333/334 Homo sapiens PNAS-143 mRNA, complete cds 151 170 NM_004219 gi|11038651|ref|NM_004219.2| Homo 730 728 0 368/368 sapiens pituitary tumor-transforming 1 (PTTG1), mRNA 152 171 S76771 gi|914225|gb|S76771.1|S76771 210 6849 1E−52  168/185 TPO = thrombopoietin [human, Genomic, 6849 nt] 153 171 M81890 gi|186274|gb|M81890.1|HUMIL11A 216 6870 2E−54  180/203 Human interleukin 11 (IL11) gene, complete mRNA 154 172 XM_004952 gi|12733392|ref|XM_004952.2| Homo 603 2861 1E−171 310/312 sapiens solute carrier family 26, member 3 (SLC26A3), mRNA 155 147 XM_009488 gi|12742285|ref|XM_009488.2| Homo 716 770 0 361/361 sapiens ubiquitin carrier protein E2-C (UBCH10), mRNA 156 149 XM_011755 gi|12734624|ref|XM_011755.1| Homo 733 2566 0 370/370 sapiens SET translocation (myeloid leukemia-associated) (SET), mRNA 157 150 L19183 gi|307154|gb|L19183.1|HUMMAC30X 593 2002 1E−168 323/331 Human MAC30 mRNA, 3′ end 158 151 AK024303 gi|10436651|dbj|AK024303.1|AK024303 698 1591 0 352/352 Homo sapiens cDNA FLJ14241 fis, clone OVARC1000533 159 173 BC001410 gi|12655116|gb|BC001410.1|BC001410 682 577 0 354/356 Homo sapiens, S100 calcium-binding protein A11 (calgizzarin), clone MGC: 2149, mRNA, complete cds 161 175 BC001308 gi|12654922|gb|BC001308.1|BC001308 646 2263 0 353/362 Homo sapiens, clone HQ0310 PRO0310p1, clone MGC: 5505, mRNA, complete cds 162 176 XM_009004 gi|12742171|ref|XM_009004.2| Homo 458 1448 1E−127 231/231 sapiens kallikrein 10 (KLK10), mRNA 163 177 XM_006705 gi|12737366|ref|XM_006705.2| Homo 630 784 1E−179 324/326 sapiens nascent-polypeptide-associated complex alpha polypeptide (NACA), mRNA 164 178 AF102848 gi|12641918|gb|AF102848.1|AF102848 739 1649 0 379/381 Homo sapiens keratin 23 (KRT23) mRNA, complete cds 165 179 XM_003512 gi|12730699|ref|XM_003512.2| Homo 718 1231 0 371/374 sapiens amphiregulin (schwannoma- derived growth factor) (AREG), mRNA 166 180 XM_005313 gi|12734542|ref|XM_005313.2| Homo 652 1275 0 335/337 sapiens gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) (GGH), mRNA 168 182 XM_010117 gi|11419764|ref|XM_010117.1| Homo 690 2519 0 360/364 sapiens plastin 3 (T isoform) (PLS3), mRNA 169 183 L47277 gi|986911|gb|L47277.1|HUMTOPATRA 646 994 0 353/362 Homo sapiens (cell line HepG2, HeLa) alpha topoisomerase truncated-form mRNA, 3′UTR 170 184 XM_012941 gi|12742342|ref|XM_012941.1| Homo 670 3071 0 341/342 sapiens chromosome 20 open reading frame 1 (C20ORF1), mRNA 171 185 NM_000581 gi|10834975|ref|NM_000581.1| Homo 640 1134 0 339/343 sapiens glutathione peroxidase 1 (GPX1), mRNA 172 185 NM_000581 gi|10834975|ref|NM_000581.1| Homo 640 1134 0 338/343 sapiens glutathione peroxidase 1 (GPX1), mRNA 173 186 X06705 gi|35511|emb|X06705.1|HSPLAX 700 883 0 353/353 Human PLA-X mRNA 174 187 D45915 gi|1483130|dbj|D45915.1|D45915 666 2584 0 336/336 Human mRNA for p80 protein, complete cds 176 189 BC000242 gi|12652962|gb|BC000242.1|BC000242 521 849 1E−146 280/286 Homo sapiens, CGI-138 protein, clone MGC: 676, mRNA, complete cds 177 190 BC005945 gi|13543585|gb|BC005945.1|BC005945 567 1391 1E−160 295/298 Homo sapiens, MAD2 (mitotic arrest deficient, yeast, homolog)-like 1, clone MGC: 14577, mRNA, complete cds 179 192 XM_010835 gi|12728550|ref|XM_010835.1| Homo 452 1679 1E−125 313/340 sapiens similar to hypothetical protein (H. sapiens) (LOC65349), mRNA 180 193 XM_009475 gi|11420562|ref|XM_009475.1| Homo 668 2110 0 340/341 sapiens S-adenosylhomocysteine hydrolase (AHCY), mRNA 181 194 AF054183 gi|4092053|gb|AF054183.1|AF054183 690 1148 0 351/352 Homo sapiens GTP binding protein mRNA, complete cds 182 195 BC005356 gi|13529175|gb|BC005356.1|BC005356 396 1050 1E−108 200/200 Homo sapiens, Similar to hypothetical protein MGC3077, clone MGC: 12457, mRNA, complete cds 183 196 XM_006545 gi|12736918|ref|XM_006545.2| Homo 613 588 1E−173 309/309 sapiens hypothetical protein (HSPC152), mRNA 184 197 XM_003598 gi|12730828|ref|XM_003598.2| Homo 662 440 0 345/349 sapiens S100 calcium-binding protein P (S100P), mRNA 185 197 NM_005980 gi|5174662|ref|NM_005980.1| Homo 565 439 1E−159 291/293 sapiens S100 calcium-binding protein P (S100P), mRNA 190 199 M80340 gi|339767|gb|M80340.1|HUMTNL12 539 6075 1E−151 351/377 Human transposon L1.1 with a base deletion relative to L1.2B resulting in a premature stop codon in the coding region 191 199 U93574 gi|2072975|gb|U93574.1|HSU93574 404 5979 1E−111 290/318 Human L1 element L1.39 p40 and putative p150 genes, complete cds 192 200 AC002143 gi|2168303|gb|AC002143.1|AC002143 214 4025 8E−54  235/275 Homo sapiens (subclone 4_b10 from BAC H102) DNA sequence, complete sequence 193 176 BC002710 gi|12803744|gb|BC002710.1|BC002710 648 1542 0 327/327 Homo sapiens, kallikrein 10, clone MGC: 3667, mRNA, complete cds 194 201 XM_004286 gi|11418526|ref|XM_004286.1| Homo 561 700 1E−158 289/291 sapiens ribosomal protein L10a (RPL10A), mRNA 196 118 AF226998 gi|12655885|gb|AF226998.1|AF226998 505 734 1E−141 255/255 Homo sapiens dpy-30-like protein mRNA, complete cds 198 204 AL3900221 gi|10862787|emb|AL390022.11|AL390022 470 9277 1E−130 337/369 Human DNA sequence from clone RP11-370B6 on chromosome X, complete sequence [Homo sapiens] 200 206 BC002476 gi|12803316|gb|BC002476.1|BC002476 615 695 1E−174 316/318 Homo sapiens, non-metastatic cells 2, protein (NM23B) expressed in, clone MGC: 2212, mRNA, complete cds 201 207 XM_005235 gi|12734360|ref|XM_005235.2| Homo 605 1507 1E−171 311/313 sapiens eukaryotic translation initiation factor 3, subunit 6 (48 kD) (EIF3S6), mRNA 202 152 BC004427 gi|13325215|gb|BC004427.1|BC004427 611 967 1E−173 321/324 Homo sapiens, proteasome (prosome, macropain) subunit, alpha type, 7, clone MGC: 3755, mRNA, complete cds 204 151 AK024303 gi|10436651|dbj|AK024303.1|AK024303 585 1591 1E−165 295/295 Homo sapiens cDNA FLJ14241 fis, clone OVARC1000533 205 151 AK024303 gi|10436651|dbj|AK024303.1|AK024303 591 1591 1E−167 298/298 Homo sapiens cDNA FLJ14241 fis, clone OVARC1000533 206 153 XM_003927 gi|11417090|ref|XM_003927.1| Homo 656 473 0 337/339 sapiens Apg12 (autophagy 12, S. cerevisiae)-like (APG12L), mRNA 207 154 BC000947 gi|13111828|gb|BC000947.2|BC000947 644 1608 0 336/340 Homo sapiens, clone IMAGE: 3450586, mRNA, partial cds 208 155 XM_004478 gi|12732587|ref|XM_004478.2| Homo 660 1993 0 339/341 sapiens glyoxalase I (GLO1), mRNA 209 156 L36587 gi|598241|gb|L36587.1|HUMUHGA 664 1357 0 335/335 Homo sapiens spliced UHG RNA 210 157 BC000447 gi|12653354|gb|BC000447.1|BC000447 656 585 0 334/335 Homo sapiens, macrophage migration inhibitory factor (glycosylation- inhibiting factor), clone MGC: 8444, mRNA, complete cds 211 158 BC001708 gi|12804576|gb|BC001708.1|BC001708 626 906 1E−178 319/320 Homo sapiens, ribosomal protein S3A, clone MGC: 1626, mRNA, complete cds 212 159 BC005008 gi|13477106|gb|BC005008.1|BC005008 668 2249 0 337/337 Homo sapiens, carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen), clone MGC: 10467, mRNA, complete cds 213 160 AL110141 gi|5817036|emb|AL110141.1|HSM800785 519 656 1E−145 265/266 Homo sapiens mRNA; cDNA DKFZp564D0164 (from clone DKFZp564D0164) 214 161 NM_014366 gi|7657047|ref|NM_014366.1| Homo 634 2059 1E−180 335/343 sapiens putative nucleotide binding protein, estradiol-induced (E2IG3), mRNA 215 162 AL359585 gi|8655645|emb|AL359585.1|HSM802687 129 2183 4E−28  68/69 Homo sapiens mRNA; cDNA DKFZp762B195 (from clone DKFZp762B195) 217 195 NM_024051 gi|13129017|ref|NM_024051.1| Homo 646 1195 0 329/330 sapiens hypothetical protein MGC3077 (MGC3077), mRNA 218 164 XM_006551 gi|11441541|ref|XM_006551.1| Homo 601 905 1E−170 321/327 sapiens interferon induced transmembrane protein 2 (1-8D) (IFITM2), mRNA 220 65 XM_007736 gi|11433251|ref|XM_007736.1| Homo 648 836 0 330/331 sapiens KIAA0101 gene product (KIAA0101), mRNA 222 124 U07571 gi|497170|gb|U07571.1|HSU07571 46.1 392 0.005 23/23 Human clone S1X13-SS13A dinucleotide repeat at Xq21 223 126 AF288394 gi|12620197|gb|AF288394.1|AF288394 718 1961 0 377/382 Homo sapiens C1orf19 mRNA, partial cds 224 132 U35622 gi|5733846|gb|U35622.2|HSU35622 779 2107 0 398/400 Homo sapiens EWS protein/E1A enhancer binding protein chimera mRNA, complete cds 225 291 BC004928 gi|13436256|gb|BC004928.1|BC004928 793 2567 0 400/400 Homo sapiens, clone MGC: 10493, mRNA, complete cds 226 142 AL137736 gi|6808315|emb|AL137736.1|HSM802318 692 2053 0 363/365 Homo sapiens mRNA; cDNA DKFZp586P2321 (from clone DKFZp586P2321) 227 144 XM_008130 gi|11424226|ref|XM_008130.1| Homo 785 1361 0 396/396 sapiens galactokinase 1 (GALK1), mRNA 228 115 AF019770 gi|2674084|gb|AF019770.1|AF019770 1370 1202 0 721/729 Homo sapiens macrophage inhibitory cytokine-1 (MIC-1) mRNA, complete cds 230 255 AF179710 gi|9836821|gb|AF179710.1|AF179710 40.1 1096 0.35 20/20 Pongo pygmaeus RH50 glycoprotein (RHAG) gene, intron 9 231 262 XM_009943 gi|11418022|ref|XM_009943.1| Homo 864 5486 0 455/462 sapiens tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory) (TIMP3), mRNA 232 256 AF134904 gi|4809150|gb|AF134904.1|AF134904 42.1 2558 0.097 21/21 Schistocerca gregaria semaphorin 2a mRNA, complete cds 233 263 BC003002 gi|12804286|gb|BC003002.1|BC003002 523 2165 1E−147 284/294 Homo sapiens, polo (Drosophia)-like kinase, clone MGC: 3988, mRNA, complete cds 234 265 M68513 gi|199119|gb|M68513.1|MUSMEK4 882 3197 0 491/503 Mouse eph-related receptor tyrosine kinase (Mek4) mRNA, complete cds 235 264 XM_007931 gi|12739533|ref|XM_007931.2| Homo 730 1593 0 407/414 sapiens solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2 (SLC9A3R2), mRNA 236 266 XM_003748 gi|12731108|ref|XM_003748.2| Homo 387 2967 1E−106 267/302 sapiens serum-inducible kinase (SNK), mRNA 239 269 BC001401 gi|12655098|gb|BC001401.1|BC001401 773 1571 0 396/398 Homo sapiens, Similar to sterile-alpha motif and leucine zipper containing kinase AZK, clone MGC: 808, mRNA, complete cds 240 270 S76617 gi|914203|gb|S76617.1|S76617 38.2 2608 0.87 19/19 blk = protein tyrosine kinase [human, B lymphocytes, mRNA, 2608 nt] 242 273 AK006144 gi|12839086|dbj|AK006144.1|AK006144 323 1387 1E−86  233/255 Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone: 1700020B19, full insert sequence 243 276 X91656 gi|2125862|emb|X91656.1|MMSRP20 494 13121 1E−138 262/265 M. musculus Srp20 gene 247 236 BC002499 gi|12803360|gb|BC002499.1|BC002499 640 2129 0 330/331 Homo sapiens, serine/threonine kinase 15, clone MGC: 1605, mRNA, complete cds 248 277 NM_003618 gi|4506376|ref|NM_003618.1| Homo 702 4380 0 361/362 sapiens mitogen-activated protein kinase kinase kinase kinase 3 (MAP4K3), mRNA 249 278 NM_018492 gi|8923876|ref|NM_018492.1| Homo 779 1548 0 400/401 sapiens PDZ-binding kinase; T-cell originated protein kinase (TOPK), mRNA 250 278 XM_005110 gi|12734111|ref|XM_005110.2| Homo 1003 1537 0 506/506 sapiens PDZ-binding kinase; T-cell originated protein kinase (TOPK), mRNA 252 274 BC002466 gi|12803300|gb|BC002466.1|BC002466 1074 2451 0 575/581 Homo sapiens, v-raf murine sarcoma 3611 viral oncogene homolog 1, clone MGC: 2356, mRNA, complete cds 253 280 XM_001729 gi|11423735|ref|XM_001729.1| Homo 751 1658 0 385/387 sapiens v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) (AKT3), mRNA 254 259 NM_002893 gi|13259504|ref|NM_002893.2| Homo 1164 1946 0 715/746 sapiens retinoblastoma-binding protein 7 (RBBP7), mRNA 255 210 AB056798 gi|13365896|dbj|AB056798.1|AB056798 678 4521 0 435/461 Macaca fascicularis brain cDNA clone: QflA-11110, full insert sequence 256 213 AJ302649 gi|11140019|emb|AJ302649.1|DRE302649 42.1 2188 0.058 21/21 Danio rerio mRNA for GABAA receptor betaZ2 subunit (gabaabeta2 gene) 257 212 L27711 gi|808006|gb|L27711.1|HUMKAP1A 1057 844 0 550/553 Human protein phosphatase (KAP1) mRNA, complete cds 258 214 NM_004336 gi|4757877|ref|NM_004336.1| Homo 1318 3446 0 694/701 sapiens budding uninhibited by benzimidazoles 1 (yeast homolog) (BUB1), mRNA 260 216 NM_004300 gi|4757713|ref|NM_004300.1| Homo 985 2222 0 621/656 sapiens acid phosphatase 1, soluble (ACP1), transcript variant a, mRNA 262 219 AK026166 gi|10438929|dbj|AK026166.1|AK026166 1402 1813 0 838/871 Homo sapiens cDNA: FLJ22513 fis, clone HRC12111, highly similar to HUMKUP Human Ku (p70/p80) subunit mRNA 263 252 BC004937 gi|13436283|gb|BC004937.1|BC004937 898 1032 0 475/480 Homo sapiens, clone MGC: 10779, mRNA, complete cds 264 220 XM_006375 gi|12736706|ref|XM_006375.2| Homo 1316 737 0 693/703 sapiens glutathione S-transferase pi (GSTP1), mRNA 265 218 BC001827 gi|12804774|gb|BC001827.1|BC001827 1259 1073 0 672/683 Homo sapiens, Similar to deoxythymidylate kinase (thymidylate kinase), clone MGC: 3923, mRNA, complete cds 266 221 BC002900 gi|12804094|gb|BC002900.1|BC002900 1217 867 0 699/728 Homo sapiens, Similar to proteasome (prosome, macropain) subunit, alpha type, 2, clone IMAGE: 3942625, mRNA, partial cds 267 226 AF064029 gi|4091894|gb|AF064029.1|AF064029 60 779 0.0000002 30/30 Helianthus tuberosus lectin 1 mRNA, complete cds 268 212 L27711 gi|808006|gb|L27711.1|HUMKAP1A 1257 844 0 694/705 Human protein phosphatase (KAP1) mRNA, complete cds 269 223 XM_011470 gi|12732420|ref|XM_011470.1| Homo 1029 2591 0 519/519 sapiens myristoylated alanine-rich protein kinase C substrate (MARCKS, 80K-L) (MACS), mRNA 270 221 BC002900 gi|12804094|gb|BC002900.1|BC002900 1330 867 0 724/739 Homo sapiens, Similar to proteasome (prosome, macropain) subunit, alpha type, 2, clone IMAGE: 3942625, mRNA, partial cds 271 206 BC002476 gi|12803316|gb|BC002476.1|BC002476 1203 695 0 610/611 Homo sapiens, non-metastatic cells 2, protein (NM23B) expressed in, clone MGC: 2212, mRNA, complete cds 272 225 XM_007980 gi|12739602|ref|XM_007980.2| Homo 904 1866 0 481/487 sapiens membrane-associated tyrosine- and threonine-specific cdc2-inhibitory kinase (PKMYT1), mRNA 273 231 S50810 gi|262070|gb|S50810.1|S50810 {satellite 52 1086 0.00003 29/30 DNA} [Drosophila melanogaster, Doc mobile element, Transposon, 1086 nt] 274 233 AF217396 gi|8132773|gb|AF217396.1|AF217396 46.1 2007 0.004 23/23 Drosophila melanogaster clone 2G2 unknown mRNA 275 232 L29057 gi|609636|gb|L29057.1|XELCADH 40.1 4097 0.081 20/20 Xenopus laevis (clone: XTCAD-1) cadherin gene, complete cds 276 227 XM_008475 gi|11426657|ref|XM_008475.1| Homo 40.1 6962 0.32 20/20 sapiens KIAA0100 gene product (KIAA0100), mRNA 277 229 M34230 gi|204651|gb|M34230.1|RATHPA1 Rat 56 3282 0.000002 28/28 haptoglobin (Hp) gene, exons 1, 2 and 3 278 230 AJ302649 gi|11140019|emb|AJ302649.1|DRE302649 50.1 2188 0.0002 25/25 Danio rerio mRNA for GABAA receptor betaZ2 subunit (gabaabeta2 gene) 279 239 NM_021158 gi|11056039|ref|NM_021158.1| Homo 710 2257 0 358/358 sapiens protein kinase domains containing protein similar to phosphoprotein C8FW (LOC57761), mRNA 280 238 AX030958 gi|10278361|emb|AX030958.1|AX030958 56 3828 0.000005 28/28 Sequence 7 from Patent WO9800549 281 228 XM_010102 gi|11419709|ref|XM_010102.1| Homo 1469 1767 0 839/865 sapiens phosphoglycerate kinase 1 (PGK1), mRNA 282 235 U00238 gi|404860|gb|U00238.1|U00238 Homo 1132 3600 0 653/677 sapiens glutamine PRPP amidotransferase (GPAT) mRNA, complete cds 283 237 NM_002753 gi|4506080|ref|NM_002753.1| Homo 733 2372 0 381/385 sapiens mitogen-activated protein kinase 10 (MAPK10), mRNA 284 241 XM_006151 gi|12736568|ref|XM_006151.2| Homo 979 1640 0 494/494 sapiens similar to serine protease, umbilical endothelium (H. sapiens) (LOC63320), mRNA 285 242 BC004215 gi|13278917|gb|BC004215.1|BC004215 1106 3373 0 578/585 Homo sapiens, eukaryotic translation elongation factor 1 gamma, clone MGC: 4501, mRNA, complete cds 286 243 NM_000455 gi|4507270|ref|NM_000455.1| Homo 1243 2158 0 651/660 sapiens serine/threonine kinase 11 (Peutz-Jeghers syndrome) (STK11), mRNA 287 258 XM_004842 gi|12733228|ref|XM_004842.2| Homo 682 3715 0 381/387 sapiens SFRS protein kinase 2 (SRPK2), mRNA 288 261 NM_020197 gi|9910273|ref|NM_020197.1| Homo 561 1694 1E−158 346/355 sapiens HSKM-B protein (HSKM-B), mRNA 289 260 XM_001416 gi|12719345|ref|XM_001416.2| Homo 517 2966 1E−145 277/284 sapiens similar to ribosomal protein S6 kinase, 90 kD, polypeptide 1 (H. sapiens) (LOC65290), mRNA 290 236 BC002499 gi|12803360|gb|BC002499.1|BC002499 618 2129 1E−175 358/366 Homo sapiens, serine/threonine kinase 15, clone MGC: 1605, mRNA, complete cds 293 246 XM_004679 gi|11419466|ref|XM_004679.1| Homo 383 987 1E−104 214/224 sapiens cyclin-dependent kinase 5 (CDK5), mRNA 294 245 XM_005258 gi|11426310|ref|XM_005258.1| Homo 902 2391 0 463/466 sapiens serum/glucocorticoid regulated kinase-like (SGKL), mRNA 295 248 XM_008654 gi|12740227|ref|XM_008654.2| Homo 662 3576 0 369/374 sapiens mitogen-activated protein kinase kinase 4 (MAP2K4), mRNA 296 129 BC002364 gi|12803120|gb|BC002364.1|BC002364 688 2645 0 347/347 Homo sapiens, non-POU-domain- containing, octamer-binding, clone MGC: 8677, mRNA, complete cds 298 2 NM_004443 gi|4758287|ref|NM_004443.1| Homo 533 3805 1E−150 297/301 sapiens EphB3 (EPHB3) mRNA 299 254 XM_002383 gi|11429253|ref|XM_002383.1| Homo 571 2832 1E−161 333/340 sapiens activin A receptor, type I (ACVR1), mRNA 300 249 BC000633 gi|12653696|gb|BC000633.1|BC000633 537 2993 1E−151 396/419 Homo sapiens, TTK protein kinase, clone MGC: 865, mRNA, complete cds 301 2 NM_004443 gi|4758287|ref|NM_004443.1| Homo 795 3805 0 453/467 sapiens EphB3 (EPHB3) mRNA 302 224 XM_005116 gi|12734122|ref|XM_005116.2| Homo 470 3396 1E−131 252/259 sapiens protein tyrosine kinase 2 beta (PTK2B), mRNA 303 222 AB056389 gi|13358639|dbj|AB056389.1|AB056389 196 2038 9E−49  129/141 Macaca fascicularis brain cDNA, clone: QflA-12365 304 208 BC002921 gi|12804134|gb|BC002921.1|BC002921 446 2349 1E−123 260/274 Homo sapiens, Similar to protein kinase related to S. cerevisiae STE20, effector for Cdc42Hs, clone MGC: 10333, mRNA, complete cds 305 250 XM_004079 gi|11417431|ref|XM_004079.1| Homo 525 1719 1E−147 275/280 sapiens serine/threonine-protein kinase PRP4 homolog (PRP4), mRNA 306 251 XM_004306 gi|11418576|ref|XM_004306.1| Homo 317 7375 4E−85  160/160 sapiens v-ros avian UR2 sarcoma virus oncogene homolog 1 (ROS1), mRNA 307 252 BC004937 gi|13436283|gb|BC004937.1|BC004937 975 1032 0 567/582 Homo sapiens, clone MGC: 10779, mRNA, complete cds 308 253 NM_006293 gi|5454141|ref|NM_006293.1| Homo 823 4364 0 457/466 sapiens TYRO3 protein tyrosine kinase (TYRO3), mRNA 309 257 X71765 gi|402221|emb|X71765.1|PFCAATPAS 38.2 5477 1.4 19/19 P. falciparum gene for Ca2+ - ATPase

Example 2 Detection of Differential Expression Using Arrays

mRNA isolated from samples of cancerous and normal colon tissue obtained from patients were analyzed to identify genes differentially expressed in cancerous and normal cells. Normal and cancerous cells collected from cryopreserved patient tissues were isolated using laser capture microdissection (LCM) techniques, which techniques are well known in the art (see, e.g., Ohyama et al. (2000) Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol. 53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone et al. (1998) Trends Genet. 14:272-6; Conia et al. (1997) J. Clin. Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science 274:998-1001).

Tables 4A and 4B provide information about each patient from which the samples were isolated, including: the “Patient ID” and “Path ReportID”, which are numbers assigned to the patient and the pathology reports for identification purposes; the “Group” to which the patients have been assigned; the anatomical location of the tumor (“Anatom Loc”); the “Primary Tumor Size”; the “Primary Tumor Grade”; the identification of the histopathological grade (“Histopath Grade”); a description of local sites to which the tumor had invaded (“Local Invasion”); the presence of lymph node metastases (“Lymph Node Met”); the incidence of lymph node metastases (provided as a number of lymph nodes positive for metastasis over the number of lymph nodes examined) (“Incidence Lymphnode Met”); the “Regional Lymphnode Grade”; the identification or detection of metastases to sites distant to the tumor and their location (“Distant Met & Loc”); a description of the distant metastases (“Descrip Distant Met”); the grade of distant metastasis (“Dist Met Grade”); and general comments about the patient or the tumor (“Comments”). Adenoma was not described in any of the patients; adenoma dysplasia (described as hyperplasia by the pathologist) was described in Patient ID No. 695. Extranodal extensions were described in two patients, Patient ID Nos. 784 and 791. Lymphovascular invasion was described in seven patients, Patient ID Nos. 128, 278, 517, 534, 784, 786, and 791. Crohn's-like infiltrates were described in seven patients, Patient ID Nos. 52, 264, 268, 392, 393, 784, and 791.

TABLE 4A Path Primary Primary Patient Report Tumor Tumor Histopath ID ID Group Anatom Loc Size Grade Grade Local Invasion 15 21 III Ascending 4 T3 G2 extending into colon subserosal adipose tissue 52 71 II Ascending 9 T3 G3 Invasion through colon muscularis propria, subserosal involvement; ileocec. valve involvement 121 140 II Sigmoid 6 T4 G2 Invasion of muscularis propria into serosa, involving submucosa of urinary bladder 125 144 II Cecum 6 T3 G2 Invasion through the muscularis propria into suserosal adipose tissue. Ileocecal junction. 128 147 III Transverse 5 T3 G2 Invasion of colon muscularis propria into percolonic fat 130 149 Splenic 5.5 T3 through wall and into flexure surrounding adipose tissue 133 152 II Rectum 5 T3 G2 Invasion through muscularis propria into non- peritonealized pericolic tissue; gross configuration is annular. 141 160 IV Cecum 5.5 T3 G2 Invasion of muscularis propria into pericolonic adipose tissue, but not through serosa. Arising from tubular adenoma. 156 175 III Hepatic 3.8 T3 G2 Invasion through flexure mucsularis propria into subserosa/pericolic adipose, no serosal involvement. Gross configuration annular. 228 247 III Rectum 5.8 T3 G2 to G3 Invasion through muscularis propria to involve subserosal, perirectoal adipose, and serosa 264 283 II Ascending 5.5 T3 G2 Invasion through colon muscularis propria into subserosal adipose tissue. 266 285 III Transverse 9 T3 G2 Invades through colon muscularis propria to involve pericolonic adipose, extends to serosa. 268 287 I Cecum 6.5 T2 G2 Invades full thickness of muscularis propria, but mesenteric adipose free of malignancy 278 297 III Rectum 4 T3 G2 Invasion into perirectal adipose tissue. 295 314 II Ascending 5 T3 G2 Invasion through colon muscularis propria into percolic adipose tissue. 339 358 II Rectosigmoid 6 T3 G2 Extends into perirectal fat but does not reach serosa 341 360 II Ascending 2 cm T3 G2 Invasion through colon invasive muscularis propria to involve pericolonic fat. Arising from villous adenoma. 356 375 II Sigmoid 6.5 T3 G2 Through colon wall into subserosal adipose tissue. No serosal spread seen. 360 412 III Ascending 4.3 T3 G2 Invasion thru colon muscularis propria to pericolonic fat 392 444 IV Ascending 2 T3 G2 Invasion through colon muscularis propria into subserosal adipose tissue, not serosa. 393 445 II Cecum 6 T3 G2 Cecum, invades through muscularis propria to involve subserosal adipose tissue but not serosa. 413 465 IV Ascending 4.8 T3 G2 Invasive through colon muscularis to involve periserosal fat; abutting ileocecal junction. 505 383 IV 7.5 cm T3 G2 Invasion through max dim muscularis propria involving pericolic adipose, serosal surface uninvolved 517 395 IV Sigmoid 3 T3 G2 penetrates muscularis propria, involves pericolonic fat. 534 553 II Ascending 12 T3 G3 Invasion through the colon muscularis propria involving pericolic fat. Serosa free of tumor. 546 565 IV Ascending 5.5 T3 G2 Invasion through colon muscularis propria extensively through submucosal and extending to serosa. 577 596 II Cecum 11.5 T3 G2 Invasion through the bowel wall, into suberosal adipose. Serosal surface free of tumor. 695 714 II Cecum 14 T3 G2 extending through bowel wall into serosal fat 784 803 IV Ascending 3.5 T3 G3 through muscularis colon propria into pericolic soft tissues 786 805 IV Descending 9.5 T3 G2 through muscularis colon propria into pericolic fat, but not at serosal surface 791 810 IV Ascending 5.8 T3 G3 through the colon muscularis propria into pericolic fat 888 908 IV Ascending 2 T2 G1 into muscularis colon propria 889 909 IV Cecum 4.8 T3 G2 through muscularis propria int subserosal tissue

TABLE 4B Incidence Regional Descrip Dist Patient Lymphnode Lymphnode Lympnode Distant Met Distant Met ID Met Met Grade & Loc Met Grade Comment 15 positive 8-Mar N1 negative MX invasive adenocarcinoma, moderately differentiated; focal perineural invasion is seen 52 negative 0/12 N0 negative M0 Hyperplastic polyp in appendix. 121 negative 0/34 N0 negative M0 Perineural invasion; donut anastomosis negative. One tubulovillous and one tubular adenoma with no high grade dysplasia. 125 negative 0/19 N0 negative M0 patient history of metastatic melanoma 128 positive 5-Jan N1 negative M0 130 positive 24-Oct N2 negative M1 133 negative 0/9 N0 negative M0 Small separate tubular adenoma (0.4 cm) 141 positive 21-Jul N2 positive adenocarcinoma M1 Perineural invasion (Liver) consistant identified adjacent to with metastatic primary adenocarcinoma. 156 positive 13-Feb N1 negative M0 Separate tubolovillous and tubular adenomas 228 positive 8-Jan N1 negative MX Hyperplastic polyps 264 negative 0/10 N0 negative M0 Tubulovillous adenoma with high grade dysplasia 266 negative 0/15 N1 positive 0.4 cm, MX (Mesenteric may deposit) represent lymphnode completely replaced by tumor 268 negative 0/12 N0 negative M0 278 positive 10-Jul N2 negative M0 Descending colon polyps, no HGD or carcinoma identified. 295 negative 0/12 N0 negative M0 Melanosis coli and diverticular disease. 339 negative 0/6 N0 negative M0 1 hyperplastic polyp identified 341 negative 0/4 N0 negative MX 356 negative 0/4 N0 negative M0 360 positive 5-Jan N1 negative M0 Two mucosal polyps 392 positive 6-Jan N1 positive Macrovesicular M1 Tumor arising at (Liver) and prior ileocolic microvesicular surgical anastomosis. steatosis 393 negative 0/21 N0 negative M0 413 negative 0/7 N0 positive adenocarcinoma M1 rediagnosis of (Liver) in oophorectomy path to multiple metastatic colon slides cancer. 505 positive 17-Feb N1 positive moderately M1 Anatomical location (Liver) differentiated of primary not adenocarcinoma, notated in report. consistant Evidence of chronic with colitis. primary 517 positive 6-Jun N2 negative M0 No mention of distant met in report 534 negative 0/8 N0 negative M0 Omentum with fibrosis and fat necrosis. Small bowel with acute and chronic serositis, focal abscess and adhesions. 546 positive 12-Jun N2 positive metastatic M1 (Liver) adenocarcinoma 577 negative 0/58 N0 negative M0 Appendix dilated and fibrotic, but not involved by tumor 695 negative 0/22 N0 negative MX tubular adenoma and hyperplstic polyps present, moderately differentiated adenoma with mucinous diferentiation (% not stated) 784 positive 17-May N2 positive M1 invasive poorly (Liver) differentiated adenosquamous carcinoma 786 negative 0/12 N0 positive M1 moderately (Liver) differentiated invasive adenocarcinoma 791 positive 13/25 N2 positive M1 poorly differentiated (Liver) invasive colonic adenocarcinoma 888 positive 21-Mar N0 positive M1 well- to moderately- (Liver) differentiated adenocarcinoma; this patient has tumors of the ascending colon and the sigmoid colon 889 positive 4-Jan N1 positive M1 moderately (Liver) differentiated adenocarcinoma

Identification of Differentially Expressed Genes

cDNA probes were prepared from total RNA isolated from the patient cells described above. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.

Total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling.

Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red), and vice versa.

Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots, for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array.

Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues. PCR products of from about 0.5 kb to 2.0 kb amplified from these sources were spotted onto the array using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides. The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1. For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about four duplicate measurements for each clone, two of one color and two of the other, for each sample.

Table 5 describes the physical location of the differentially expressed polynucleotides on the arrays. Table 5 includes: 1) a Spot ID, which is a unique identifier for each spot containing target sequence of interest on all arrays used; 2) a “Chip Num” which refers to a particular array representing a specific set of genes; 3) the “Sample Name or Clone Name” from which the sequence was obtained; and 4) the coordinates of the sequence on the particular array (“Coordinates”). Table 6 provides information about the sequences on the arrays, specifically: 1) Candidate Identification Number; 2) Sample name or clone name; 3) function of the gene corresponding to the sequence (as determined by homology to genes of known function by BLAST search of GenBank); 4) the class of the gene (as determined by homology to genes of known function by BLAST search of GenBank); 5) the pathway in which the gene is implicated; 6) gene assignment; which refers to the gene to which the sequence has the greatest homology or identity; 7) the “Gene Symbol”; 8) chromosome number on which the gene is located (“Chrom Num”); 9) the map position on the chromosome.

TABLE 5 Chip SpotID Num Sample Name or Clone Name Coords 27 1 M00023371A:G03 1:85  195 1 M00001489B:G04 1:227 212 1 M00026888A:A03 1:244 335 1 M00001558C:B06 1:367 511 1 M00003852B:C01 2:191 538 1 M00022009A:A12 2:218 599 1 M00001374A:A06 2:279 943 1 M00001341B:A11 3:271 1048 1 M00007965C:G08 3:376 1160 1 M00022140A:E11 4:136 1176 1 M00022180D:E11 4:152 1195 1 M00001675B:G05 4:171 1203 1 M00003853B:G11 4:179 1252 1 M00022742A:F08 4:228 1266 1 M00026900D:F02 4:242 1605 1 M00001496A:G03 5:229 1648 1 M00001393D:F01 5:272 1793 1 M00023283C:C06 6:65  1927 1 M00007985A:B08 6:199 1933 1 M00007985B:A03 6:205 2332 1 M00026903D:D11 7:252 2404 1 M00006883D:H12 7:324 2633 1 M00007987D:D04 8:201 2659 1 M00023431B:A01 8:227 2662 1 M00023363C:A04 8:230 2799 1 M00004031B:D12 8:367 2889 1 M00003814C:C11 9:105 2917 1 M00007935D:A05 9:133 3005 1 M00021956B:A09 9:221 3204 1 M00027066B:E09 10:68  3296 1 M00022215C:A10 10:160  3313 1 M00003961B:H05 10:177  3519 1 M00005360A:A07 10:383  3665 1 M00001600C:B11 11:177  3748 1 M00001402B:C12 11:260  3974 1 M00022168B:F02 12:134  4040 1 M00008049B:A12 12:200  8594 2 RG:742775:10011:A07 1:178 8630 2 I:2458926:03B01:C07 1:214 8788 2 I:3229778:02B01:B07 1:372 8840 2 I:1857563:05B02:D01 2:72  9042 2 I:4072558:12B01:A07 2:274 9191 2 I:1421929:05A01:D02 3:71  9349 2 I:1723834:01A01:C02 3:229 9478 2 I:1817434:02B01:C02 3:358 9489 2 I:1750782:02A01:A08 3:369 9547 2 I:1297179:05A02:F02 4:75  9684 2 I:1443877:03B02:B08 4:212 9724 2 I:1384823:01B02:F08 4:252 9739 2 I:2902903:12A02:F02 4:267 9809 2 I:2152363:04A02:A08 4:337 10000 2 RG:813679:10011:H03 5:176 10006 2 RG:759927:10011:C09 5:182 10153 2 I:1712592:04A01:E03 5:329 10168 2 I:2615513:04B01:D09 5:344 10200 2 I:1702266:02B01:D09 5:376 10299 2 I:2825369:07A02:F09 6:123 10394 2 I:1450639:03B02:E09 6:218 10426 2 I:2499976:01B02:E09 6:250 10600 2 I:1749883:05B01:D04 7:72  10614 2 I:1516301:05B01:C10 7:86  10621 2 I:1298021:05A01:G10 7:93  10744 2 I:1613615:03B01:D10 7:216 10877 2 I:1395918:04A01:G10 7:349 10956 2 I:1600586:05B02:F04 8:76  10984 2 I:1666080:07B02:D04 8:104 11017 2 I:1633286:06A02:E04 8:137 11019 2 I:1609538:06A02:F04 8:139 11035 2 I:1630804:06A02:F10 8:155 11223 2 I:1749417:04A02:D10 8:343 11245 2 I:1809385:02A02:G04 8:365 11258 2 I:1854245:02B02:E10 8:378 11445 2 I:1854558:03A01:C11 9:213 11569 2 I:1509602:04A01:A11 9:337 11739 2 I:1699587:06A02:F11 10:155  11838 2 I:2840195:01B02:G11 10:254  11908 2 I:2914719:04B02:B05 10:324  11923 2 I:2239819:04A02:B11 10:339  12001 2 I:2483109:05A01:A06 11:65  12007 2 I:2499479:05A01:D06 11:71  12013 2 I:2675481:05A01:G06 11:77  12104 2 RG:773612:10011:D06 11:168  12270 2 I:2914605:04B01:G06 11:334  12513 2 I:2079906:01A02:A06 12:225  12519 2 I:1810640:01A02:D06 12:231  16933 3 I:1963753:18B01:E07 1:122 17035 3 RG:166410:10006:F01 1:171 17059 3 I:1920650:16A01:B01 1:195 17068 3 I:1923769:16B01:F01 1:204 17069 3 I:901317:16A01:G01 1:205 17075 3 I:3518380:16A01:B07 1:211 17171 3 RG:666323:10010:B07 1:307 17385 3 RG:244132:10007:E01 2:169 17386 3 RG:2117694:10016:E01 2:170 17399 3 RG:241029:10007:D07 2:183 17459 3 I:2056395:13A02:B07 2:243 17533 3 RG:1555877:10013:G07 2:317 17696 3 I:1923490:18B01:H08 3:128 17730 3 RG:526536:10002:A02 3:162 17742 3 RG:612874:10002:G02 3:174 17746 3 RG:530002:10002:A08 3:178 17836 3 RG:29739:10004:F02 3:268 17964 3 I:1920522:15B02:F02 4:44  18089 3 RG:244601:10007:E02 4:169 18100 3 RG:2048081:10016:B08 4:180 18102 3 RG:2097294:10016:C08 4:182 18240 3 RG:1927470:10015:H08 4:320 18331 3 I:1926006:15A01:F09 5:59  18379 3 I:2359588:18A01:F03 5:107 18389 3 I:986558:18A01:C09 5:117 18408 3 I:970933:14B01:D03 5:136 18445 3 RG:180296:10006:G03 5:173 18488 3 I:1743234:16B01:D09 5:216 18552 3 RG:25258:10004:D09 5:280 18580 3 RG:985973:10012:B09 5:308 18801 3 RG:203031:10007:A09 6:177 18804 3 RG:2055807:10016:B09 6:180 18856 3 I:605019:13B02:D03 6:232 18886 3 RG:43296:10005:C03 6:262 18903 3 RG:301608:10008:D09 6:279 18904 3 RG:45623:10005:D09 6:280 18921 3 RG:1461567:10013:E03 6:297 18942 3 RG:1895716:10015:G09 6:318 18985 3 I:1402615:09A02:E03 6:361 19067 3 I:2054678:19A01:F10 7:91  19120 3 I:956077:14B01:H04 7:144 19175 3 I:750899:16A01:D04 7:199 19189 3 I:620494:16A01:C10 7:213 19229 3 I:2060725:13A01:G10 7:253 19264 3 RG:35892:10004:H10 7:288 19374 3 I:1758241:15B02:G04 8:46  19428 3 I:1965257:18B02:B04 8:100 19590 3 RG:43534:10005:C04 8:262 19600 3 RG:110764:10005:H04 8:272 19603 3 RG:278409:10008:B10 8:275 19604 3 RG:41097:10005:B10 8:276 19629 3 RG:1552386:10013:G04 8:301 19642 3 RG:1838677:10015:E10 8:314 19766 3 I:1996180:19B01:C11 9:86  19816 3 I:1431819:14B01:D05 9:136 19821 3 I:1833191:14A01:G05 9:141 19822 3 I:1227385:14B01:G05 9:142 19835 3 I:2055926:14A01:F11 9:155 19950 3 RG:32281:10004:G05 9:270 19962 3 RG:27403:10004:E11 9:282 19971 3 RG:665682:10010:B05 9:291 20102 3 I:2759046:19B02:C05 10:70  20196 3 RG:2012168:10016:B05 10:164  20280 3 I:1960722:13B02:D11 10:248  20303 3 RG:343821:10008:H05 10:271  20315 3 RG:323425:10008:F11 10:283  20506 3 I:1969044:18B01:E12 11:122  20586 3 I:659143:16B01:E06 11:202  20691 3 RG:669110:10010:B12 11:307  20703 3 RG:740831:10010:H12 11:319  20775 3 I:1968921:15A02:D06 12:39  20878 3 I:998612:14B02:G06 12:142  20915 3 RG:208954:10007:B12 12:179  20940 3 I:1967543:16B02:F06 12:204  21017 3 RG:306813:10008:E12 12:281  21025 3 RG:1353123:10013:A06 12:289  21068 3 I:549299:17B02:F06 12:332  21160 4 RG:1996901:20003:D01 1:104 21207 4 M00056483D:G07 1:151 21294 4 M00042439D:C11 1:238 21354 4 RG:781507:10011:E01 1:298 21518 4 RG:1374447:20004:G01 2:110 21544 4 M00056908A:H05 2:136 21589 4 M00054777D:E09 2:181 21674 4 RG:2002384:20003:E01 2:266 21705 4 RG:1651303:10014:E01 2:297 21732 4 M00054538C:C01 2:324 21763 4 M00056622B:F12 2:355 21769 4 M00056632B:H10 2:361 21784 4 M00055423A:C07 2:376 21812 4 M00056308A:F02 3:52  21884 4 RG:2006302:20003:F08 3:124 21921 4 M00054639D:F05 3:161 21983 4 M00057081B:H03 3:223 22023 4 M00056533D:G07 3:263 22027 4 M00056534C:E08 3:267 22043 4 M00056585B:F04 3:283 22060 4 RG:785846:10011:F02 3:300 22072 4 RG:781028:10011:D08 3:312 22254 4 M00056918C:F09 4:142 22285 4 M00054742C:B12 4:173 22299 4 M00054806B:G03 4:187 22366 4 M00056350B:B03 4:254 22375 4 M00056728C:G02 4:263 22405 4 RG:1637619:10014:C02 4:293 22415 4 RG:1674393:10014:H02 4:303 22419 4 RG:1635546:10014:B08 4:307 22498 4 M00056250C:B02 5:34  22619 4 M00056500C:A07 5:155 22633 4 M00054647A:A09 5:169 22678 4 M00057231A:G04 5:214 22724 4 RG:1861510:20001:B03 5:260 22775 4 RG:417109:10009:D09 5:311 22783 4 RG:487171:10009:H09 5:319 23103 4 M00056810A:A02 6:287 23179 4 M00056645C:D11 6:363 23183 4 M00056646B:F07 6:367 23189 4 M00056679B:H03 6:373 23286 4 RG:1996788:20003:C10 7:118 23337 4 M00054650D:E04 7:169 23371 4 M00057044D:G03 7:203 23373 4 M00057046A:G09 7:205 23380 4 M00057241C:F03 7:212 23394 4 M00042756A:H02 7:226 23471 4 RG:471154:10009:H04 7:303 23514 4 M00054520A:D04 7:346 23803 4 M00056812D:A08 8:283 23813 4 RG:1638979:10014:C04 8:293 23984 4 RG:2051667:20003:H05 9:112 24185 4 RG:432960:10009:E11 9:313 24186 4 RG:785368:10011:E11 9:314 24297 4 M00055209C:B07 10:73  24358 4 M00056937C:C10 10:134  24394 4 M00056992C:F12 10:170  24423 4 M00057126C:B03 10:199  24429 4 M00057127B:B09 10:205  24515 4 RG:1630930:10014:B05 10:291  24519 4 RG:1645945:10014:D05 10:295  24700 4 RG:2006592:20003:F12 11:124  24713 4 M00056478D:B07 11:137  24728 4 M00056227B:G06 11:152  24806 4 M00042770D:G04 11:230  24855 4 M00056619A:H02 11:279  24866 4 RG:742764:10011:A06 11:290  24867 4 RG:364972:10009:B06 11:291  24883 4 RG:376554:10009:B12 11:307  24900 4 M00054500D:C08 11:324  24944 4 M00054971D:D07 11:368  25021 4 M00055258B:D12 12:93  25095 4 M00054769A:E05 12:167  25161 4 M00055435B:A12 12:233  25203 4 M00056822A:E08 12:275  25212 4 RG:2006592:20003:F12 12:284  25219 4 RG:1631867:10014:B06 12:291  25305 4 M00056707D:D05 12:377  25309 4 M00056709B:D03 12:381  25332 4 M00055583C:B07 1:55  25337 4 M00056301D:A04 1:60  25393 2 I:2606813:04A02:B12 12:339  25430 2 I:1931371:02B02:D12 12:376 

TABLE 6 Chrom- Sample Name or Gene osome Map CID Clone Name Function Class Pathway GeneAssignment Symbol Num Position 1 I:1222317:15A02:C02 Unknown Ca++ Homo sapiens S100 S100A 1 1q12- binding calcium-binding q22 protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog) (S100A4) mRNA > :: gb|M80563|HUMCAPL Human CAPL protein mRNA, complete cds. 2 I:1227385:14B01:G05 Signal kinase EphB3 [Homo sapiens] EPHB3 3 3q21 Transduction 2 RG:32281:10004:G05 Signal kinase EphB3 [Homo sapiens] EPHB3 3 3q21 Transduction 2 RG:41097:10005:B10 Signal kinase EphB3 [Homo sapiens] EPHB3 3 3q21 Transduction 3 I:1297179:05A02:F02 Metabolism dehydrogenase folate methylenetetrahydrofolate MTHFD1 14 14q24 pathway dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase 4 I:1298021:05A01:G10 Cell Cycle pseudouridine rRNA dyskeratosis congenital, DKC1 X Xq28 (psi) processing dyskerin synthase 5 I:1358285:04A02:F11 Signal kinase AXL receptor tyrosine AXL 19 19q13.1 Transduction kinase 5 M00022180D:E11 Signal kinase AXL receptor tyrosine AXL 19 19q13.1 Transduction kinase 6 I:1384823:01B02:F08 Cell Cycle CDC28 CDC28 protein kinase 2 CKS2 9 9q22 subunit 7 I:1395918:04A01:G10 Cytoskeleton GTPase Arg/Abl-interacting ARGBP2 4  4 protein ArgBP2 8 I:1402615:09A02:E03 Cell Cycle ubiquitination Fn14 for type I LOC51330 16 16 transmenmbrane protein 9 I:1421929:05A01:D02 Adhesion cadherin cadherin 3, P-cadherin CDH3 16 16q22 (placental) 10 I:1431819:14B01:D05 GTPase nucleolar P130 10 phosphoprotein p130 11 I:1443877:03B02:B08 Protein proteasome 26S proteasome- POH1 2  2 Degradation subunit associated pad1 homolog 12 I:1450639:03B02:E09 microtubule- caltractin (20 kD CALT X Xq28 organizing calcium-binding protein) 13 I:1480159:06B02:E03 Unknown protease kallikrein 6 (neurosin, KLK6 19 19q13.3 zyme) 14 I:1509602:04A01:A11 Metabolism lipoxygenase arachdonic arachidonate 5- ALOX5 10 10q11.2 metabolism lipoxygenase 15 I:1516301:05B01:C10 Transcription transcription forkhead box M1 FOXM1 12 12p13 factor 16 I:1600586:05B02:F04 RNA spliceosome splicing factor 3b, SF3B3 splicing subunit 3, 130 kD 17 I:1609538:06A02:F04 Mitochondrial translocase translocase of outer TOM34 20 20 mitochondrial 20 membrane 34 18 I:1613615:03B01:D10 Signal secreted bone morphogenetic BMP4 14 14q22- Transduction protein 4 q23 19 I:1630804:06A02:F10 Metabolism iron Friedreich ataxia FRDA 9 9q13- homeostasis q21.1 20 I:1633286:06A02:E04 Unknown membrane transmembrane 4 TM4SF4 3  3 superfamily member 4 21 I:1666080:07B02:D04 Unknown novel 22 I:1699587:06A02:F11 Unknown protease matrix MMP7 11 11q21- metalloproteinase 7 q22 (matrilysin, uterine) 23 I:1702266:02B01:D09 Metabolism carboxylate amino acid pyrroline-5-carboxylate PYCR1 17 17 reductase synthesis reductase 1 24 I:1712592:04A01:E03 insulin induced gene 1 INSIG1 7 7q36 25 I:1723834:01A01:C02 cell cycle transcription minichromosome MCM2 3 3q21 factor maintenance deficient (S. cerevisiae) 2 (mitotin) 26 I:1743234:16B01:D09 Novel secreted 27 I:1749417:04A02:D10 Unknown protease cathepsin H CTSH 15 15q24- q25 28 I:1749883:05B01:D04 Metabolism kinase pyridoxal (pyridoxine, PDXK 21 21q22.3 vitamin B6) kinase 29 I:1750782:02A01:A08 Unknown novel KIAA0007 protein KIAA0007 2  2 30 I:1758241:15B02:G04 Cell Cycle CDC28 CDC28 protein kinase 1 CKS1 8 8q21 kinase 30 M00056227B:G06 Cell Cycle CDC28 CDC28 protein kinase 1 CKS1 8 8q21 kinase 31 I:1809385:02A02:G04 integrin- integrin beta 3 binding ITGB3BP 1  1 binding protein (beta3- pathway endonexin) [Homo sapiens] 32 I:1810640:01A02:D06 Adhesion kinase EphA1 EPHA1 7 7q32- q36 33 I:1817434:02B01:C02 Nucleotide transketolase transketolase TKT 3 3p14.3 Biosynthesis (Wernicke-Korsakoff syndrome) 34 I:1833191:14A01:G05 Unknown dedicator of cytokinesis 3 DOCK3 3  3 35 I:1854245:02B02:E10 Unknown kinase KIAA0173 gene KIAA0173 2  2 product [Homo sapiens] 36 I:1854558:03A01:C11 Metabolism glycosylation fucosyltransferase 1 FUT1 19 19q13.3 (galactoside 2-alpha-L- fucosyltransferase, Bombay phenotype included) 37 I:1857563:05B02:D01 transcription 6-pyruvoyl- PCBD 10 10q22 factor tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 38 I:1920522:15B02:F02 Cell Cycle D123 gene product D123 39 I:1920650:16A01:B01 Ca++ annexin A3 ANXA3 4 4q13- signal q22 41 I:1923490:18B01:H08 Unknown phosphatase hypothetical protein LOC51235 1  1 41 M00022742A:F08 Unknown phosphatase hypothetical protein LOC51235 1  1 42 I:1923769:16B01:F01 Unknown unknown hypothetical protein, HSA272196 17 17q11.2 clone 2746033 43 I:1926006:15A01:F09 DNA mismatch mutS (E. coli) homolog 6 MSH6 2 2p16 Repair repair 44 I:1931371:02B02:D12 Unknown microtubule- KIAA0097 gene KIAA0097 11 11 organizing product 45 I:1960722:13B02:D11 Chaperone HSP90 tumor necrosis factor LOC51721 16 16 type 1 receptor associated protein [Homo sapiens] 46 I:1963753:18B01:E07 Trafficking membrane transporter 47 I:1965257:18B02:B04 Unknown novel 48 I:1967543:16B02:F06 Novel secreted 13 13 49 I:1968921:15A02:D06 Adhesion cell surface immunoglobulin ISLR 15 15q23- superfamily containing q24 leucine-rich repea 50 I:1969044:18B01:E12 Unknown kinase 51 I:1981218:16B02:H01 Unknown transmembrane integral type I protein P24B 15 15q24- 53 I:1996180:19B01:C11 Signal GTP q25 Transduction effector 54 I:2054678:19A01:F10 Unknown Ca++ 1  1 binding 55 I:2055926:14A01:F11 Unknown kinase thymidine kinase 1, TK1 17 17q23.2- soluble q25.3 56 I:2056395:13A02:B07 Adhesion fasciclin transforming growth TGFBI 5 5q31 factor, beta-induced, 68 kD 58 I:2060725:13A01:G10 Ca++ calcyclin binding CACYBP 1 1q24- signal protein [Homo sapiens] q25 59 I:2079906:01A02:A06 DNA replication Replication factor 60 I:2152363:04A02:A08 Unknown kinase non-metastatic cells 1, NME1 17 17q21.3 protein (NM23A) expressed in 63 I:2239819:04A02:B11 Unknown protease dipeptidase 1 (renal) DPEP1 16 16q24.3 64 I:2359588:18A01:F03 Unknown unknown 65 I:2458926:03B01:C07 Unknown novel KIAA0101 gene KIAA0101 15 15 product [Homo sapiens] 65 M00055423A:C07 Unknown novel KIAA0101 gene KIAA0101 15 15 product [Homo sapiens] 66 I:2483109:05A01:A06 Unknown kinase chromosome 1 open C1ORF2 1 1q21 reading frame 2 67 I:2499479:05A01:D06 Transcription transcription factor NRF NRF 68 I:2499976:01B02:E09 transmembrane 70 I:2606813:04A02:B12 Chaperone isomerase peptidylprolyl PPIE 1 1p32 isomerase E (cyclophilin E) 71 I:2615513:04B01:D09 antizyme polyamine antizyme inhibitor LOC51582 inhibitor synthesis [Homo sapiens] 74 I:2675481:05A01:G06 Mitochondrial protease ClpP (caseinolytic CLPP 19 19 protease, ATP- dependent, proteolytic subunit, E. coli) homolog 75 I:2759046:19B02:C05 Unknown membrane tetraspan 5 TSPAN-5 4  4 76 I:2825369:07A02:F09 Metabolism transferase serine phosphoserine PSA 9  9 biosynthesis aminotransferase 77 I:2840195:01B02:G11 Nucleotide kinase adenosine kinase ADK 10 10cen- Biosynthesis q24 78 I:2902903:12A02:F02 Adhesion transmembrane interferon induced IFITM1 11 11 transmembrane protein 1 (9-27) 79 I:2914605:04B01:G06 Unknown unknown KIAA0170 gene KIAA0170 6 6p21.3 product [Homo sapiens] 80 I:2914719:04B02:B05 nuclear RAE1 (RNA export 1, RAE1 20 20 export S. pombe) homolog 81 I:3229778:02B01:B07 Adhesion integrin integrin, alpha 2 ITGA2 5 5q23- (CD49B, alpha 2 31 subunit of VLA-2 receptor) 83 I:3518380:16A01:B07 Metabolism sterol cholesterol 7-dehydrocholesterol DHCR7 11 11q13.2- reductase biosynthesis reductase q13.5 85 I:4072558:12B01:A07 Translation initiation factor 87 I:549299:17B02:F06 Novel KIAA0784 protein KIAA0784 20 20q13.13- q13.2 88 I:605019:13B02:D03 Unknown transferase catechol-O- COMT 22 22q11.21 methyltransferase 89 I:620494:16A01:C10 Unknown proteasome proteasome (prosome, PSMB7 9 9q34.11- subunit macropain) subunit, q34.12 beta type, 7 90 I:659143:16B01:E06 Unknown novel 91 I:750899:16A01:D04 Unknown phosphatase protein tyrosine PTPRN 2 2q35- phosphatase, receptor q36.1 type, N 92 I:763607:16A01:E09 Unknown unknown tumor protein D52-like 1 TPD52L1 6 6q22- q23 93 I:901317:16A01:G01 Unknown proteasome proteasome (prosome, PSMB4 1 1q21 subunit macropain) subunit, beta type, 4 94 I:956077:14B01:H04 DNA GTPase nudix (nucleoside NUDT1 7 7p22 Repair diphosphate linked moiety X)-type motif 1 95 I:970933:14B01:D03 Novel secreted FOXJ2 forkhead factor LOC55810 96 I:986558:18A01:C09 Unknown unknown 3 98 I:998612:14B02:G06 Metabolism dehydrogenase 3-phosphoglycerate PHGDH 1 1p11.1- dehydrogenase 13.1 100 M00001341B:A11 Cell Cycle kinase KIAA0175 gene KIAA0175 9  9 product [Homo sapiens] 101 M00001349A:C11 Adhesion kinase discoidin domain DDR1 6 6p21.3 receptor family, member 1 102 M00001351C:E02 Unknown unknown cathepsin C CTSC 11 11q14.1- q14.3 103 M00001374A:A06 Unknown desaturase stearoyl-CoA SCD 10 10 desaturase 104 M00001393D:F01 Metabolism dehydrogenase lactate dehydrogenase B LDHB 12 12p12.2- p12.1 105 M00001402B:C12 Cell Cycle kinase cyclin-dependent CDK4 12 12q14 kinase 4 106 M00001402C:B01 Unknown unknown catenin (cadherin- CTNNAL1 9 9q31.2 associated protein), alpha-like 1 109 M00001489B:G04 HSPC003 protein HSPC003 [Homo sapiens] 110 M00001496A:G03 Transcription transcription v-myb avian MYBL2 20 20q13.1 factor myeloblastosis viral oncogene homolog-like 2 111 M00001558C:B06 Unknown novel hypothetical protein HSPC130 20 20 112 M00001600C:B11 helicase DEAD-box protein ABS 5  5 abstrakt [Homo sapiens] 113 M00001675B:G05 Novel GTPase KIAA0712 gene KIAA0712 11 11 product [Homo sapiens] 114 M00003814C:C11 Unknown novel KIAA0116 protein KIAA0116 3  3 115 M00003852B:C01 Signal cytokine prostate differentiation PLAB 19 19p13.1- Transduction factor 13.2 116 M00003853B:G11 Unknown novel 20 20 117 M00003961B:H05 Unknown kinase EphB4 EPHB4 7  7 118 M00004031B:D12 Unknown secreted 118 M00057112B:E11 Unknown secreted 120 M00004229C:B06 Unknown protease cathepsin Z CTSZ 20 20q13 121 M00005360A:A07 Novel calcitonin EGF-like-domain, EGFL2 1  1 receptor multiple 2 122 M00005438D:D06 Unknown protease beta-site APP-cleaving BACE2 21 21q22.3 enzyme 2 123 M00006883D:H12 Unknown novel 124 M00007935D:A05 Unknown novel 7  7 125 M00007965C:G08 Unknown unknown 126 M00007985A:B08 Unknown novel 1  1 127 M00007985B:A03 sigma sigma receptor SR-BP1 9  9 receptor (SR31747 binding protein 1) 128 M00007987D:D04 Novel secreted KIAA0179 KIAA0179 21 21q22.3 129 M00008049B:A12 RNA non-Pou domain- NONO X Xq13.1 Splicing containing octamer (ATGCAAAT) binding protein [Homo sapiens] 129 RG:25258:10004:D09 RNA non-Pou domain- NONO X Xq13.1 Splicing containing octamer (ATGCAAAT) binding protein [Homo sapiens] 130 M00008099D:A05 Unknown secreted 20 20 131 M00021828C:F04 Unknown kinase dual-specificity DYRK4 12 12 tyrosine-(Y)- phosphorylation regulated kinase 4 132 M00021956B:A09 Transcription transcription ets variant gene 4 (E1A ETV4 17 17q21 factor enhancer-binding protein, E1AF) 133 M00022009A:A12 Unknown unknown pleckstrin homology- PHLDA1 12 12q15 like domain, family A, member 1 134 M00022081D:G02 Unknown kinase Ste20-related KIAA0204 10 10 serine/threonine kinase [Homo sapiens] 135 M00022158D:C11 Adhesion laminin laminin, beta 3 (nicein LAMB3 1 1q32 (125 kD), kalinin (140 kD), BM600 (125 kD)) 136 M00022168B:F02 Unknown deaminase hypothetical protein FLJ10540 FLJ10540 137 M00022215C:A10 Unknown unknown 138 M00023283C:C06 Unknown novel hypothetical protein HN1L 16 16 similar to mouse HN1 (Hematological and Neurological expressed sequence 1) 139 M00023363C:A04 Unknown protease kallikrein 11 KLK11 19 19q13.3- q13.4 140 M00023371A:G03 Cell Cycle retinoblastoma-binding RBBP8 18 18q11.2 protein 8 141 M00023431B:A01 Ribosomal small 6 6q14.3- Biogenesis nucleolar 16.2 RNA 142 M00026888A:A03 Unknown novel 143 M00026900D:F02 Metabolism transferase sulfotransferase family SULT2B1 19 19q13.3 2B, member 1 144 M00026903D:D11 Metabolism kinase galactokinase 1 GALK1 17 17q24 145 M00027066B:E09 Unknown unknown 146 M00032537B:F11 Unknown transmembrane 147 M00042439D:C11 Cell Cycle ubiquitin ubiquitin carrier protein UBCH10 20 20 carrier E2-C 148 M00042704D:D09 Unknown novel 149 M00042756A:H02 Cell Cycle SET translocation SET 9 9q34 (myeloid leukemia- associated) 150 M00042770D:G04 hypothetical protein MAC30 17 17 151 M00042818A:D05 Unknown integrase 151 M00054520A:D04 Unknown integrase 152 M00054500D:C08 Unknown proteasome proteasome (prosome, PSMA7 subunit macropain) subunit, alpha type, 7 153 M00054538C:C01 Autophagy Apg12 (autophagy 12, APG12L 5 5q21- S. cerevisiae)-like q22 154 M00054639D:F05 GTP nucleocyto karyopherin (importin) KPNB3 binding plasmic beta 3 transport? 155 M00054647A:A09 Metabolism glyoxalase glyoxalase I GLO1 6 6p21.3- p21.1 156 M00054650D:E04 Ribosomal RNA, U22 small RNU22 11 11q13 Biogenesis nucleolar 157 M00054742C:B12 Unknown cytokine macrophage migration MIF 22 22q11.23 inhibitory factor (glycosylation- inhibiting factor) 158 M00054769A:E05 Translation ribosomal ribosomal protein S3A RPS3A 4 4q31.2- protein q31.3 159 M00054777D:E09 Unknown secreted carcinoembryonic CEACAM6 19 19q13.2 antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) 160 M00054806B:G03 Unknown snRNA 161 M00054893C:D03 Unknown novel putative nucleotide E2IG3 binding protein, estradiol-induced [Homo sapiens] 162 M00054971D:D07 Unknown novel 20 20q13.2- 13.2 163 M00055135A:B06 Unknown unknown hypothetical protein HSPC011 [Homo sapiens] 164 M00055258B:D12 interferon induced IFITM2 11 11 transmembrane protein 2 (1-8D) 165 M00055406C:D03 Unknown kinase CDC-like kinase 1 CLK1 2 2q33 166 M00055435B:A12 Apoptosis unknown over-expressed breast OBTP tumor protein 167 M00055583C:B07 Novel secreted hypothetical protein LOC51316 [Homo sapiens] 169 M00055873C:B06 Unknown protease secretory leukocyte SLPI inhibitor protease inhibitor (antileukoproteinase) 170 M00056250C:B02 transmembrane pituitary tumor- PTTG1 5 5q35.1 transforming 1 171 M00056301D:A04 Unknown unknown 172 M00056308A:F02 sulfate/ down-regulated in DRA 7 7q31 oxalate adenoma Transporter? 173 M00056350B:B03 Cytoskeleton Ca++ S100 calcium-binding S100A11 1 1q21 binding protein A11 (calgizzarin) 174 M00056423A:B06 Unknown novel hypothetical protein HSPC148 11 11 [Homo sapiens] 175 M00056478D:B07 Unknown novel clone HQ0310 LOC51203 15 15 PRO0310p1 [Homo sapiens] 176 M00056483D:G07 Unknown protease kallikrein 10 KLK10 19 19q13 176 M00057046A:G09 Unknown protease kallikrein 10 KLK10 19 19q13 177 M00056500C:A07 nascent-polypeptide- NACA 12 12q23- associated complex q24.1 alpha polypeptide 178 M00056533D:G07 Unknown secreted DKFZP434G032 DKFZP434G032 17 17 protein [Homo sapiens] 179 M00056534C:E08 Signal secreted amphiregulin AREG 4 4q13- Transduction (schwannoma-derived q21 growth factor) 180 M00056585B:F04 Unknown hydrolase gamma-glutamyl GGH hydrolase (conjugase, folylpolygammaglutamyl hydrolase) 181 M00056617D:F07 Unknown novel 182 M00056619A:H02 Cytoskeleton plastin plastin 3 (T isoform) PLS3 X X 183 M00056622B:F12 DNA topoisomerase topoisomerase (DNA) TOP2A 17 17q21- Replication II alpha (170 kD) q22 184 M00056632B:H10 ATP/GTP chromosome 20 open C20ORF1 20 20q11.2 binding reading frame 1 185 M00056645C:D11 Metabolism peroxidase oxidative glutathione peroxidase 1 GPX1 3 3p21.3 metabolism 186 M00056646B:F07 ribosomal protein L7a RPL7A 9 9q33- q34 187 M00056679B:H03 nucleophosmin NPM1 5 5q35 (nucleolar phosphoprotein B23, numatrin) 188 M00056707D:D05 Unknown novel 189 M00056709B:D03 Unknown novel CGI-138 protein LOC51649 17 17 [Homo sapiens] 190 M00056728C:G02 Cell Cycle MAD2 (mitotic arrest MAD2L1 4 4q27 deficient, yeast, homolog)-like 1 191 M00056732B:E02 Unknown novel LIM domain only 7 LMO7 13 13 192 M00056810A:A02 Novel GTP hypothetical protein PTD004 binding 193 M00056812D:A08 Unknown hydrolase S- AHCY 20 20cen- adenosylhomocysteine q13.1 hydrolase 194 M00056822A:E08 Signal RAS-like RAN, member RAS RAN 6 6p21 Transduction oncogene family 195 M00055209C:B07 Unknown novel 7 7p14- p15 195 M00056908A:H05 Unknown novel 7 7p14- p15 196 M00056918C:F09 Unknown novel hypothetical protein HSPC152 11 11 [Homo sapiens] 197 M00056937C:C10 Cell Cycle Ca++ S100 calcium-binding S100P 4 4p16 binding protein P 198 M00056953B:C09 Unknown proteasome proteasome (prosome, PSME2 14 14q11.2 subunit macropain) activator subunit 2 (PA28 beta) 199 M00056992C:F12 Unknown unknown 200 M00057044D:G03 Unknown unknown 6  6 201 M00057081B:H03 Unknown unknown ribosomal protein L10a RPL10A 202 M00057086D:D08 Unknown unknown RNA binding motif RBM8 1 1q12 protein 8 203 M00057126C:B03 Unknown novel 204 M00057127B:B09 Unknown unknown 205 M00057192B:D02 Unknown unknown 206 M00057231A:G04 Transcription transcription non-metastatic cells 2, NME2 17 17q21.3 factor protein (NM23B) expressed in 206 RG:1651303:10014:E01 Transcription transcription non-metastatic cells 2, NME2 17 17q21.3 factor protein (NM23B) expressed in 207 M00057241C:F03 Translation initiation eukaryotic translation EIF3S6 8 8q22- factor initiation factor 3, q23 subunit 6 (48 kD) 208 RG:110764:10005:H04 kinase protein kinase related PAK4 19 19 to S. cerevisiae STE20, effector for Cdc42Hs 210 RG:1325847:10012:H07 Unknown transmembrane 6 6q23 212 RG:1353123:10013:A06 Cell Cycle phosphatase cyclin-dependent CDKN3 14 14q22 kinase inhibitor 3 (CDK2-associated dual specificity phosphatase) 212 RG:1637619:10014:C02 Cell Cycle phosphatase cyclin-dependent CDKN3 14 14q22 kinase inhibitor 3 (CDK2-associated dual specificity phosphatase) 213 RG:1374447:20004:G01 Unknown novel 214 RG:1461567:10013:E03 Cell Cycle kinase budding uninhibited by BUB1 2 2q14 benzimidazoles 1 (yeast homolog) 215 RG:1525813:10013:F12 Unknown novel 2  2 216 RG:1552386:10013:G04 phosphatase acid phosphatase 1, ACP1 2 2p25 soluble 217 RG:1555877:10013:G07 Metabolism NADPH neutrophil cytosolic NCF4 22 22q13.1 oxidase factor 4 (40 kD), isoform 1 [Homo sapiens] 218 RG:1630930:10014:B05 nucleic kinase deoxythymidylate DTYMK 2  2 acid kinase synthesis 219 RG:1631867:10014:B06 DNA Ku protein dsDNA X-ray repair XRCC5 2 2q35 Repair repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80 kD) 220 RG:1638979:10014:C04 Metabolism GST drug glutathione S- GSTP1 11 11q13 metabolism transferase pi 221 RG:1645945:10014:D05 proteasome proteasome (prosome, PSMA2 6 6q27 subunit macropain) subunit, alpha type, 2 221 RG:1674393:10014:H02 proteasome proteasome (prosome, PSMA2 6 6q27 subunit macropain) subunit, alpha type, 2 222 RG:166410:10006:F01 Novel kinase 223 RG:1674098:10014:H01 Unknown unknown myristoylated alanine- MACS 6 6q22.2 rich protein kinase C substrate (MARCKS, 80K-L) 224 RG:180296:10006:G03 kinase protein tyrosine kinase PTK2B 8 8p21.1 2 beta 225 RG:1838677:10015:E10 kinase membrane-associated PKMYT1 tyrosine- and threonine-specific cdc2-inhibitory kinase 226 RG:1861510:20001:B03 Unknown novel 227 RG:1895716:10015:G09 Novel kinase 14 14 228 RG:1927470:10015:H08 Metabolism kinase glycolysis phosphoglycerate PGK1 X Xq13 kinase 1 229 RG:1996788:20003:C10 Unknown novel 230 RG:1996901:20003:D01 Unknown novel 231 RG:2002384:20003:E01 Unknown novel 232 RG:2006302:20003:F08 Unknown novel 233 RG:2006592:20003:F12 Unknown novel 12 235 RG:2012168:10016:B05 Metabolism hydrolase phosphoribosyl PPAT 4 4q12 pyrophosphate amidotransferase 236 RG:203031:10007:A09 Unknown kinase serine/threonine kinase STK15 20 20q13.2- 15 q13.3 236 RG:781507:10011:E01 Unknown kinase serine/threonine kinase STK15 20 20q13.2- 15 q13.3 237 RG:2048081:10016:B08 kinase mitogen-activated MAPK10 protein kinase 10 238 RG:2051667:20003:H05 Unknown novel 1  1 239 RG:2055807:10016:B09 Unknown kinase 20 20p12.2- 13 240 RG:208954:10007:B12 kinase Xq25-26.3 241 RG:2097257:10016:C07 Unknown protease serine protease, SPUVE 12 12 umbilical endothelium 242 RG:2097294:10016:C08 Mitochondrial transferase thymidylate serine SHMT2 12 12q12- synthase hydroxymethyltransferase q14 metabolic 2 (mitochondrial) cycle 243 RG:2117694:10016:E01 Unknown kinase serine/threonine kinase STK11 19 19p13.3 11 (Peutz-Jeghers syndrome) 244 RG:241029:10007:D07 Unknown kinase serine/threonine kinase STK12 17 17p13.1 12 245 RG:244132:10007:E01 kinase serum/glucocorticoid SGKL 8 8q12.3- regulated kinase-like 8q13.1 246 RG:244601:10007:E02 Cell Cycle kinase cyclin-dependent CDK5 7 7q36 kinase 5 247 RG:27403:10004:E11 Novel transmembrane 248 RG:278409:10008:B10 Unknown kinase mitogen-activated MAP2K4 17 17p11.2 protein kinase kinase 4 249 RG:29739:10004:F02 Cell Cycle kinase TTK protein kinase TTK 6 6q13- q21 250 RG:301608:10008:D09 kinase serine/threonine- PRP4 protein kinase PRP4 homolog 251 RG:306813:10008:E12 kinase v-ros avian UR2 ROS1 6 6q22 sarcoma virus oncogene homolog 1 252 RG:1635546:10014:B08 Ribosomal nucleolar protein NOP56 20 20 Biogenesis (KKE/D repeat) 252 RG:323425:10008:F11 Ribosomal nucleolar protein NOP56 20 20 Biogenesis (KKE/D repeat) 253 RG:343821:10008:H05 kinase TYRO3 protein TYRO3 15 15q15.1- tyrosine kinase q21.1 254 RG:35892:10004:H10 kinase activin A receptor, type I ACVR1 2 2q23- q24 255 RG:364972:10009:B06 Unknown novel 19 19 256 RG:376554:10009:B12 Unknown novel 8  8 257 RG:417109:10009:D09 Unknown novel 9  9 258 RG:43296:10005:C03 kinase SFRS protein kinase 2 SRPK2 7 7q22- q31.1 259 RG:432960:10009:E11 Transcription deacetylase retinoblastoma-binding RBBP7 protein 7 260 RG:43534:10005:C04 kinase ribosomal protein S6 RPS6KA1 3  3 kinase, 90 kD, polypeptide 1 261 RG:45623:10005:D09 Unknown novel HSKM-B protein HSKM-B 262 RG:471154:10009:H04 protease tissue inhibitor of TIMP3 22 22q12.3 inhibitor metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory) 263 RG:487171:10009:H09 Unknown kinase polo (Drosophia)-like PLK kinase 264 RG:526536:10002:A02 kinase solute carrier family 9 SLC9A3R2 16 16p13.3 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2 265 RG:530002:10002:A08 kinase EphA3 EPHA3 3 3p11.2 266 RG:612874:10002:G02 kinase serum-inducible kinase SNK 5  5 267 RG:665547:10010:B04 Unknown novel 2  2 268 RG:665682:10010:B05 Unknown kinase mitogen-activated MAP2K7 protein kinase kinase 7 269 RG:666323:10010:B07 kinase sterile-alpha motif and ZAK 2 2q24.2 leucine zipper containing kinase AZK [Homo sapiens] 270 RG:669110:10010:B12 Novel kinase 271 RG:686594:10010:D03 Cell Cycle kinase KIAA0965 protein KIAA0965 12 12 273 RG:729913:10010:G11 Unknown kinase 14 14 274 RG:740831:10010:H12 kinase v-raf murine sarcoma ARAF1 X Xp11.4- 3611 viral oncogene p11.2 homolog 1 276 RG:742764:10011:A06 RNA splicing factor, SFRS3 splicing arginine/serine-rich 3 277 RG:781028:10011:D08 kinase mitogen-activated MAP4K3 protein kinase kinase kinase kinase 3 278 RG:785368:10011:E11 Novel kinase PDZ-binding kinase; T- TOPK 8 8p21- cell originated protein p12 kinase 278 RG:785846:10011:F02 Novel kinase PDZ-binding kinase; T- TOPK 8 8p21- cell originated protein p12 kinase 280 RG:985973:10012:B09 Unknown kinase v-akt murine thymoma AKT3 1 1q43- viral oncogene q44 homolog 3 (protein kinase B, gamma) 291 M00022140A:E11 Chaperone HSP90 heat shock 90 kD HSPCB 6 6p12 protein 1, beta M00054510D:F09 RG:742775:10011:A07 RG:759927:10011:C09 RG:773612:10011:D06 RG:813679:10011:H03

The differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.

The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to normal. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.

The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.

A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumor and normal samples of each patient. During initial analysis of the microarrays, the hypothesis was accepted if p>10−3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the tumor and normal sample. If the tumor sample has detectable expression and the normal does not, the ratio is truncated at 1000 since the value for expression in the normal sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the normal sample has detectable expression and the tumor does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).

Table 7 (incorporated by reference to a compact disk) provides the results for gene products differentially expressed in the colon tumor samples relative to normal tissue samples. Table 7 includes: 1) the SEQ ID NO; 2) the CID or candidate identification number; 3) the spot identification number (“SpotID”); 4) the percentage of patients tested in which expression levels of the gene was at least 2-fold greater in cancerous tissue than in matched normal tissue (“>=2×”); 5) the percentage of patients tested in which expression levels of the gene was at least 2.5-fold greater in cancerous tissue than in matched normal tissue (“>=2.5×”); 6) the percentage of patients tested in which expression levels of the gene was at least 5-fold greater in cancerous tissue than in matched normal cells (“>=5×”); 7) the percentage of patients tested in which expression levels of the gene was less than or equal to ½ of the expression level in matched normal cells (“<=half×”); and 8) the number of patients tested for each sequence. Table 7 also includes the results from each patient, identified by the patient ID number (e.g., “15Ratio”). This data represents the ratio of differential expression for the samples tested from that particular patient's tissues (e.g., “15Ratio” is the ratio from the tissue samples of patient ID no. 15). The ratios of differential expression is expressed as a normalized hybridization signal associated with the tumor probe divided by the normalized hybridization signal with the normal probe. Thus, a ratio greater than 1 indicates that the gene product is increased in expression in cancerous cells relative to normal cells, while a ratio of less than 1 indicates the opposite.

These data provide evidence that the genes represented by the polynucleotides having the indicated sequences are differentially expressed in colon cancer.

Example 3 Antisense Regulation of Gene Expression

The expression of the differentially expressed genes represented by the polynucleotides in the cancerous cells was analyzed using antisense knockout technology to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting a metastatic phenotype.

A number of different oligonucleotides complementary to the mRNA generated by the differentially expressed genes identified herein were designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of the genes. Sets of antisense oligomers specific to each candidate target were designed using the sequences of the polynucleotides corresponding to a differentially expressed gene and the software program HYB simulator Version 4 (available for Windows 95/Windows NT or for Power Macintosh, RNAture, Inc. 1003 Health Sciences Road, West, Irvine, Calif. 92612 USA). Factors considered when designing antisense oligonucleotides include: 1) the secondary structure of oligonucleotides; 2) the secondary structure of the target gene; 3) the specificity with no or minimum cross-hybridization to other expressed genes; 4) stability; 5) length and 6) terminal GC content. The antisense oligonucleotide is designed to so that it will hybridize to its target sequence under conditions of high stringency at physiological temperatures (e.g., an optimal temperature for the cells in culture to provide for hybridization in the cell, e.g., about 37° C.), but with minimal formation of homodimers.

Using the sets of oligomers and the HYB simulator program, three to ten antisense oligonucleotides and their reverse controls were designed and synthesized for each candidate mRNA transcript, which transcript was obtained from the gene corresponding to the target polynucleotide sequence of interest. Once synthesized and quantitated, the oligomers were screened for efficiency of a transcript knock-out in a panel of cancer cell lines. The efficiency of the knock-out was determined by analyzing mRNA levels using lightcycler quantification. The oligomers that resulted in the highest level of transcript knock-out, wherein the level was at least about 50%, preferably about 80-90%, up to 95% or more up to undetectable message, were selected for use in a cell-based proliferation assay, an anchorage independent growth assay, and an apoptosis assay.

The ability of each designed antisense oligonucleotide to inhibit gene expression was tested through transfection into SW620 colon colorectal carcinoma cells. For each transfection mixture, a carrier molecule, preferably a lipitoid or cholesteroid, was prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide was then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide was further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, lipitoid or cholesteroid, typically in the amount of about 1.5-2 nmol lipitoid/μg antisense oligonucleotide, was diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide was immediately added to the diluted lipitoid and mixed by pipetting up and down. Oligonucleotide was added to the cells to a final concentration of 30 nM.

The level of target mRNA that corresponds to a target gene of interest in the transfected cells was quantitated in the cancer cell lines using the Roche LightCycler™ real-time PCR machine. Values for the target mRNA were normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) was placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water was added to a total volume of 12.5 μl. To each tube was added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents were mixed by pipetting up and down, and the reaction mixture was incubated at 42° C. for 1 hour. The contents of each tube were centrifuged prior to amplification.

An amplification mixture was prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT was added, and amplification was carried out according to standard protocols.

The results of the antisense assays are provided in Table 8. The results are expressed as the percent decrease in expression of the corresponding gene product relative to non-transfected cells, vehicle-only transfected (mock-transfected) cells, or cells transfected with reverse control oligonucleotides. Table 8 includes: 1) the SEQ ID NO; 2) the CID; 3) the “Gene Assignment” which refers to the gene to which the sequence has the greatest homology or identity; 4) the “Gene Symbol”; 5) GenBank gene name; and 6) the percent decrease in expression of the gene relative to control cells (“mRNA KO”).

TABLE 8 SEQ ID Gene GenBank mRNA NO CID GeneAssignment Symbol Gene Name KO  4 1 Homo sapiens S100 calcium-binding protein S100A S100A4 >80% A4 (calcium protein, calvasculin, metastasin, murine placental homolog) (S100A4) mRNA > :: gb|M80563|HUMCAPL Human CAPL protein mRNA, complete cds.  9 6 CDC28 protein kinase 2 CKS2 CKS2 01/ >80% 11  11 8 Fn14 for type I transmenmbrane protein LOC51330 Fn14 >90%  12 9 cadherin 3, P-cadherin (placental) CDH3 CADHERIN-P >90%  16 13 kallikrein 6 (neurosin, zyme) KLK6 proteaseM >80%  17 14 arachidonate 5-lipoxygenase ALOX5 ALOX5 >80%  22 18 bone morphogenetic protein 4 BMP4 BMP4 >90%  25 21 GSTHOM >90%  32 27 cathepsin H CTSH CATH-H >90%  38 33 transketolase (Wernicke-Korsakoff TKT TRANSKETOLASE >90% syndrome)  41 36 fucosyltransferase 1 (galactoside 2-alpha-L- FUT1 FUT1 >90% fucosyltransferase, Bombay phenotype included)  42 37 6-pyruvoyl-tetrahydropterin PCBD hDohc >95% synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1)  54 50 THC271862 >70%  56 53 hECT2 >80%  63 63 dipeptidase 1 (renal) DPEP1 DPP >80%  71 74 ClpP (caseinolytic protease, ATP-dependent, CLPP CLPP >80% proteolytic subunit, E. coli) homolog  77 75 tetraspan 5 TSPAN-5 NET-4 >90%  78 76 phosphoserine aminotransferase PSA serAT >90%  87 121 EGF-like-domain, multiple 2 EGFL2 EGFL2 >70% 100 127 sigma receptor (SR31747 binding protein 1) SR-BP1 SR-BP1 >90% 113 92 tumor protein D52-like 1 TPD52L1 hD53 >80% 141 143 sulfotransferase family 2B, member 1 SULT2B1 SULT2B1 >80% 147 166 over-expressed breast tumor protein OBTP HUMTUM >90% 165 179 amphiregulin (schwannoma-derived growth AREG AREG >90% factor) 180 193 S-adenosylhomocysteine hydrolase AHCY HUMAHCY2 >70% 183 196 hypothetical protein [Homo sapiens] HSPC152 c719 >80% 208 155 glyoxalase I GLO1 GLO1 >90% 213 160 c374641 >80% 214 161 putative nucleotide binding protein, E2IG3 c454001 >80% estradiol-induced [Homo sapiens] 218 164 interferon induced transmembrane protein 2 IFITM2 1-8U >90% (1-8D) 233 263 polo (Drosophia)-like kinase PLK PLK1 >90% 236 266 serum-inducible kinase SNK SNK >80% 239 269 sterile-alpha motif and leucine zipper ZAK AZK >70% containing kinase AZK [Homo sapiens] 242 273 AA399596 >70% 253 280 v-akt murine thymoma viral oncogene AKT3 AKT3 >90% homolog 3 (protein kinase B, gamma) 276 227 ITAK1 >90% 279 239 AI335279 >90% 285 242 serine hydroxymethyltransferase 2 SHMT2 SHMT2 >90% (mitochondrial) 294 245 serum/glucocorticoid regulated kinase-like SGKL SGKL >90% 295 248 mitogen-activated protein kinase kinase 4 MAP2K4 MKK4 >80% 300 249 TTK protein kinase TTK hTTK >90% 123, 103 stearoyl-CoA desaturase SCD SCD >90% 124 130, 115 prostate differentiation factor PLAB PLAB >80% 228 162, 176 kallikrein 10 KLK10 NES1 >80% 193 182, 195 c1665 >80% 217 247, 236 serine/threonine kinase 15 STK15 hARK2 >80% 290 257, 212 cyclin-dependent kinase inhibitor 3 (CDK2- CDKN3 KAP >85% 268 associated dual specificity phosphatase) 31, 170 pituitary tumor-transforming 1 PTTG1 PTTG1 >90% 151 35, 30 CDC28 protein kinase 1 CKS1 CKS1 >80% 150 5, 2 EphB3 [Homo sapiens] EPHB3 EPHB3 >90% 298, 301 65, 65 KIAA0101 gene product [Homo sapiens] KIAA0101 KIAA0101 >80% 220 73, 100 KIAA0175 gene product [Homo sapiens] KIAA0175 KIAA0175 >90% 116 75, 106 catenin (cadherin-associated protein), alpha- CTNNAL1 RTA00000179AF.k.22.1 >90% 131, like 1 134 8, 106 5 AXL receptor tyrosine kinase AXL >95% 88, 118 c3376 >80% 196

Example 4 Effect of Expression on Proliferation

The effect of gene expression on the inhibition of cell proliferation was assessed in metastatic breast cancer cell lines (MDA-MB-231 (“231”)), SW620 colon colorectal carcinoma cells, or SKOV3 cells (a human ovarian carcinoma cell line).

Cells were plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide was diluted to 21.1M in OptiMEM™ and added to OptiMEM™ into which the delivery vehicle, lipitoid 116-6 in the case of SW620 cells or 1:1 lipitoid 1:cholesteroid 1 in the case of MDA-MB-231 cells, had been diluted. The oligo/delivery vehicle mixture was then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments was 300 nM, and the final ratio of oligo to delivery vehicle for all experiments was 1.5 nmol lipitoid/μg oligonucleotide.

Antisense oligonucleotides were prepared as described above (see Example 3). Cells were transfected overnight at 37° C. and the transfection mixture was replaced with fresh medium the next morning. Transfection was carried out as described above in Example 3.

The results of the antisense experiments are shown in Table 9 (column labeled “Proliferation”). Those antisense oligonucleotides that resulted in decreased proliferation in SW620 colorectal carcinoma cells are indicated by “Inhib in” and “weak effect in”, with the cell type following. Those antisense oligonucleotides that resulted in inhibition of proliferation of SW620 cells indicates that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibited proliferation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that resulted in inhibition of proliferation of MDA-MB-231 cells indicates that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells.

TABLE 9 SEQ ID Gene mRNA NO CID GeneAssignment Symbol Gene KO Proliferation Softagar  4 1 Homo sapiens S100 S100A S100A4 >80% Inhib in weak calcium-binding protein SW620 inhibition A4 (calcium protein, calvasculin, metastasin, murine placental homolog) (S100A4) mRNA > :: gb|M80563|HUMCAPL Human CAPL protein mRNA, complete cds. 11 8 Fn14 for type I LOC51330 Fn14 >90% inconsis. inhibits transmenmbrane protein SW620, SW620, 231 231 12 9 cadherin 3, P-cadherin CDH3 CADHERIN-P >90% Inhib in Inhib in (placental) SW620 SW620 16 13 kallikrein 6 (neurosin, KLK6 proteaseM >80% weak effect negative zyme) in SW620 SW620 38 33 transketolase (Wernicke- TKT TRANSKETOLASE >90% inconsis. inhibits Korsakoff syndrome) SW620, SW620, 231 231 42 37 6-pyruvoyl- PCBD hDohc >95% inconsis. inhibits tetrahydropterin SW620, SW620, synthase/dimerization 231 231 cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 56 53 hECT2 >80% Inhib in Inhib in SW620 SW620 63 63 dipeptidase 1 (renal) DPEP1 DPP >80% weak negative inhibition in SW620 77 75 tetraspan 5 TSPAN-5 NET-4 >90% Inhib in weak SW620 inhibition 180  193 S-adenosylhomocysteine AHCY HUMAHCY 2 >70% Inhib in Inhib in hydrolase SW620 SW620 233  263 polo (Drosophia)-like PLK PLK1 >90% Inhib in Inhib in kinase SW620 SW620 236  266 serum-inducible kinase SNK SNK >80% Inhib in negative SW620 in SW620 253  280 v-akt murine thymoma AKT3 AKT3 >90% inhibits inhibits viral oncogene homolog 3 SKOV3, 231 SKOV3, (protein kinase B, gamma) 231 279  239 AI335279 >90% negative in weak SW620 inhibition 300  249 TTK protein kinase TTK hTTK >90% inhibits inhibits SW620 SW620 247, 290 236 serine/threonine kinase 15 STK15 hARK2 >80% Inhib in weak SW620 effect in SW620 257, 268 212 cyclin-dependent kinase CDKN3 KAP >85% Inhib in inhibitor 3 (CDK2- SW620 associated dual specificity phosphatase)  35, 150 30 CDC28 protein kinase 1 CKS1 CKS1 >80% Inhib in Inhib in SW620 SW620  88, 196 118 c3376 >80% weak effect neg in SW620 SW620

Example 5 Effect of Gene Expression on Colony Formation

The effect of gene expression upon colony formation of SW620 cells, SKOV3 cells, and MD-MBA-231 cells was tested in a soft agar assay. Soft agar assays were conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer was formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells were counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots were placed with media in 96-well plates (to check counting with WST1), or diluted further for the soft agar assay. 2000 cells were plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidified, 2 ml of media was dribbled on top and antisense or reverse control oligo (produced as described in Example 3) was added without delivery vehicles. Fresh media and oligos were added every 3-4 days. Colonies formed in 10 days to 3 weeks. Fields of colonies were counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.

Table 9 provides the results of these assays (“Softagar”). Those antisense oligonucleotides that resulted in inhibition of colony formation are indicated by “inhibits”, “weak effect”, or “weak inhibition” followed by the cell type. Those antisense oligonucleotides that resulted in inhibition of colony formation of SW620 cells indicates that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibited colony formation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that resulted in inhibition of colony formation of MDA-MB-231 cells indicates that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells.

Example 6 Induction of Cell Death Upon Depletion of Polypeptides by Depletion of mRNA (“Antisense Knockout”)

In order to assess the effect of depletion of a target message upon cell death, SW620 cells, or other cells derived from a cancer of interest, are transfected for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol is followed but cells are left in the presence of 2 μM drug. Each day, cytotoxicity was monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH is measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). A positive control using antisense and reverse control oligonucleotides for BCL2 (a known anti-apoptotic gene) is included; loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).

Example 7 Functional Analysis of Gene Products Differentially Expressed in Colon Cancer in Patients

The gene products of sequences of a gene differentially expressed in cancerous cells can be further analyzed to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting or inhibiting development of a metastatic phenotype. For example, the function of gene products corresponding to genes identified herein can be assessed by blocking function of the gene products in the cell. For example, where the gene product is secreted or associated with a cell surface membrane, blocking antibodies can be generated and added to cells to examine the effect upon the cell phenotype in the context of, for example, the transformation of the cell to a cancerous, particularly a metastatic, phenotype.

Where the gene product of the differentially expressed genes identified herein exhibits sequence homology to a protein of known function (e.g., to a specific kinase or protease) and/or to a protein family of known function (e.g., contains a domain or other consensus sequence present in a protease family or in a kinase family), then the role of the gene product in tumorigenesis, as well as the activity of the gene product, can be examined using small molecules that inhibit or enhance function of the corresponding protein or protein family.

Additional functional assays include, but are not necessarily limited to, those that analyze the effect of expression of the corresponding gene upon cell cycle and cell migration. Methods for performing such assays are well known in the art.

Example 8 Contig Assembly and Additional Gene Characterization

The sequences of the polynucleotides provided in the present invention can be used to extend the sequence information of the gene to which the polynucleotides correspond (e.g., a gene, or mRNA encoded by the gene, having a sequence of the polynucleotide described herein). This expanded sequence information can in turn be used to further characterize the corresponding gene, which in turn provides additional information about the nature of the gene product (e.g., the normal function of the gene product). The additional information can serve to provide additional evidence of the gene product's use as a therapeutic target, and provide further guidance as to the types of agents that can modulate its activity.

In one example, a contig was assembled using the sequence of the polynucleotide having SEQ ID NO:2 (sequence name 019.G3.sp6128473), which is present in clone M00006883D:H12. A “contig” is a contiguous sequence of nucleotides that is assembled from nucleic acid sequences having overlapping (e.g., shared or substantially similar) sequence information. The sequences of publicly-available ESTs (Expressed Sequence Tags) and the sequences of various clones from several cDNA libraries synthesized at Chiron were used in the contig assembly. None of the sequences from these latter clones from the cDNA libraries had significant hits against known genes with function when searched using BLASTN against GenBank as described above.

The contig was assembled using the software program Sequencher, version 4.05, according to the manufacturer's instructions. The final contig was assembled from 11 sequences, provided in the Sequence Listing as SEQ ID NOS:2 and 310-320. The sequence names and SEQ ID NOS of the sequences are provided in the overview alignment produced by Sequencher (see FIG. 1).

The clone containing the sequence of 035JN032.H09 (SEQ ID NO:319) is of particular interest. This clone was originally obtained from a normalized cDNA library prepared from a prostate cancer tissue sample that was obtained from a patient with Gleason grade 3+3. The clone having the 035JN032.H09 sequence corresponds to a gene that has increased expression in (e.g., is upregulated) in colon cancer as detected by microarray analysis using the protocol and materials described above. The data is provided in Table 10 below.

TABLE 10 Number of patients SEQ used to ID Spot Chip Sample calculate % % NO ID # ID concordance >=2x >=5x 2 1833 1 M00006883D:H12 33 61 33 319 27454 5 035JN032.H09 28 61 11

“%>2×” and “%>5×” indicate the percentage of patients in which the corresponding gene was expressed at two-fold and five-fold greater levels in cancerous cells relative to normal cells, respectively.

This observation thus further validates the expression profile of the clone having the sequence of 035JN032.H09, as it indicates that the gene represented by this sequence and clone is differentially expressed in at least two different cancer types.

The sequence information obtained in the contig assembly described above was used to obtain a consensus sequence derived from the contig using the Sequencher program. The consensus sequence is provided as SEQ ID NO:320 in the Sequence Listing.

In preliminary experiments, the consensus sequence was used as a query sequence in a BLASTN search of the DGTI DoubleTwist Gene Index (DoubleTwist, Inc., Oakland, Calif.), which contains all the EST and non-redundant sequence in public databases. This preliminary search indicated that the consensus sequence has homology to a predicted gene homologue to human atrophin-1 (HSS0190516.1 dtgic|HSC010416.3 Similar to: DRPL_HUMAN gi|17660|sp|P54259|DRPL_HUMAN ATROPHIN-1 (DENTATORUBRAL-PALLIDOLUYSIAN ATROPHY PROTEIN) [Homo sapiens (Human), provided as SEQ ID NO:322), with a Score=1538 bits (776), Expect=0.0, and Identities=779/780 (99%).

While the preliminary results regarding the homology to atrophin-1 are not yet confirmed, this example, through contig assembly and the use of homology searching software programs, shows that the sequence information provided herein can be readily extended to confirm, or confirm a predicted, gene having the sequence of the polynucleotides described in the present invention. Further the information obtained can be used to identify the function of the gene product of the gene corresponding to the polynucleotides described herein. While not necessary to the practice of the invention, identification of the function of the corresponding gene, can provide guidance in the design of therapeutics that target the gene to modulate its activity and modulate the cancerous phenotype (e.g., inhibit metastasis, proliferation, and the like).

Example 9 Source of Biological Materials

The biological materials used in the experiments that led to the present invention are described below.

Source of Patient Tissue Samples

Normal and cancerous tissues were collected from patients using laser capture microdissection (LCM) techniques, which techniques are well known in the art (see, e.g., Ohyama et al. (2000) Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol. 53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone et al. (1998) Trends Genet. 14:272-6; Conia et al. (1997) J. Clin. Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science 274:9981001). Table 11 provides information about each patient from which colon tissue samples were isolated, including: the Patient ID (“PT ID”) and Path ReportID (“Path ID”), which are numbers assigned to the patient and the pathology reports for identification purposes; the group (“Grp”) to which the patients have been assigned; the anatomical location of the tumor (“Anatom Loc”); the primary tumor size (“Size”); the primary tumor grade (“Grade”); the identification of the histopathological grade (“Histo Grade”); a description of local sites to which the tumor had invaded (“Local Invasion”); the presence of lymph node metastases (“Lymph Met”); the incidence of lymph node metastases (provided as a number of lymph nodes positive for metastasis over the number of lymph nodes examined) (“Lymph Met Incid”); the regional lymphnode grade (“Reg Lymph Grade”); the identification or detection of metastases to sites distant to the tumor and their location (“Dist Met & Loc”); the grade of distant metastasis (“Dist Met Grade”); and general comments about the patient or the tumor (“Comments”). Histophatology of all primary tumors indicated the tumor was adenocarcinoma except for Patient ID Nos. 130 (for which no information was provided), 392 (in which greater than 50% of the cells were mucinous carcinoma), and 784 (adenosquamous carcinoma). Extranodal extensions were described in three patients, Patient ID Nos. 784 and 791. Lymphovascular invasion was described in Patient ID Nos. 128, 228, 278, 517, 784, 786, 791, and 890. Crohn's-like infiltrates were described in seven patients, Patient ID Nos. 52, 264, 268, 392, 393, 784, and 791.

TABLE 11 Pt Path Histo ID ID Grp Anatom Loc Size Grade Grade Local Invasion  15 21 III Ascending 4.0 T3 G2 Extending into colon subserosal adipose tissue  52 71 II Cecum 9.0 T3 G3 Invasion through muscularis propria, subserosal involvement; ileocec. valve involvement 121 140 II Sigmoid 6 T4 G2 Invasion of muscularis propria into serosa, involving submucosa of urinary bladder 125 144 II Cecum 6 T3 G2 Invasion through the muscularis propria into suserosal adipose tissue. Ileocecal junction. 128 147 III Transverse 5.0 T3 G2 Invasion of colon muscularis propria into percolonic fat 130 149 Splenic 5.5 T3 through wall and flexure into surrounding adipose tissue 133 152 II Rectum 5.0 T3 G2 Invasion through muscularis propria into non- peritonealized pericolic tissue; gross configuration is annular. 141 160 IV Cecum 5.5 T3 G2 Invasion of muscularis propria into pericolonic adipose tissue, but not through serosa. Arising from tubular adenoma. 156 175 III Hepatic 3.8 T3 G2 Invasion through flexure mucsularis propria into subserosa/pericolic adipose, no serosal involvement. Gross configuration annular. 228 247 III Rectum 5.8 T3 G2 to Invasion through G3 muscularis propria to involve subserosal, perirectoal adipose, and serosa 264 283 II Ascending 5.5 T3 G2 Invasion through colon muscularis propria into subserosal adipose tissue. 266 285 III Transverse 9 T3 G2 Invades through colon muscularis propria to involve pericolonic adipose, extends to serosa. 268 287 I Cecum 6.5 T2 G2 Invades full thickness of muscularis propria, but mesenteric adipose free of malignancy 278 297 III Rectum 4 T3 G2 Invasion into perirectal adipose tissue. 295 314 II Ascending 5.0 T3 G2 Invasion through colon muscularis propria into percolic adipose tissue. 296 315 III Cecum 5.5 T3 G2 Invasion through muscularis propria and invades pericolic adipose tissue. Ileocecal junction. 339 358 II Rectosigmoid 6 T3 G2 Extends into perirectal fat but does not reach serosa 341 360 II Ascending 2 cm T3 G2 Invasion through colon invasive muscularis propria to involve pericolonic fat. Arising from villous adenoma. 356 375 II Sigmoid 6.5 T3 G2 Through colon wall into subserosal adipose tissue. No serosal spread seen. 392 444 IV Ascending 2 T3 G2 Invasion through colon muscularis propria into subserosal adipose tissue, not serosa. 393 445 II Cecum 6.0 T3 G2 Cecum, invades through muscularis propria to involve subserosal adipose tissue but not serosa. 413 465 IV Cecum 4.8 T3 G2 Invasive through muscularis to involve periserosal fat; abutting ileocecal junction. 517 395 IV Sigmoid 3 T3 G2 penetrates muscularis propria, involves pericolonic fat. 546 565 IV Ascending 5.5 T3 G2 Invasion through colon muscularis propria extensively through submucosal and extending to serosa. 577 596 II Cecum 11.5 T3 G2 Invasion through the bowel wall, into suberosal adipose. Serosal surface free of tumor. 784 803 IV Ascending 3.5 T3 G3 through muscularis colon propria into pericolic soft tissues 786 805 IV Descending 9.5 T3 G2 through muscularis colon propria into pericolic fat, but not at serosal surface 791 810 IV Ascending 5.8 T3 G3 Through the colon muscularis propria into pericolic fat 888 908 IV Ascending 2.0 T2 G1 Into muscularis colon propria 889 909 IV Cecum 4.8 T3 G2 Through muscularis propria int subserosal tissue 890 910 IV Ascending T3 G2 Through colon muscularis propria into subserosa. Lymph Reg Dist Pt Lymph Met Lymph Dist Met & Met ID Met Incid Grade Loc Grade Comment  15 Pos 3/8  N1 Neg MX invasive adenocarcinoma, moderately differentiated; focal perineural invasion is seen  52 Neg 0/12 N0 Neg M0 Hyperplastic polyp in appendix. 121 Neg 0/34 N0 Neg M0 Perineural invasion; donut anastomosis Neg. One tubulovillous and one tubular adenoma with no high grade dysplasia. 125 Neg 0/19 N0 Neg M0 patient history of metastatic melanoma 128 Pos 1/5  N1 Neg M0 130 Pos 10/24  N2 Neg M1 133 Neg 0/9  N0 Neg M0 Small separate tubular adenoma (0.4 cm) 141 Pos 7/21 N2 Pos - Liver M1 Perineural invasion identified adjacent to metastatic adenocarcinoma. 156 Pos 2/13 N1 Neg M0 Separate tubolovillous and tubular adenomas 228 Pos 1/8  N1 Neg MX Hyperplastic polyps 264 Neg 0/10 N0 Neg M0 Tubulovillous adenoma with high grade dysplasia 266 Neg 0/15 N1 Pos - MX Mesenteric deposit 268 Neg 0/12 N0 Neg M0 278 Pos 7/10 N2 Neg M0 Descending colon polyps, no HGD or carcinoma identified.. 295 Neg 0/12 N0 Neg M0 Melanosis coli and diverticular disease. 296 Pos 2/12 N1 Neg M0 Tubulovillous adenoma (2.0 cm) with no high grade dysplasia. Neg. liver biopsy. 339 Neg 0/6  N0 Neg M0 1 hyperplastic polyp identified 341 Neg 0/4  N0 Neg MX 356 Neg 0/4  N0 Neg M0 392 Pos 1/6  N1 Pos - Liver M1 Tumor arising at prior ileocolic surgical anastomosis. 393 Neg 0/21 N0 Neg M0 413 Neg 0/7  N0 Pos - Liver M1 rediagnosis of oophorectomy path to metastatic colon cancer. 517 Pos 6/6  N2 Neg M0 No mention of distant met in report 546 Pos 6/12 N2 Pos - Liver M1 577 Neg 0/58 N0 Neg M0 Appendix dilated and fibrotic, but not involved by tumor 784 Pos 5/17 N2 Pos - Liver M1 invasive poorly differentiated adenosquamous carcinoma 786 Neg 0/12 N0 Pos - Liver M1 moderately differentiated invasive adenocarcinoma 791 Pos 13/25  N2 Pos - Liver M1 poorly differentiated invasive colonic adenocarcinoma 888 Pos 3/21 N0 Pos - Liver M1 well to moderately differentiated adenocarcinomas; this patient has tumors of the ascending colon and the sigmoid colon 889 Pos 1/4  N1 Pos - Liver M1 moderately differentiated adenocarcinoma 890 Pos 11/15  N2 Pos - Liver M1

Source of Polynucleotides on Arrays

Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues. Table 12 provides information about the polynucleotides on the arrays including: (1) the “SEQ ID NO” assigned to each sequence for use in the present specification; (2) the spot identification number (“Spot ID”), an internal reference that serves as a unique identifier for the spot on the array; (3) the “Clone ID” assigned to the clone from which the sequence was isolated; (4) the number of the Group (“Grp”) to which the gene is assigned (see Example 11 below); and (5) the gene represented by the SEQ ID NO (“Gene”).

TABLE 12 SEQ ID Spot NO ID Clone ID Grp Gene GBHit GBDesc GBScore 322 33669 RG:26148:Order7TM01:C06 1 IGF2 X07868 Human DNA for insulin- 2.1E−35  like growth factor II (IGF-2); exon 7 and additional ORF 323 32956 RG:240381:Order7TM20:G11 1 IGF2 X03427 Homo sapiens IGF-II 7.4E−186 gene, exon 5 324 17167 RG:730402:10010:H01 1 TTK BC000633 Homo sapiens, TTK 2.1E−38  protein kinase, clone MGC: 865 IMAGE: 3343925, mRNA, complete cds 325 21711 RG:1674098:10014:H01 1 MARCKS D10522 Homo sapiens mRNA for   4E−148 80K-L protein, complete cds 326 29171 035JN025.C12 1 FLJ22066 AK025719 Homo sapiens cDNA: 0 FLJ22066 fis, clone HEP10611 327 30566 RG:432087:Order7TM26:D02 1 FLJ22066 AK025719 Homo sapiens cDNA: 0 FLJ22066 fis, clone HEP10611 328 10638 I:1644648:07B01:G04 1 NQO2 U07736 Human quinone 1.6E−171 oxidoreductase2 (NQO2) gene, exon 7, complete cds 329 8491 I:2594080:05A01:F01 1 FHL3 BC001351 Homo sapiens, Similar to 2.6E−34  four and a half LIM domains 3, clone MGC: 8696 IMAGE: 2964682, mRNA, compl 330 27092 035Jn031.C09 1 MGC: 29604 BC019103 Homo sapiens, clone   1E−300 MGC: 29604 IMAGE: 5021401, mRNA, complete cds 331 10394 I:1450639:03B02:E09 1 CETN2 BC005334 Homo sapiens, centrin, 1.1E−190 EF-hand protein, 2, clone MGC: 12421 IMAGE: 3961448, mRNA, complete cds 332 3295 M00008083D:D06 1 CGI-148 AF223467 Homo sapiens NPD008 2.5E−157 protein protein (NPD008) mRNA, complete cds 333 30831 RG:301734:Order7TM22:H02 1 KIP2 AB012955 Homo sapiens mRNA for 5.8E−252 KIP2, complete cds 334 19871 RG:196236:10006:H11 1 FGFR4 AF359246 Homo sapiens fibroblast   5E−249 growth factor receptor 4 variant mRNA, complete cds 335 30858 RG:359021:Order7TM24:F02 1 BBS2 AF342736 Homo sapiens BBS2   1E−100 (BBS2) mRNA, complete cds 336 17168 RG:1320327:10012:H01 1 OGG1 Y11731 H. sapiens mRNA for   1E−300 DNA glycosylase 337 17487 RG:341475:10008:H01 1 MAPKAPK2 NM_032960 Homo sapiens mitogen-   1E−300 activated protein kinase- activated protein kinase 2 (MAPKAPK2), transcript variant 338 18942 RG:1895716:10015:G09 2 ITAK AC007055 AC007055 Homo sapiens 3.00E−94  chromosome 14 clone BAC 201F1 map 14q24.3, complete sequence 339 17365 I:504786:14A02:C07 2 1-8U; 1-8D; BC006794 Homo sapiens, Similar to 6.4E−295 9-27 interferon induced transmembrane protein 3 (1-8U), clone MGC: 5225 IMAGE: 340 21144 M00055353D:A04 2 1-8U; 1-8D; BC006794 Homo sapiens, Similar to 1.1E−156 9-27 interferon induced transmembrane protein 3 (1-8U), clone MGC: 5225 IMAGE: 341 11573 I:1513214:04A01:C11 2 BIRC3 U45878 Human inhibitor of 2.5E−157 apoptosis protein 1 mRNA, complete cds

The sequences corresponding to the SEQ ID NOS are provided in the Sequence Listing.

Characterization of Sequences

The sequences of the isolated polynucleotides were first masked to eliminate low complexity sequences using the RepeatMasker masking program, publicly available through a web site supported by the University of Washington (See also Smit, A. F. A. and Green, P., unpublished results). Generally, masking does not influence the final search results, except to eliminate sequences of relatively little interest due to their low complexity, and to eliminate multiple “hits” based on similarity to repetitive regions common to multiple sequences, e.g., Alu repeats. Masking resulted in the elimination of several sequences.

The remaining sequences of the isolated polynucleotides were used in a homology search of the GenBank database using the TeraBLAST program (TimeLogic, Crystal Bay, Nev.), a DNA and protein sequence homology searching algorithm. TeraBLAST is a version of the publicly available BLAST search algorithm developed by the National Center for Biotechnology, modified to operate at an accelerated speed with increased sensitivity on a specialized computer hardware platform. The program was run with the default parameters recommended by TimeLogic to provide the best sensitivity and speed for searching DNA and protein sequences. Gene assignment for the query sequences was determined based on best hit form the GenBank database; expectancy values are provided with the hit.

Summary of TeraBLAST Search Results

Table 12 also provides information about the gene corresponding to each polynucleotide. Table 12 includes: (1) the “SEQ ID NO” of the sequence; (2) the GenBank Accession Number of the publicly available sequence corresponding to the polynucleotide (“GBHit”); (3) a description of the GenBank sequence (“GBDesc”); (4) the score of the similarity of the polynucleotide sequence and the GenBank sequence (“GBScore”). The published information for each GenBank and EST description, as well as the corresponding sequence identified by the provided accession number, are incorporated herein by reference.

Example 10 Detection of Differential Expression Using Arrays

cDNA probes were prepared from total RNA isolated from the patient cells described above. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.

Total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling.

Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red), and vice versa.

Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots, for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array.

Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues as described above and in Table 12. PCR products of from about 0.5 kb to 2.0 kb amplified from these sources were spotted onto the array using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides. The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1. For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about four duplicate measurements for each clone, two of one color and two of the other, for each sample.

The differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.

The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to normal. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.

The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.

A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumor and normal samples of each patient. During initial analysis of the microarrays, the hypothesis was accepted if p>10−3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the tumor and normal sample. If the tumor sample has detectable expression and the normal does not, the ratio is truncated at 1000 since the value for expression in the normal sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the normal sample has detectable expression and the tumor does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).

Tables 13A-D summarize the results of the differential expression analysis. Table 13A-D provides: (1) the spot identification number (“Spot ID”), an internal reference that serves as a unique identifier for the spot on the array; (2) the number of the Group (“Grp”) to which the gene is assigned (see Example 11 below); and (3) the ratio of expression of the gene in each of the patient samples, identified by the patient ID number (e.g., 15). This data represents the ratio of differential expression for the samples tested from that particular patient's tissues (e.g., “RATIO15” is the ratio from the tissue samples of Patient ID no. 15). The ratios of differential expression are expressed as a normalized hybridization signal associated with the tumor probe divided by the normalized hybridization signal with the normal probe. Thus, a ratio greater than 1 indicates that the gene product is increased in expression in cancerous cells relative to normal cells, while a ratio of less than 1 indicates the opposite.

TABLE 13A RATIO RATIO RATIO RATIO RATIO RATIO RATIO RATIO RATIO Spot ID Grp Gene 015 052 121 125 128 130 133 141 156 3295 1 CGI-148 protein 0.603 0.569 1.420 1.000 1.347 0.544 1.000 0.663 0.400 8491 1 FHL3 1.000 1.000 10.786 6.347 4.580 2.918 5.331 1.000 2.771 10394 1 CETN2 1.000 1.000 3.335 1.000 2.493 2.450 1.000 1.000 2.130 10638 1 NQO2 1.000 1.000 2.522 1.720 2.495 1.000 1.748 1.000 2.018 17167 1 TTK 1.000 1.000 5.053 1.000 5.484 1.000 1.000 1.000 1.000 17168 1 OGG1 1.389 1.000 1.736 1.000 2.525 1.000 2.339 1.000 1.162 17487 1 MAPKAPK2 1.000 1.000 39.041 1.000 26.551 1.000 54.030 0.657 0.116 19871 1 FGFR4 1.000 1.000 4.040 0.760 3.246 1.000 4.017 1.859 0.224 21711 1 MARCKS 1.000 1.000 21.440 1.294 10.369 1.000 20.040 1.000 1.000 27092 1 MGC:29604 1.806 2.418 5.831 2.114 11.273 1.821 9.841 1.413 2.385 29171 1 FLJ22066 1.000 1.000 184.016 0.728 52.758 0.849 145.030 1.000 0.015 30566 1 FLJ22066 1.000 1.000 163.068 1.000 53.616 1.000 1.000 1.000 0.083 30831 1 KIP2 0.723 1.000 2.349 1.000 1.972 1.000 1.000 1.437 0.626 30858 1 BBS2 1.304 0.745 1.907 1.678 2.686 0.525 1.877 1.000 0.251 32956 1 IGF2 1.105 1.000 20.747 1.000 10.458 1.000 1.000 1.000 0.476 33669 1 IGF2 0.592 0.381 21.028 1.195 16.876 0.334 25.468 0.720 0.049 11573 2 BIRC3 1.698 2.791 0.825 1.319 1.264 1.587 1.986 0.408 1.504 17365 2 1-8U; 1-8D; 9-27 3.113 2.893 1.229 4.848 3.307 4.004 9.166 1.000 1.769 18942 2 ITAK 4.489 7.386 1.000 6.655 4.507 5.485 12.390 1.000 2.281 21144 2 1-8U; 1-8D; 9-27 5.520 22.946 1.000 5.929 3.918 7.337 8.908 1.182 1.706

TABLE 13B RATIO RATIO RATIO RATIO RATIO RATIO RATIO RATIO RATIO Spot ID Grp Gene 228 264 266 268 278 295 296 339 341 3295 1 CGI-148 protein 0.579 0.599 0.302 1.000 1.270 1.000 0.484 0.561 1.000 8491 1 FHL3 1.000 1.000 1.000 12.583 4.691 1000.000 1000.000 3.136 7.320 10394 1 CETN2 1.000 1.000 1.000 3.463 1.000 1.000 1000.000 1.000 4.065 10638 1 NQO2 1.000 1.000 1.000 3.325 1.697 1.000 1000.000 1.000 3.036 17167 1 TTK 1.000 1.724 1.515 1.000 1.000 1.000 1000.000 1.000 5.355 17168 1 OGG1 1.000 1.584 1.332 2.564 2.024 1.600 1.551 0.739 1.999 17487 1 MAPKAPK2 1.000 1.000 1.206 43.580 23.642 2.085 1.000 0.545 18.309 19871 1 FGFR4 1.619 1.992 1.000 4.407 3.989 1000.000 1.000 1.324 2.494 21711 1 MARCKS 1.000 1.000 1.192 13.283 1.000 2.161 1.000 0.638 1.000 27092 1 MGC: 29604 1.927 3.330 2.678 10.984 9.190 4.226 8.035 0.757 14.757 29171 1 FLJ22066 1.000 1.760 1.000 186.617 83.660 4.242 1000.000 0.303 102.601 30566 1 FLJ22066 1.596 1.430 1.000 108.781 51.686 1.000 1.000 0.530 50.061 30831 1 KIP2 0.672 0.952 1.000 1.000 2.848 1.000 1.000 1.000 2.521 30858 1 BBS2 1.393 1.547 1.431 2.272 1.440 1.000 1.000 1.000 2.180 32956 1 IGF2 1.000 1.000 1.000 32.991 3.788 1.000 1.000 1.565 10.202 33669 1 IGF2 0.566 0.380 0.196 14.331 4.654 0.298 0.237 0.508 11.442 11573 2 BIRC3 1.000 1.645 1.000 1.283 1.667 1.408 2.084 1.000 1.000 17365 2 1-8U; 1-8D; 9-27 2.633 7.263 7.775 4.152 4.770 3.064 2.220 1.374 1.808 18942 2 ITAK 4.106 10.286 11.733 6.840 1.000 11.385 1.000 1.892 1.690 21144 2 1-8U; 1-8D; 9-27 5.027 8.086 8.148 3.902 7.228 5.159 1.000 2.787 1.569

TABLE 13C RATIO RATIO RATIO RATIO RATIO RATIO RATIO RATIO RATIO Spot ID Grp Gene 356 392 393 413 517 546 577 784 786 3295 1 CGI-148 protein 0.503 0.816 0.692 0.649 0.200 1.000 1.000 0.662 0.532 8491 1 FHL3 1.000 1.000 13.185 1.000 1000.000 3.131 5.278 1.000 1.000 10394 1 CETN2 1000.000 1.000 3.015 1.000 1.000 1.000 1.000 1.000 1.000 10638 1 NQO2 1.000 1.000 2.850 1.000 1.000 1.000 1.000 1.000 1.000 17167 1 TTK 1.000 1.000 5.355 1.000 1.000 1.000 3.158 1.092 1.898 17168 1 OGG1 1.000 2.116 1.694 1.000 1.000 1.000 1.672 1.701 1.000 17487 1 MAPKAPK2 1.556 51.316 43.253 0.516 1.412 0.813 1.000 1.000 1.000 19871 1 FGFR4 1.000 2.284 4.041 1.000 3.005 2.185 1.000 1.000 3.307 21711 1 MARCKS 1.000 32.171 26.574 0.814 1.000 1.000 1.347 1.000 1.000 27092 1 MGC: 29604 7.284 12.948 8.685 1.742 1.451 2.296 3.357 1.329 2.919 29171 1 FLJ22066 1.000 218.198 197.610 0.330 1.657 0.749 1.000 1.000 1.790 30566 1 FLJ22066 1.000 264.417 157.238 0.293 1.300 1.000 1.220 2.785 1.000 30831 1 KIP2 1.000 1.997 1.964 1.000 1.379 1.119 0.753 1.972 1.000 30858 1 BBS2 0.519 3.152 2.475 3.013 0.449 1.000 0.662 1.339 1.000 32956 1 IGF2 1.475 25.053 23.953 1.000 1.529 1.430 1.600 1.430 1.713 33669 1 IGF2 0.412 24.283 30.632 0.564 0.214 0.853 0.381 0.551 0.506 11573 2 BIRC3 1.000 1.199 1.768 1.000 1.485 1.000 1.429 1.000 1.648 17365 2 1-8U; 1-8D; 9-27 3.636 9.985 7.293 2.980 4.484 3.107 4.362 1.645 4.670 18942 2 ITAK 12.611 16.163 7.279 3.603 6.904 4.196 7.792 1.000 8.475 21144 2 1-8U; 1-8D; 9-27 10.080 18.239 8.395 2.839 6.176 3.328 5.636 2.142 7.000

TABLE 13D RATIO RATIO RATIO RATIO Spot ID Grp Gene 791 888 889 890 3295 1 CGI-148 protein 0.495 0.574 0.483 0.711 8491 1 FHL3 1.000 1.000 1.000 5.465 10394 1 CETN2 1.000 2.970 1.000 2.848 10638 1 NQO2 1.000 1.511 1.000 2.158 17167 1 TTK 1.000 1.000 1.000 2.290 17168 1 OGG1 1.000 1.000 1.000 1.519 17487 1 MAPKAPK2 1.000 1.449 1.000 1.516 19871 1 FGFR4 1.000 1.988 0.646 4.007 21711 1 MARCKS 1.000 1.397 1.000 1.000 27092 1 MGC: 29604 3.771 1.890 2.788 1.799 29171 1 FLJ22066 1.000 1.000 7.569 2.512 30566 1 FLJ22066 1.000 2.624 1.000 1.713 30831 1 KIP2 1.000 1.000 1.000 4.213 30858 1 BBS2 0.749 2.316 0.506 1.000 32956 1 IGF2 1.486 1.633 1.000 1.491 33669 1 IGF2 0.474 0.842 2.502 0.736 11573 2 BIRC3 2.502 0.781 1.314 1.000 17365 2 1-8U; 1-8D; 9-27 8.576 2.723 3.553 11.697 18942 2 ITAK 10.189 2.909 4.165 11.972 21144 2 1-8U; 1-8D; 9-27 14.444 2.712 7.659 11.467

These data provide evidence that the genes represented by the polynucleotides having the indicated sequences are differentially expressed in colon cancer as compared to normal non-cancerous colon tissue.

Example 11 Stratification of Colon Cancers Using Differential Expression Data

Groups of genes with differential expression data correlating with specific genes of interest can be identified using statistical analysis such as the Student t-test and Spearman rank correlation (Stanton Glantz (1997) Primer of Bio-Statistics, McGraw Hill, pp 65-107, 256-262). Using these statistical tests, patients having tumors that exhibit similar differential expression patterns can be assigned to Groups. At least two Groups were identified, and are described below.

Group 1

Genes that Exhibit Differential Expression in Colon Cancer in a Pattern that Correlates with IGF2

Using both the Student-t test and the Spearman rank correlation test, the differential expression data of IGF2 correlated with that of 14 distinct genes: TTK, MAPKAPK2, MARCKS, BBS2, CETN2 CGI-148 protein, FGFR4, FHL3, FLJ22066, KIP2, MGC:29604, NQO2, and OGG1 (see Tables 13A-D). The differential expression data for these genes is presented in graphical form in FIGS. 2-17. This group was identified as Group 1. IGF2 is a secreted protein and has been reported to be involved in colon as well as other cancers (Toretsky J A and Helman L J (1996) J Endocrinol 149(3):367-72). Genes whose expression patterns correlate with IGF2 may provide a mechanism for the involvement of IGF2 in cancer. Among the genes in Group 1 are genes such as TTK (a kinase implicated in mitotic spindle check point), MAP-KAP kinase 2 (mitogen-activated protein (MAP) kinase activated protein kinase 2), and MARCKS (myristoylated alanine-rich C kinase substrate, which is a substrate of protein kinase C). The protein products of these genes and their associated signaling pathways can be targets for small molecule drug development for anti-cancer therapy. Furthermore, the upregulation of IGF2 can be a criterion for selecting patients who will benefit from anti-cancer therapy targeted to the genes in Group 1 and their associated pathway components.

Group 2

Genes that Exhibit Differential Expression in Colon Cancer in a Pattern that Correlates Interferon Induced Transmembrane (IFITM) Protein Family

Using the Spearman rank correlation test, the differential expression data of the IFITM family (1-8U; 1-8D; 9-27) correlated with that of 2 other genes: ITAK and BIRC3/H-IAP1 (see Tables 13A-D). The differential expression data for these genes is presented in graphical form in FIGS. 18-21. This group was identified as Group 2. 1-8U/IFITM3 was previously reported as a gene differentially upregulated in ulcerative-colitis-associated colon cancer (Hisamatsu et al (1999) Cancer Research 59, 5927-5931). Genes whose expression patterns correlate with 1-8U/IFITM3 and its family members may provide a mechanism for the involvement of inflammation in colon cancer. There are at least 3 members of the IFITM family: 9-27/IFITM1, 1-8D/IFITM2 and 1-8U/IFITM3. The polynucleotides used for the detection of 1-8U/IFITM3 are within a domain that is highly conserved among the 3 members. Therefore, the upregulation detected by the corresponding microarray spots may indicate the upregulation of one or multiple members within the family. Among the genes in Group 2 are ITAK (IL-1, TNF alpha activated kinase) and BIRC3/H-IAP1 (human inhibitor of apoptosis 1). The protein products of these genes and their associated signaling pathways can be targets for small molecule drug development for anti-cancer therapy. Furthermore, the upregulation of the IFITM can be a criterion for selecting patients who will benefit from anti-cancer therapy targeted to the genes in Group 2 and their associated pathway components.

Example 12 Antisense Regulation of Gene Expression

The expression of the differentially expressed genes represented by the polynucleotides in the cancerous cells can be analyzed using antisense knockout technology to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting a metastatic phenotype.

A number of different oligonucleotides complementary to the mRNA generated by the differentially expressed genes identified herein can be designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of the genes. Sets of antisense oligomers specific to each candidate target are designed using the sequences of the polynucleotides corresponding to a differentially expressed gene and the software program HYBsimulator Version 4 (available for Windows 95/Windows NT or for Power Macintosh, RNAture, Inc. 1003 Health Sciences Road, West, Irvine, Calif. 92612 USA). Factors that are considered when designing antisense oligonucleotides include: 1) the secondary structure of oligonucleotides; 2) the secondary structure of the target gene; 3) the specificity with no or minimum cross-hybridization to other expressed genes; 4) stability; 5) length and 6) terminal GC content. The antisense oligonucleotide is designed so that it will hybridize to its target sequence under conditions of high stringency at physiological temperatures (e.g., an optimal temperature for the cells in culture to provide for hybridization in the cell, e.g., about 37° C.), but with minimal formation of homodimers.

Using the sets of oligomers and the HYB simulator program, three to ten antisense oligonucleotides and their reverse controls are designed and synthesized for each candidate mRNA transcript, which transcript is obtained from the gene corresponding to the target polynucleotide sequence of interest. Once synthesized and quantitated, the oligomers are screened for efficiency of a transcript knock-out in a panel of cancer cell lines. The efficiency of the knock-out is determined by analyzing mRNA levels using lightcycler quantification. The oligomers that resulted in the highest level of transcript knock-out, wherein the level was at least about 50%, preferably about 80-90%, up to 95% or more up to undetectable message, are selected for use in a cell-based proliferation assay, an anchorage independent growth assay, and an apoptosis assay.

The ability of each designed antisense oligonucleotide to inhibit gene expression is tested through transfection into SW620 colon carcinoma cells. For each transfection mixture, a carrier molecule (such as a lipid, lipid derivative, lipid-like molecule, cholesterol, cholesterol derivative, or cholesterol-like molecule) is prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide is then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide is further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, the carrier molecule, typically in the amount of about 1.5-2 nmol carrier/μg antisense oligonucleotide, is diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide is immediately added to the diluted carrier and mixed by pipetting up and down. Oligonucleotide is added to the cells to a final concentration of 30 nM.

The level of target mRNA that corresponds to a target gene of interest in the transfected cells is quantitated in the cancer cell lines using the Roche LightCycler™ real-time PCR machine. Values for the target mRNA are normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) is placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water is added to a total volume of 12.5 μl To each tube is added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents are mixed by pipetting up and down, and the reaction mixture is incubated at 42° C. for 1 hour. The contents of each tube are centrifuged prior to amplification.

An amplification mixture is prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT is added, and amplification is carried out according to standard protocols. The results are expressed as the percent decrease in expression of the corresponding gene product relative to non-transfected cells, vehicle-only transfected (mock-transfected) cells, or cells transfected with reverse control oligonucleotides.

Example 13 Effect of Expression on Proliferation

The effect of gene expression on the inhibition of cell proliferation can be assessed in metastatic breast cancer cell lines (MDA-MB-231 (“231”)); SW620 colon colorectal carcinoma cells; SKOV3 cells (a human ovarian carcinoma cell line); or LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells.

Cells are plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide is diluted to 2 μM in OptiMEM™. The oligonucleotide-OptiMEM™ can then be added to a delivery vehicle, which delivery vehicle can be selected so as to be optimized for the particular cell type to be used in the assay. The oligo/delivery vehicle mixture is then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments can be about 300 nM.

Antisense oligonucleotides are prepared as described above (see Example 12). Cells are transfected overnight at 37° C. and the transfection mixture is replaced with fresh medium the next morning. Transfection is carried out as described above in Example 12.

Those antisense oligonucleotides that result in inhibition of proliferation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit proliferation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of proliferation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit proliferation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.

Example 14 Effect of Gene Expression on Cell Migration

The effect of gene expression on the inhibition of cell migration can be assessed in SW620 colon cancer cells using static endothelial cell binding assays, non-static endothelial cell binding assays, and transmigration assays.

For the static endothelial cell binding assay, antisense oligonucleotides are prepared as described above (see Example 12). Two days prior to use, colon cancer cells (CaP) are plated and transfected with antisense oligonucleotide as described above (see Examples 4 and 5). On the day before use, the medium is replaced with fresh medium, and on the day of use, the medium is replaced with fresh medium containing 2 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in DMEM/1% BSA/10 mM HEPES pH 7.0. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.

Endothelial cells (EC) are plated onto 96-well plates at 40-50% confluence 3 days prior to use. On the day of use, EC are washed 1× with PBS and 50λ DMDM/1% BSA/10 mM HEPES pH 7 is added to each well. To each well is then added 50K (50) CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. The plates are incubated for an additional 30 min and washed 5× with PBS containing Ca++ and Mg++. After the final wash, 100 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).

For the non-static endothelial cell binding assay, CaP are prepared as described above. EC are plated onto 24-well plates at 30-40% confluence 3 days prior to use. On the day of use, a subset of EC are treated with cytokine for 6 hours then washed 2× with PBS. To each well is then added 150-200K CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. Plates are placed on a rotating shaker (70 RPM) for 30 min and then washed 3× with PBS containing Ca++ and Mg++. After the final wash, 500 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).

For the transmigration assay, CaP are prepared as described above with the following changes. On the day of use, CaP medium is replaced with fresh medium containing 5 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in EGM-2-MV medium. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.

EC are plated onto FluorBlok transwells (BD Biosciences) at 30-40% confluence 5-7 days before use. Medium is replaced with fresh medium 3 days before use and on the day of use. To each transwell is then added 50K labeled CaP. 30 min prior to the first fluorescence reading, 10 μg of FITC-dextran (10K MW) is added to the EC plated filter. Fluorescence is then read at multiple time points on a fluorescent plate reader (Ab492/Em 516 nm).

Those antisense oligonucleotides that result in inhibition of binding of SW620 colon cancer cells to endothelial cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that result in inhibition of endothelial cell transmigration by SW620 colon cancer cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous colon cells.

Example 15 Effect of Gene Expression on Colony Formation

The effect of gene expression upon colony formation of SW620 cells, SKOV3 cells, MD-MBA-231 cells, LNCaP cells, PC3 cells, 22Rv1 cells, MDA-PCA-2b cells, and DU145 cells can be tested in a soft agar assay. Soft agar assays are conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer is formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells are counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for the soft agar assay. 2000 cells are plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo (produced as described in Example 12) is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies form in 10 days to 3 weeks. Fields of colonies are counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.

Those antisense oligonucleotides that result in inhibition of colony formation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit colony formation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of colony formation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit colony formation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.

Example 16 Induction of Cell Death Upon Depletion of Polypeptides by Depletion of mRNA (“Antisense Knockout”)

In order to assess the effect of depletion of a target message upon cell death, SW620 cells, or other cells derived from a cancer of interest, can be transfected for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol is followed but cells are left in the presence of 2 μM drug. Each day, cytotoxicity is monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH is measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). A positive control using antisense and reverse control oligonucleotides for BCL2 (a known anti-apoptotic gene) is included; loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).

Example 17 Functional Analysis of Gene Products Differentially Expressed in Colon Cancer in Patients

The gene products of sequences of a gene differentially expressed in cancerous cells can be further analyzed to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting or inhibiting development of a metastatic phenotype. For example, the function of gene products corresponding to genes identified herein can be assessed by blocking function of the gene products in the cell. For example, where the gene product is secreted or associated with a cell surface membrane, blocking antibodies can be generated and added to cells to examine the effect upon the cell phenotype in the context of, for example, the transformation of the cell to a cancerous, particularly a metastatic, phenotype. In order to generate antibodies, a clone corresponding to a selected gene product is selected, and a sequence that represents a partial or complete coding sequence is obtained. The resulting clone is expressed, the polypeptide produced isolated, and antibodies generated. The antibodies are then combined with cells and the effect upon tumorigenesis assessed.

Where the gene product of the differentially expressed genes identified herein exhibits sequence homology to a protein of known function (e.g., to a specific kinase or protease) and/or to a protein family of known function (e.g., contains a domain or other consensus sequence present in a protease family or in a kinase family), then the role of the gene product in tumorigenesis, as well as the activity of the gene product, can be examined using small molecules that inhibit or enhance function of the corresponding protein or protein family.

Additional functional assays include, but are not necessarily limited to, those that analyze the effect of expression of the corresponding gene upon cell cycle and cell migration. Methods for performing such assays are well known in the art.

Example 18 Contig Assembly and Additional Gene Characterization

The sequences of the polynucleotides provided in the present invention can be used to extend the sequence information of the gene to which the polynucleotides correspond (e.g., a gene, or mRNA encoded by the gene, having a sequence of the polynucleotide described herein). This expanded sequence information can in turn be used to further characterize the corresponding gene, which in turn provides additional information about the nature of the gene product (e.g., the normal function of the gene product). The additional information can serve to provide additional evidence of the gene product's use as a therapeutic target, and provide further guidance as to the types of agents that can modulate its activity.

In one example, a contig is assembled using a sequence of a polynucleotide of the present invention, which is present in a clone. A “contig” is a contiguous sequence of nucleotides that is assembled from nucleic acid sequences having overlapping (e.g., shared or substantially similar) sequence information. The sequences of publicly-available ESTs (Expressed Sequence Tags) and the sequences of various clones from several cDNA libraries synthesized at Chiron can be used in the contig assembly.

The contig is assembled using the software program Sequencher, version 4.05, according to the manufacturer's instructions and an overview alignment of the contiged sequences is produced. The sequence information obtained in the contig assembly can then be used to obtain a consensus sequence derived from the contig using the Sequencher program. The consensus sequence is used as a query sequence in a TeraBLASTN search of the DGTI DoubleTwist Gene Index (DoubleTwist, Inc., Oakland, Calif.), which contains all the EST and non-redundant sequence in public databases.

Through contig assembly and the use of homology searching software programs, the sequence information provided herein can be readily extended to confirm, or confirm a predicted, gene having the sequence of the polynucleotides described in the present invention. Further the information obtained can be used to identify the function of the gene product of the gene corresponding to the polynucleotides described herein. While not necessary to the practice of the invention, identification of the function of the corresponding gene, can provide guidance in the design of therapeutics that target the gene to modulate its activity and modulate the cancerous phenotype (e.g., inhibit metastasis, proliferation, and the like).

Example 19 Source of Biological Materials

The biological materials used in the experiments that led to the present invention are described below.

Source of Patient Tissue Samples

Normal and cancerous tissues were collected from patients using laser capture microdissection (LCM) techniques, which techniques are well known in the art (see, e.g., Ohyama et al. (2000) Biotechniques 29:530-6; Curran et al. (2000) Mol. Pathol. 53:64-8; Suarez-Quian et al. (1999) Biotechniques 26:328-35; Simone et al. (1998) Trends Genet. 14:272-6; Conia et al. (1997) J. Clin. Lab. Anal. 11:28-38; Emmert-Buck et al. (1996) Science 274:9981001). Table 14 below provides information about each patient from which the prostate tissue samples were isolated, including: 1) the “Patient ID”, which is a number assigned to the patient for identification purposes; 2) the “Tissue Type”; and 3) the “Gleason Grade” of the tumor. Histopathology of all primary tumors indicated the tumor was adenocarcinoma.

TABLE 14 Prostate patient data. Gleason Patient ID Tissue Type Grade 93 Prostate Cancer 3 + 4 94 Prostate Cancer 3 + 3 95 Prostate Cancer 3 + 3 96 Prostate Cancer 3 + 3 97 Prostate Cancer 3 + 2 100 Prostate Cancer 3 + 3 101 Prostate Cancer 3 + 3 104 Prostate Cancer 3 + 3 105 Prostate Cancer 3 + 4 106 Prostate Cancer 3 + 3 138 Prostate Cancer 3 + 3 151 Prostate Cancer 3 + 3 153 Prostate Cancer 3 + 3 155 Prostate Cancer 4 + 3 171 Prostate Cancer 3 + 4 173 Prostate Cancer 3 + 4 231 Prostate Cancer 3 + 4 232 Prostate Cancer 3 + 3 251 Prostate Cancer 3 + 4 282 Prostate Cancer 4 + 3 286 Prostate Cancer 3 + 3 294 Prostate Cancer 3 + 4 351 Prostate Cancer 5 + 4 361 Prostate Cancer 3 + 3 362 Prostate Cancer 3 + 3 365 Prostate Cancer 3 + 2 368 Prostate Cancer 3 + 3 379 Prostate Cancer 3 + 4 388 Prostate Cancer 5 + 3 391 Prostate Cancer 3 + 3 420 Prostate Cancer 3 + 3 425 Prostate Cancer 3 + 3 428 Prostate Cancer 4 + 3 431 Prostate Cancer 3 + 4 492 Prostate Cancer 3 + 3 493 Prostate Cancer 3 + 4 496 Prostate Cancer 3 + 3 510 Prostate Cancer 3 + 3 511 Prostate Cancer 4 + 3 514 Prostate Cancer 3 + 3 549 Prostate Cancer 3 + 3 552 Prostate Cancer 3 + 3 858 Prostate Cancer 3 + 4 859 Prostate Cancer 3 + 4 864 Prostate Cancer 3 + 4 883 Prostate Cancer 4 + 4 895 Prostate Cancer 3 + 3 901 Prostate Cancer 3 + 3 909 Prostate Cancer 3 + 3 921 Prostate Cancer 3 + 3 923 Prostate Cancer 4 + 3 934 Prostate Cancer 3 + 3 1134 Prostate Cancer 3 + 4 1135 Prostate Cancer 3 + 3 1136 Prostate Cancer 3 + 4 1137 Prostate Cancer 3 + 3 1138 Prostate Cancer 4 + 3

Source of Polynucleotides on Arrays

Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues. Table 15 provides information about the polynucleotides on the arrays including: 1) the “SEQ ID NO” assigned to each sequence for use in the present specification; 2) the spot identification number (“Spot ID”), an internal reference that serves as a unique identifier for the spot on the array; 3) the “Sequence Name” assigned to each sequence; and 4) the “Sample Name or Clone Name” assigned to the sample or clone from which the sequence was isolated. The sequences corresponding to the SEQ ID NOS are provided in the Sequence Listing.

Characterization of Sequences

The sequences of the isolated polynucleotides were first masked to eliminate low complexity sequences using the RepeatMasker masking program, publicly available through a web site supported by the University of Washington (See also Smit, A. F. A. and Green, P., unpublished results). Generally, masking does not influence the final search results, except to eliminate sequences of relative little interest due to their low complexity, and to eliminate multiple “hits” based on similarity to repetitive regions common to multiple sequences, e.g., Alu repeats. Masking resulted in the elimination of several sequences.

The remaining sequences of the isolated polynucleotides were used in a homology search of the GenBank database using the TeraBLAST program (TimeLogic, Crystal Bay, Nev.), a DNA and protein sequence homology searching algorithm. TeraBLAST is a version of the publicly available BLAST search algorithm developed by the National Center for Biotechnology, modified to operate at an accelerated speed with increased sensitivity on a specialized computer hardware platform. The program was run with the default parameters recommended by TimeLogic to provide the best sensitivity and speed for searching DNA and protein sequences. Gene assignment for the query sequences was determined based on best hit form the GenBank database; expectancy values are provided with the hit.

Tables 16 and 17 provide information about the gene corresponding to each polynucleotide. Tables 16 and 17 include: 1) the spot identification number (“Spot ID”); 2) the GenBank Accession Number of the publicly available sequence corresponding to the polynucleotide (“GenBankHit”); 3) a description of the GenBank sequence (“GenBankDesc”); and 4) the score of the similarity of the polynucleotide sequence and the GenBank sequence (“GenBankScore”). The published information for each GenBank and EST description, as well as the corresponding sequence identified by the provided accession number, are incorporated herein by reference.

Example 20 Detection of Differential Expression Using Arrays

cDNA probes were prepared from total RNA isolated from the patient cells described above. Since LCM provides for the isolation of specific cell types to provide a substantially homogenous cell sample, this provided for a similarly pure RNA sample.

Total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling.

Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from the tumor RNA sample were compared to fluorescently labeled cDNAs prepared from normal cell RNA sample. For example, the cDNA probes from the normal cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumor cells were labeled with Cy5 fluorescent dye (red), and vice versa.

Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots, for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array.

Polynucleotides for use on the arrays were obtained from both publicly available sources and from cDNA libraries generated from selected cell lines and patient tissues as described above and in Table 15. PCR products of from about 0.5 kb to 2.0 kb amplified from these sources were spotted onto the array using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides. The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1. For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about four duplicate measurements for each clone, two of one color and two of the other, for each sample.

The differential expression assay was performed by mixing equal amounts of probes from tumor cells and normal cells of the same patient. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS. After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.

The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to normal. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.

The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescent intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.

A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumor and normal samples of each patient. During initial analysis of the microarrays, the hypothesis was accepted if p>10−3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the tumor and normal sample. If the tumor sample has detectable expression and the normal does not, the ratio is truncated at 1000 since the value for expression in the normal sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the normal sample has detectable expression and the tumor does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).

TABLE 15 SEQ ID Spot NO Id Sequence Name Sample Name or Clone Name 342 987 gbH13036.1 NIH50_43563 343 1016 019.G8.sp6_128478 M00006968D:E03 344 1019 1chip1.K15.T7HSQ3_328869 M00005636D:B08 345 1033 RTA00000184AR.p.16.1 M00001568C:D03 346 1047 122.B4.sp6_132088 M00001655C:E04 347 1049 324.E8.sp6_145687 M00001657A:C02 348 149 4chip1.F13.SP6_329984 M00001470A:C06 349 260 HX2105-6 2105-6 350 279 gbR51346.1 NIH50_39093 351 283 gbH05914.1 NIH50_43550 352 315 1chip1.K13.T7HSQ3_328837 M00005629C:E09 353 320 1chip1.P13.T7HSQ3_328842 M00006964D:C05 354 342 626.C7.sp6_157434 M00007965A:C03 355 369 SL178m13 SL178 356 403 RTA00000848F.c.07.1 M00023298C:E11 357 453 3chip1.F02.T7HSQ3_329424 M00008050A:D12 358 460 40000063.F01.T7HSQ3_332264 M00022135A:C04 359 462 642.G1.sp6_156335 M00022137A:A05 360 507 RTA00000603F.b.03.1 M00004163D:A08 361 511 774.H7.sp6_162527 M00004167D:H05 362 515 627.B2.sp6_157609 M00007976D:D10 363 530 636.A2.sp6_158173 M00022004A:F05 364 578 271.A1.sp6_145248 M00001429A:G04 365 579 269.B1.sp6_144876 M00001358B:F05 366 582 271.C1.sp6_145272 M00001429C:C03 367 589 269.G1.sp6_144936 M00001360C:B05 368 596 271.B7.sp6_145266 M00001445D:D07 369 605 6chip1.N13.SP6_330760 M00001374D:D10 370 627 8chip1.C14.Topo2_336359 2016-5 371 635 HX2058-2 2058-2 372 637 HX2090-1 2090-1 373 641 1chip1.A02.T7HSQ3_328651 M00006600A:E02 374 653 RTA00000321F.e.05.1 M00006619A:C04 375 656 959.SP6.H01_180102 M00007082B:D06 376 688 RTA00001082F.m.03.1 M00027211C:F06 377 742 660.C2.sp6_159543 M00026921D:F12 378 760 6chip1.G15.SP6_330785 M00026961D:G06 379 764 RTA00001069F.i.01.1 M00026962D:E01 380 770 021.A2.sp6_128760 M00005467A:G06 381 784 021.H2.sp6_128844 M00007007A:H06 382 789 5chip1.E16.SP6_330415 M00001393B:B01 383 816 40000062.H02.T7HSQ3_332178 M00008095B:G07 384 828 634.F8.sp6_155946 M00021638B:F03 385 866 RTA22200231F.p.10.1.P M00008002B:G03 386 920 656.D8.sp6_159369 M00026896A:C09 387 929 919.A2.SP6_168666 M00001339C:G05 388 964 HX2106-1 2106-1 389 978 HX2103-1 2103-1 390 1061 8chip1.E03.Topo2_336185 SL141 391 1108 661.B8.sp6_159729 M00027116A:A10 392 1111 RTA00001069F.b.02.1 M00023302D:E10 393 1117 653.G8.sp6_159021 M00023305A:C02 394 1137 022.A6.sp6_128956 M00007943C:f02 395 1145 019.G8.sp6_128478 M00006968D:e03 396 1176 642.D8.sp6_156306 M00022180D:E11 397 1195 5chip1.K03.SP6_330213 M00001675B:G05 398 1251 RTA00001038F.a.21.1 M00023413D:F04 399 1261 655.G2.sp6_156528 M00023419C:B06 400 1266 RTA00000922F.g.12.1 M00026900D:F02 401 1282 271.A2.sp6_145249 M00001430D:H07 402 1283 6chip1.D03.SP6_330590 M00001360D:H10 403 1298 RTA00000585F.o.09.2 M00001448A:C04 404 1307 269.F8.sp6_144931 M00001378D:E03 405 1309 269.G8.sp6_144943 M00001378D:G05 406 1310 271.G8.sp6_145327 M00001451D:F01 407 1319 HX2030-2 2030-2 408 1323 8chip1.K04.Topo2_336207 2054-2 409 1325 HX2076-5 2076-5 410 1331 HX2017-1 2017-1 411 1341 HX2090-3 2090-3 412 1351 1chip1.G04.T7HSQ3_328689 M00006630A:D01 413 1466 RTA00000852F.h.21.1 M00026964B:H10 414 1506 40000062.A03.T7HSQ3_332179 M00008095C:A10 415 1524 40000062.B09.T7HSQ3_332228 M00021649B:F09 416 1607 323.D3.sp6_145478 M00001497A:A09 417 1644 020.A2.sp6_128592 M00001393B:B01 418 1645 919.G3.SP6_168739 M00001342C:C01 419 1659 268.F9.sp6_144740 M00001350B:D10 420 1663 919.H9.SP6_168757 M00001350C:C05 421 1664 270.H9.sp6_145148 M00001411A:G02 422 1689 gbR61053.1 NIH50_42096 423 1693 gbH16957.1 NIH50_50117 424 1723 1chip1.K17.T7HSQ3_328901 M00005694A:A09 425 1752 626.D9.sp6_157448 M00007967D:G06 426 1767 SL149m13 SL149 427 1769 8chip1.I05.Topo2_336221 SL150 428 1789 8chip1.M17.Topo2_336417 SL200 429 1791 SL201m13 SL201 430 1794 661.A3.sp6_159712 M00027028A:A06 431 1807 653.H3.sp6_159028 M00023285D:C05 432 1810 RTA00001069F.k.22.1 M00027143D:E10 433 1852 1chip1.L18.T7HSQ3_328918 M00005380A:E11 434 1859 3chip1.D06.T7HSQ3_329486 M00008057A:B01 435 1868 642.F3.sp6_156325 M00022151A:B12 436 1895 RTA22200222F.k.17.1.P M00004069B:G01 437 1899 RTA00000603F.a.21.1 M00004072D:E08 438 1927 RTA22200231F.l.22.1.P M00007985A:B08 439 1936 RTA00000854F.g.12.1 M00008020C:H09 440 1955 655.B3.sp6_156469 M00023423B:A04 441 1957 655.C3.sp6_156481 M00023424C:A01 442 1992 271.D3.sp6_145286 M00001434D:F08 443 2000 271.H3.sp6_145334 M00001435C:F08 444 2014 4chip1.M17.SP6_330055 M00001462A:E06 445 2028 8chip1.L06.Topo2_336240 2237-3 446 2030 8chip1.N06.Topo2_336242 2245-1 447 2067 1chip1.C18.T7HSQ3_328909 M00006715C:C09 448 2108 RTA00001083F.e.05.1 M00027619D:A06 449 2110 RTA00001083F.e.06.1 M00027622D:H04 450 2137 sl102t7 SL102 451 2139 sl103m13 SL103 452 2152 RTA22200241F.k.11.1.P M00026931B:E12 453 2190 021.G4.sp6_128834 M00006953B:C05 454 2237 3chip1.N19.T7HSQ3_329704 M00007943D:B09 455 2267 773.F10.sp6_162349 M00001573D:H09 456 2280 RTA00001206F.a.07.1 M00008023B:A05 457 2338 270.A4.sp6_145059 M00001394C:B12 458 2357 268.C10.sp6_144705 M00001351A:A01 459 2375 gbR35294.1 NIH50_37451 460 2381 gbH09589.1 NIH50_46171 461 2427 RTA00001064F.k.13.2 M00005767D:B03 462 2442 626.E4.sp6_157455 M00007960A:D12 463 2513 653.A10.sp6_158951 M00023312D:F10 464 2514 661.A10.sp6_159719 M00027168A:E01 465 2528 661.H10.sp6_159803 M00027176D:B08 466 2549 019.E10.sp6_128456 M00005645D:g06 467 2557 020.G4.sp6_128666 M00005404C:f02 468 2564 RTA22200232F.o.21.1.P M00022154C:D08 469 2568 642.D4.sp6_156302 M00022158D:C11 470 2588 642.F10.sp6_156332 M00022208D:B02 471 2605 774.G4.sp6_162502 M00004085C:C02 472 2613 774.C10.sp6_162546 M00004243D:C01 473 2621 RTA00000193AR.c.15.2 M00004248B:E08 474 2629 RTA22200231F.m.13.1.P M00007987B:F11 475 2632 RTA22200233F.c.14.1.P M00008025D:A02 476 2662 RTA00001069F.c.03.1 M00023363C:A04 477 2663 RTA00000786F.o.16.3 M00023431C:F07 478 2694 271.C4.sp6_145275 M00001436B:E11 479 2696 271.D4.sp6_145287 M00001436C:C03 480 2702 271.G4.sp6_145323 M00001437B:B08 481 2716 271.F10.sp6_145317 M00001468A:D02 482 2728 8chip1.H08.Topo2_336268 2208-5 483 2732 HX2237-4 2237-4 484 2734 HX2245-2 2245-2 485 2736 HX2254-2 2254-2 486 2751 HX2100-1 2100-1 487 2765 955.SP6.G04_177960 M00006653C:B09 488 2766 RTA22200230F.g.19.1.P M00007154B:H08 489 2791 RTA00000789F.g.11.1 M00003994A:G12 490 2837 sl108m13 SL108 491 2919 625.D5.sp6_155727 M00007936A:C09 492 2922 959.SP6.G09_180098 M00008100B:G11 493 2977 RTA22200231F.m.16.1.P M00007990D:A11 494 2979 RTA22200231F.m.20.1.P M00007992A:D02 495 2988 628.F9.sp6_157856 M00008039A:C09 496 3009 323.A5.sp6_145444 M00001503C:D01 497 3090 HX2104-3 2104-3 498 3091 gbR42581.1 NIH50_31143 499 3093 gbR45594.1 NIH50_35483 500 3097 gbR61295.1 NIH50_42352 501 3099 gbH05820.1 NIH50_44255 502 3101 gbH16908.1 NIH50_50666 503 3122 019.G10.sp6_128480 M00007019A:B01 504 3143 324.D5.sp6_145672 M00001605D:C02 505 3152 626.H5.sp6_157492 M00007963B:B04 506 3235 019.D5.sp6_128439 M00005443D:b03 507 3275 633.F5.sp6_156135 M00008072D:E12 508 3284 642.B11.sp6_156285 M00022211D:A02 509 3301 5chip1.E09.SP6_330303 M00003820A:G06 510 3317 774.C11.sp6_162554 M00004282B:D11 511 3346 636.A10.sp6_158181 M00022068C:F05 512 3372 RTA00000854F.m.01.1 M00023395C:F06 513 3394 271.A5.sp6_145252 M00001437D:E12 514 3396 271.B5.sp6_145264 M00001438A:B09 515 3419 269.F11.sp6_144934 M00001387A:A08 516 3440 HX2254-4 2254-4 517 3453 HX2093-3 2093-3 518 3455 HX2100-2 2100-2 519 3469 RTA00002902F.h.07.1.P M00006678A:A03 520 3517 RTA22200224F.j.03.1.P M00005358D:A11 521 3531 SL66t7 SL66 522 3575 654.D12.sp6_159181 M00023398C:D01 523 3683 RTA00000717F.o.13.1 M00007994C:F08 524 3710 RTA22200232F.i.18.1.P M00022074D:H11 525 3712 636.H11.sp6_158266 M00022075A:B09 526 3745 268.A6.sp6_144677 M00001344D:H07 527 3760 013717 M00001405B:A11 528 3772 270.F12.sp6_145127 M00001427D:G03 529 3776 270.H12.sp6_145151 M00001428C:A07 530 3785 gbR58991.1 NIH50_41452 531 3794 HX2105-1 2105-1 532 3831 1chip1.G23.T7HSQ3_328993 M00006582A:D11 533 4007 RTA22200222F.m.10.1.P M00004136A:D10 534 4019 774.B12.sp6_162561 M00004331A:A03 535 4037 RTA22200231F.o.10.1.P M00007996C:F04 536 4068 344.B6.sp6_146241 M00023397B:E08 537 4100 4chip1.C11.SP6_329949 M00001441A:A09 538 4107 920.F6.SP6_168826 M00001372A:D01 539 4123 019.A4.sp6_128402 M00001389A:F09 540 4124 4chip1.K23.SP6_330149 M00001481C:A12 541 4127 6chip1.P23.SP6_330922 M00001389C:G01 542 4128 4chip1.O23.SP6_330153 M00001482D:D11 543 4135 HX2032-2 2032-2 544 4157 HX2093-5 2093-5 545 4193 RTA00002895F.h.23.1.P M00004087B:E02 546 8454 2231168 I:2231168:08B01:C01 547 8486 1813269 I:1813269:05B01:C01 548 8509 1732092 I:1732092:05A01:G07 549 8513 Incyte3.A01.T3pINCY_352048 I:3325119:07A01:A01 550 8537 Incyte3.I13.T3pINCY_352248 I:3176222:07A01:E07 551 8546 Incyte2.B01.T3pINCY_351665 I:1705208:06B01:A01 552 8549 Incyte2.E01.T3pINCY_351668 I:1623214:06A01:C01 553 8568 Incyte2.H13.T3pINCY_351863 I:1712888:06B01:D07 554 8569 Incyte2.I13.T3pINCY_351864 I:1702752:06A01:E07 555 8570 1696224 I:1696224:06B01:E07 556 8599 Incyte5.H13.T3pINCY_353015 I:1678926:11A01:D07 557 8608 3676190 I:3676190:11B01:H07 558 8634 Incyt14.I13.T3pINCY_377264 I:1439934:03B01:E07 559 8637 1640555 I:1640555:03A01:G07 560 8644 Incyt12.C01.T3pINCY_368180 I:2171743:01B01:B01 561 8672 2885982 I:2885982:01B01:H07 562 8703 2917169 I:2917169:12A01:H07 563 8730 2477854 I:2477854:10B01:E07 564 8743 1858905 I:1858905:04A01:D01 565 8829 2950228 I:2950228:08A02:G07 566 8835 1732335 I:1732335:05A02:B01 567 8856 I1.H14.T3pINCY1_343720 I:1803418:05B02:D07 568 8858 I1.J14.T3pINCY1_343722 I:1857652:05B02:E07 569 8860 I1.L14.T3pINCY1_343724 I:1568725:05B02:F07 570 8862 I1.N14.T3pINCY1_343726 I:1687060:05B02:G07 571 8890 3044552 I:3044552:07B02:E07 572 8945 Incyte5.B14.T3pINCY_353025 I:3282436:11A02:A07 573 8959 1817388 I:1817388:11A02:H07 574 8960 Incyt10.O14.T3pINCY_367632 I:2488216:11B02:H07 575 8996 Incyt11.D02.T3pINCY_367813 I:2365149:01B02:B01 576 9008 Incyte8.P01.T3pINCY_354174 I:3211615:01B02:H01 577 9013 Incyte8.E14.T3pINCY_354371 I:1419396:01A02:C07 578 9021 Incyt11.N13.T3pINCY_367999 I:2862971:01A02:G07 579 9055 Incyte6.P13.T3pINCY_353598 I:4335824:12A02:H07 580 9082 3275493 I:3275493:10B02:E07 581 9097 2021576 I:2021576:04A02:E01 582 9110 Incyt14.F14.T3pINCY_377277 I:2989411:04B02:C07 583 9111 I1.G14.T3pINCY1_343719 I:1958902:04A02:D07 584 9143 2728590 I:2728590:02A02:D07 585 9168 Incyte4.O03.T3pINCY_352478 I:2344817:08B01:H02 586 9171 Incyte3.D16.T3pINCY_352291 I:3236109:08A01:B08 587 9186 1574890 I:1574890:05B01:A02 588 9191 1421929 I:1421929:05A01:D02 589 9201 3142736 I:3142736:05A01:A08 590 9278 Incyte2.N15.T3pINCY_351901 I:1305950:06B01:G08 591 9296 Incyt10.O03.T3pINCY_367456 I:1804548:11B01:H02 592 9300 Incyt10.C15.T3pINCY_367636 I:3053958:11B01:B08 593 9312 Incyt10.O15.T3pINCY_367648 I:2799347:11B01:H08 594 9318 Incyt14.E03.T3pINCY_377100 I:1312824:03B01:C02 595 9348 2745048 I:2745048:01B01:B02 596 9364 2683564 I:2683564:01B01:B08 597 9366 Incyt12.E15.T3pINCY_368406 I:2725511:01B01:C08 598 9368 Incyte8.H16.T3pINCY_354406 I:2233375:01B01:D08 599 9381 Incyt10.F03.T3pINCY_367447 I:3218334:12A01:C02 600 9442 I1.B03.T3pINCY1_343538 I:1636639:04B01:A02 601 9448 I1.H03.T3pINCY1_343544 I:2455617:04B01:D02 602 9456 I1.P03.T3pINCY1_343552 I:2806166:04B01:H02 603 9472 I1.P15.T3pINCY1_343744 I:2510171:04B01:H08 604 9487 Incyt12.O04.T3pINCY_368240 I:2190284:02A01:H02 605 9499 Incyte7.K15.T3pINCY_354009 I:1861971:02A01:F08 606 9501 3360454 I:3360454:02A01:G08 607 9512 2948256 I:2948256:08B02:D02 608 9527 2045705 I:2045705:08A02:D08 609 9528 2544622 I:2544622:08B02:D08 610 9540 1522716 I:1522716:05B02:B02 611 9552 I1.P04.T3pINCY1_343568 I:1820522:05B02:H02 612 9553 2365295 I:2365295:05A02:A08 613 9560 I1.H16.T3pINCY1_343752 I:1822577:05B02:D08 614 9574 2472778 I:2472778:07B02:C02 615 9596 3141918 I:3141918:07B02:F08 616 9618 1306814 I:1306814:06B02:A08 617 9624 Incyte2.H16.T3pINCY_351911 I:3034694:06B02:D08 618 9640 Incyt10.G04.T3pINCY_367464 I:2859033:11B02:D02 619 9645 Incyte5.N04.T3pINCY_352877 I:2795249:11A02:G02 620 9647 Incyte5.P04.T3pINCY_352879 I:2966535:11A02:H02 621 9649 Incyte5.B16.T3pINCY_353057 I:1483713:11A02:A08 622 9666 Incyt14.A04.T3pINCY_377112 I:1453049:03B02:A02 623 9678 Incyt14.M04.T3pINCY_377124 I:1415990:03B02:G02 624 9687 Incyte9.G15.T3pINCY_354773 I:2992851:03A02:D08 625 9697 Incyt11.B03.T3pINCY_367827 I:1477568:01A02:A02 626 9698 2779637 I:2779637:01B02:A02 627 9716 Incyt11.D16.T3pINCY_368037 I:2786575:01B02:B08 628 9720 Incyt11.H16.T3pINCY_368041 I:2455118:01B02:D08 629 9722 Incyt11.J16.T3pINCY_368043 I:2840251:01B02:E08 630 9739 2902903 I:2902903:12A02:F02 631 9741 Incyte6.N03.T3pINCY_353436 I:3126828:12A02:G02 632 9755 3126622 I:3126622:12A02:F08 633 9770 Incyte5.I04.T3pINCY_352872 I:2911347:10B02:E02 634 9884 Incyte4.K17.T3pINCY_352698 I:2908878:08B01:F09 635 9889 2639181 I:2639181:05A01:A03 636 9901 3132987 I:3132987:05A01:G03 637 9911 3139163 I:3139163:05A01:D09 638 9913 2242817 I:2242817:05A01:E09 639 9914 1904751 I:1904751:05B01:E09 640 9916 1750553 I:1750553:05B01:F09 641 9920 1888940 I:1888940:05B01:H09 642 9949 Incyte3.M17.T3pINCY_352316 I:3970665:07A01:G09 643 9952 Incyte3.P17.T3pINCY_352319 I:1633393:07B01:H09 644 9956 Incyte2.D05.T3pINCY_351731 I:1617326:06B01:B03 645 9981 Incyte2.M17.T3pINCY_351932 I:1720149:06A01:G09 646 9989 Incyte5.F05.T3pINCY_352885 I:2689747:11A01:C03 647 9995 Incyte5.L05.T3pINCY_352891 I:2367733:11A01:F03 648 10003 1850531 I:1850531:11A01:B09 649 10012 Incyt10.K17.T3pINCY_367676 I:2594407:11B01:F09 650 10020 Incyt14.C05.T3pINCY_377130 I:1406786:03B01:B03 651 10021 1930235 I:1930235:03A01:C03 652 10035 I1.C17.T3pINCY1_343763 I:1526240:03A01:B09 653 10046 Incyt14.M17.T3pINCY_377332 I:1510714:03B01:G09 654 10047 I1.O17.T3pINCY1_343775 I:2952864:03A01:H09 655 10083 2922292 I:2922292:12A01:B03 656 10103 Incyte6.G18.T3pINCY_353669 I:3714075:12A01:D09 657 10153 Incyt14.J05.T3pINCY_377137 I:1712592:04A01:E03 658 10160 I1.P05.T3pINCY1_343584 I:2696735:04B01:H03 659 10200 Incyte7.H17.T3pINCY_354038 I:1702266:02B01:D09 660 10231 1808121 I:1808121:08A02:D09 661 10243 Incyt15.C05.T3pINCY_377526 I:3070110:05A02:B03 662 10257 Incyt15.A17.T3pINCY_377716 I:2860815:05A02:A09 663 10285 Incyte3.M06.T3pINCY_352140 I:1930135:07A02:G03 664 10301 2669174 I:2669174:07A02:G09 665 10334 Incyte2.N18.T3pINCY_351949 I:3354893:06B02:G09 666 10355 Incyte5.D18.T3pINCY_353091 I:4215852:11A02:B09 667 10366 Incyt10.M18.T3pINCY_367694 I:2896792:11B02:G09 668 10374 Incyt14.E06.T3pINCY_377148 I:1513989:03B02:C03 669 10388 Incyt14.C18.T3pINCY_377338 I:1453450:03B02:B09 670 10463 Incyte6.P17.T3pINCY_353662 I:4592475:12A02:H09 671 10481 Incyte5.A17.T3pINCY_353072 I:1726307:10A02:A09 672 10508 Incyt14.L06.T3pINCY_377155 I:1900378:04B02:F03 673 10519 1655492 I:1655492:04A02:D09 674 10569 Incyte3.J08.T3pINCY_352169 I:2447969:08A01:E04 675 10594 1871362 I:1871362:05B01:A04 676 10601 1337615 I:1337615:05A01:E04 677 10650 Incyte3.J19.T3pINCY_352345 I:2456393:07B01:E10 678 10674 Incyte2.B19.T3pINCY_351953 I:1911622:06B01:A10 679 10684 4082816 I:4082816:06B01:F10 680 10686 Incyte2.N19.T3pINCY_351965 I:1450849:06B01:G10 681 10746 Incyt14.I19.T3pINCY_377360 I:1445895:03B01:E10 682 10762 Incyte8.J08.T3pINCY_354280 I:2852042:01B01:E04 683 10766 2071761 I:2071761:01B01:G04 684 10767 Incyt11.O08.T3pINCY_367920 I:1336836:01A01:H04 685 10777 2591814 I:2591814:01A01:E10 686 10801 Incyt10.B19.T3pINCY_367699 I:3951088:12A01:A10 687 10805 Incyt10.F19.T3pINCY_367703 I:3815547:12A01:C10 688 10815 Incyte6.O20.T3pINCY_353709 I:2881469:12A01:H10 689 10830 1438966 I:1438966:10B01:G04 690 10832 2174773 I:2174773:10B01:H04 691 10855 2555828 I:2555828:04A01:D04 692 10864 I1.P07.T3pINCY1_343616 I:2966620:04B01:H04 693 10870 I1.F19.T3pINCY1_343798 I:2832889:04B01:C10 694 10873 Incyt14.J19.T3pINCY_377361 I:1342493:04A01:E10 695 10921 1675571 I:1675571:08A02:E04 696 10924 1349433 I:1349433:08B02:F04 697 10925 1819282 I:1819282:08A02:G04 698 10936 1709017 I:1709017:08B02:D10 699 10937 3121962 I:3121962:08A02:E10 700 10938 3409027 I:3409027:08B02:E10 701 10941 1697490 I:1697490:08A02:G10 702 10961 Incyt15.A19.T3pINCY_377748 I:3176845:05A02:A10 703 10997 Incyte3.E20.T3pINCY_352356 I:3495906:07A02:C10 704 11035 1630804 I:1630804:06A02:F10 705 11050 Incyte6.I07.T3pINCY_353495 I:2494284:11B02:E04 706 11053 Incyte5.N08.T3pINCY_352941 I:3316536:11A02:G04 707 11057 Incyte5.B20.T3pINCY_353121 I:3743802:11A02:A10 708 11092 Incyt14.C20.T3pINCY_377370 I:1690653:03B02:B10 709 11100 Incyt14.K20.T3pINCY_377378 I:1636553:03B02:F10 710 11104 Incyt14.O20.T3pINCY_377382 I:1402228:03B02:H10 711 11112 Incyte8.H07.T3pINCY_354262 I:2918558:01B02:D04 712 11114 Incyt11.J08.T3pINCY_367915 I:2837773:01B02:E04 713 11149 Incyt10.N08.T3pINCY_367535 I:4049957:12A02:G04 714 11153 Incyt10.B20.T3pINCY_367715 I:2182353:12A02:A10 715 11201 2579602 I:2579602:04A02:A04 716 11202 2824181 I:2824181:04B02:A04 717 11208 2842835 I:2842835:04B02:D04 718 11221 1958560 I:1958560:04A02:C10 719 11223 I1.G20.T3pINCY1_343815 I:1749417:04A02:D10 720 11231 2495131 I:2495131:04A02:H10 721 11269 2133481 I:2133481:08A01:C05 722 11290 Incyte4.I21.T3pINCY_352760 I:1340424:08B01:E11 723 11322 1858171 I:1858171:05B01:E11 724 11335 Incyte3.G09.T3pINCY_352182 I:3360365:07A01:D05 725 11341 Incyte3.M09.T3pINCY_352188 I:1453445:07A01:G05 726 11347 Incyte3.C21.T3pINCY_352370 I:3334367:07A01:B11 727 11351 Incyte3.G21.T3pINCY_352374 I:3002566:07A01:D11 728 11380 1701809 I:1701809:06B01:B11 729 11396 Incyt10.C09.T3pINCY_367540 I:2796468:11B01:B05 730 11463 Incyt11.G10.T3pINCY_367944 I:1486087:01A01:D05 731 11473 Incyt11.A22.T3pINCY_368130 I:2555034:01A01:A11 732 11485 Incyt11.M22.T3pINCY_368142 I:1402967:01A01:G11 733 11489 Incyt10.B09.T3pINCY_367539 I:2884153:12A01:A05 734 11493 2608167 I:2608167:12A01:C05 735 11543 Incyte4.H22.T3pINCY_352775 I:2821541:10A01:D11 736 11568 I1.P09.T3pINCY1_343648 I:2883195:04B01:H05 737 11569 Incyt14.B21.T3pINCY_377385 I:1509602:04A01:A11 738 11583 Incyt14.P21.T3pINCY_377399 I:2832224:04A01:H11 739 11624 2343403 I:2343403:08B02:D05 740 11639 1880426 I:1880426:08A02:D11 741 11675 1511342 I:1511342:05A02:F11 742 11677 1805745 I:1805745:05A02:G11 743 11682 2707290 I:2707290:07B02:A05 744 11683 3872557 I:3872557:07A02:B05 745 11731 Incyte2.C22.T3pINCY_352002 I:1689068:06A02:B11 746 11736 3511355 I:3511355:06B02:D11 747 11739 Incyte2.K22.T3pINCY_352010 I:1699587:06A02:F11 748 11745 3097582 I:3097582:11A02:A05 749 11794 Incyt14.A22.T3pINCY_377400 I:2949427:03B02:A11 750 11806 Incyt14.M22.T3pINCY_377412 I:1525881:03B02:G11 751 11819 2158884 I:2158884:01A02:F05 752 11835 Incyt11.L21.T3pINCY_368125 I:2183580:01A02:F11 753 11836 Incyt11.L22.T3pINCY_368141 I:1806769:01B02:F11 754 11855 Incyt10.P10.T3pINCY_367569 I:3856893:12A02:H05 755 11928 Incyt14.H22.T3pINCY_377407 I:1683944:04B02:D11 756 11934 Incyt14.N22.T3pINCY_377413 I:1907952:04B02:G11 757 11945 Incyte7.I10.T3pINCY_353927 I:1817352:02A02:E05 758 11992 Incyte4.G23.T3pINCY_352790 I:1683245:08B01:D12 759 12025 3176179 I:3176179:05A01:E12 760 12035 Incyte3.C11.T3pINCY_352210 I:3175507:07A01:B06 761 12098 3553751 I:3553751:11B01:A06 762 12187 Incyt11.K24.T3pINCY_368172 I:1504554:01A01:F12 763 12201 Incyte6.I12.T3pINCY_353575 I:2957410:12A01:E06 764 12253 1725001 I:1725001:10A01:G12 765 12258 I1.B11.T3pINCY1_343666 I:2989991:04B01:A06 766 12259 Incyt14.D11.T3pINCY_377227 I:1514989:04A01:B06 767 12283 Incyt14.L23.T3pINCY_377427 I:1481225:04A01:F12 768 12295 Incyte7.G11.T3pINCY_353941 I:1624459:02A01:D06 769 12298 Incyte7.J11.T3pINCY_353944 I:2122820:02B01:E06 770 12329 2591352 I:2591352:08A02:E06 771 12332 2551421 I:2551421:08B02:F06 772 12369 Incyt15.A23.T3pINCY_377812 I:1252255:05A02:A12 773 12388 2674482 I:2674482:07B02:B06 774 12446 Incyte2.N24.T3pINCY_352045 I:1634046:06B02:G12 775 12499 Incyte9.C23.T3pINCY_354897 I:2513883:03A02:B12 776 12515 Incyt11.D11.T3pINCY_367957 I:2537805:01A02:B06 777 12540 Incyte8.L23.T3pINCY_354522 I:1730527:01B02:F12 778 12544 Incyt11.P24.T3pINCY_368177 I:1733522:01B02:H12 779 12546 3948420 I:3948420:12B01:A06 780 12548 3679736 I:3679736:12B01:B06 781 12555 Incyte6.L11.T3pINCY_353562 I:4083705:12A02:F06 782 16846 772853 I:772853:19A01:D07 783 16881 2028093 I:2028093:15A01:E07 784 16883 2132508 I:2132508:15A01:F07 785 16917 Incyte20.I02.Alpha2_380275 I:3144018:18B01:E01 786 16935 Incyte20.K14.Alpha2_380469 I:1967531:18B01:F07 787 16959 1426031 I:1426031:14B01:B07 788 17017 1001970 I:1001970:14A01:E07 789 17049 K1.I14.Laf3_324935 RG:160664:10006:E07 790 17090 341491 I:341491:13B01:A01 791 17119 2058935 I:2058935:13A01:H07 792 17122 AA858434 RG:1420946:10004:A01 793 17143 R51346 NIH50_39093 794 17236 Incyte4.C14.T3pINCY_352642 I:1602726:09B01:B07 795 17365 504786 I:504786:14A02:C07 796 17370 2103752 I:2103752:14B02:E07 797 17377 K1.B01.Laf3_324720 RG:197713:10007:A01 798 17379 K1.D01.Laf3_324722 RG:205212:10007:B01 799 17386 AI523571 RG:2117694:10016:E01 800 17395 K1.D13.Laf3_324914 RG:207395:10007:B07 801 17398 AI421409 RG:2097257:10016:C07 802 17422 Incyte18.N01.Alpha2_379490 I:349535:16B02:G01 803 17432 Incyte18.H13.Alpha2_379676 I:1965049:16B02:D07 804 17454 1995971 I:1995971:13B02:G01 805 17457 2132815 I:2132815:13A02:A07 806 17475 N44546 RG:272992:10008:B01 807 17479 W03193 RG:296383:10008:D01 808 17496 H08652 RG:45089:10005:D07 809 17511 K1.H02.Laf3_324742 RG:1409220:10013:D01 810 17524 K2.C13.Laf3_325298 RG:1705470:10015:B07 811 17603 1001730 I:1001730:15A01:B02 812 17609 1922531 I:1922531:15A01:E02 813 17618 707667 I:707667:15B01:A08 814 17726 1997233 I:1997233:14B01:G08 815 17730 AA128438 RG:526536:10002:A02 816 17746 AA070046 RG:530002:10002:A08 817 17756 AA197021 RG:608953:10002:F08 818 17793 2054420 I:2054420:13A01:A02 819 17795 1994472 I:1994472:13A01:B02 820 17851 H13036 NIH50_43563 821 17854 R18972 RG:33368:10004:G08 822 17867 AA281116 RG:711647:10010:F02 823 17878 K1.E15.Laf3_324947 RG:1047592:10012:C08 824 18006 Incyte21.F16.Alpha2_380880 I:2760114:19B02:C08 825 18062 2307314 I:2307314:14B02:G02 826 18069 1981145 I:1981145:14A02:C08 827 18097 R99405 RG:201268:10007:A08 828 18178 R20998 RG:36399:10005:A02 829 18187 W24158 RG:310019:10008:F02 830 18235 AA923101 RG:1521317:10013:F08 831 18305 743595 I:743595:15A01:A03 832 18311 2621547 I:2621547:15A01:D03 833 18314 1988412 I:1988412:15B01:E03 834 18316 1987738 I:1987738:15B01:F03 835 18321 1922944 I:1922944:15A01:A09 836 18323 1213932 I:1213932:15A01:B09 837 18362 2296027 I:2296027:19B01:E09 838 18431 1998269 I:1998269:14A01:H09 839 18445 R85309 RG:180296:10006:G03 840 18447 H30045 RG:190269:10006:H03 841 18454 AA131155 RG:587068:10002:C09 842 18460 AA167493 RG:609044:10002:F09 843 18464 AA197125 RG:629241:10002:H09 844 18471 Incyte21.G06.Alpha2_380721 I:1953051:16A01:D03 845 18473 Incyte21.I06.Alpha2_380723 I:518826:16A01:E03 846 18519 1997703 I:1997703:13A01:D09 847 18560 R14989 RG:35716:10004:H09 848 18571 K2.L05.Laf3_325179 RG:712070:10010:F03 849 18594 Incyte19.A06.Alpha2_379947 I:1997779:17B01:A03 850 18620 Incyte19.K18.Alpha2_380149 I:1998428:17B01:F09 851 18624 Incyte19.O18.Alpha2_380153 I:406788:17B01:H09 852 18665 1968413 I:1968413:15A02:E03 853 18683 552654 I:552654:15A02:F09 854 18687 637576 I:637576:15A02:H09 855 18693 Incyte20.F06.Alpha2_380336 I:606875:19A02:C03 856 18724 1962095 I:1962095:18B02:B03 857 18758 856900 I:856900:14B02:C03 858 18760 2132752 I:2132752:14B02:D03 859 18769 143987 I:143987:14A02:A09 860 18787 K1.D05.Laf3_324786 RG:206694:10007:B03 861 18797 N23769 RG:263708:10007:G03 862 18821 Incyte18.E05.Alpha2_379545 I:1461515:16A02:C03 863 18845 Incyte18.M17.Alpha2_379745 I:1425861:16A02:G09 864 18860 700559 I:700559:13B02:F03 865 18872 1844755 I:1844755:13B02:D09 866 18891 W30991 RG:310347:10008:F03 867 18894 H19237 RG:51009:10005:G03 868 18919 K1.H06.Laf3_324806 RG:1415437:10013:D03 869 18920 K2.G05.Laf3_325174 RG:1734353:10015:D03 870 18926 AI281021 RG:1872251:10015:G03 871 18937 K1.J18.Laf3_325000 RG:1476452:10013:E09 872 18942 K2.M17.Laf3_325372 RG:1895716:10015:G09 873 18988 Incyte4.L05.T3pINCY_352507 I:2069305:09B02:F03 874 19005 2674167 I:2674167:09A02:G09 875 19025 2296518 I:2296518:15A01:A10 876 19113 692827 I:692827:14A01:E04 877 19130 1998594 I:1998594:14B01:E10 878 19166 AA186459 RG:625691:10002:G10 879 19173 Incyte21.E08.Alpha2_380751 I:293495:16A01:C04 880 19183 3187911 I:3187911:16A01:H04 881 19219 406016 I:406016:13A01:B10 882 19227 671776 I:671776:13A01:F10 883 19259 H06516 NIH50_44180 884 19287 AA290719 RG:700320:10010:D10 885 19348 Incyte4.C20.T3pINCY_352738 I:2556708:09B01:B10 886 19370 136571 I:136571:15B02:E04 887 19376 Incyte18.O08.Alpha2_379603 I:1988674:15B02:H04 888 19389 556016 I:556016:15A02:G10 889 19401 483757 I:483757:19A02:E04 890 19444 1923893 I:1923893:18B02:B10 891 19473 130254 I:130254:14A02:A10 892 19482 2263936 I:2263936:14B02:E10 893 19506 AI335696 RG:1949583:10016:A10 894 19512 AI523861 RG:2116699:10016:D10 895 19517 K1.N19.Laf3_325020 RG:266649:10007:G10 896 19527 996772 I:996772:16A02:D04 897 19574 635178 I:635178:13B02:C10 898 19600 T83145 RG:110764:10005:H04 899 19636 K2.C19.Laf3_325394 RG:1706414:10015:B10 900 19641 K1.J20.Laf3_325032 RG:1476433:10013:E10 901 19667 Incyte19.C19.Alpha2_380157 I:1368834:17A02:B10 902 19684 Incyte4.D07.T3pINCY_352531 I:2680168:09B02:B04 903 19701 1515905 I:1515905:09A02:C10 904 19713 996104 I:996104:15A01:A05 905 19725 1966446 I:1966446:15A01:G05 906 19738 1999120 I:1999120:15B01:E11 907 19743 591358 I:591358:15A01:H11 908 19835 2055926 I:2055926:14A01:F11 909 19887 Incyte21.O10.Alpha2_380793 I:452536:16A01:H05 910 19907 2056035 I:2056035:13A01:B05 911 19922 2102320 I:2102320:13B01:A11 912 19946 R38438 RG:26394:10004:E05 913 19955 R42581 NIH50_31143 914 19996 AA745592 RG:1283072:10012:F11 915 20084 Incyte18.C22.Alpha2_379815 I:79576:15B02:B11 916 20170 1431632 I:1431632:14B02:E05 917 20171 234123 I:234123:14A02:F05 918 20184 2027012 I:2027012:14B02:D11 919 20185 128997 I:128997:14A02:E11 920 20209 K1.B21.Laf3_325040 RG:204966:10007:A11 921 20212 AI377014 RG:2065950:10016:B11 922 20262 1995380 I:1995380:13B02:C05 923 20302 H19394 RG:51505:10005:G05 924 20331 K1.L10.Laf3_324874 RG:1519327:10013:F05 925 20401 1824332 I:1824332:09A02:A11 926 20422 735149 I:735149:15B01:C06 927 20436 1530218 I:1530218:15B01:B12 928 20508 1963854 I:1963854:18B01:F12 929 20530 167371 I:167371:14B01:A12 930 20551 K1.G12.Laf3_324901 RG:151093:10006:D06 931 20554 AA143470 RG:591811:10002:E06 932 20557 R87294 RG:180978:10006:G06 933 20558 AA187806 RG:624431:10002:G06 934 20570 AA159912 RG:593090:10002:E12 935 20587 Incyte21.K12.Alpha2_380821 I:2303180:16A01:F06 936 20617 911015 I:911015:13A01:E06 937 20624 1968576 I:1968576:13B01:H06 938 20676 K1.C11.Laf3_324881 RG:967302:10012:B06 939 20696 AA627319 RG:1157566:10012:D12 940 20714 Incyte19.I12.Alpha2_380051 I:1943853:17B01:E06 941 20716 1218621 I:1218621:17B01:F06 942 20799 1967095 I:1967095:15A02:H12 943 20878 998612 I:998612:14B02:G06 944 20892 699410 I:699410:14B02:F12 945 20937 Incyte18.I11.Alpha2_379645 I:429577:16A02:E06 946 20939 Incyte18.K11.Alpha2_379647 I:2117221:16A02:F06 947 20976 1782172 I:1782172:13B02:H06 948 20986 1986809 I:1986809:13B02:E12 949 20990 1986550 I:1986550:13B02:G12 950 20999 W07144 RG:300017:10008:D06 951 21029 AA890655 RG:1405692:10013:C06 952 21035 K1.L12.Laf3_324906 RG:1519656:10013:F06 953 21038 AI268327 RG:1880845:10015:G06 954 21050 K2.I23.Laf3_325464 RG:1841029:10015:E12 955 21189 RTA22200010F.e.10.1.P M00056386D:H12 956 21212 1.L13.Beta5_309680 M00056193B:C11 957 21214 1.N13.Beta5_309682 M00056193B:D06 958 21234 4.B13.Beta5_310822 M00054882C:C06 959 21245 4.M13.Beta5_310833 M00054680B:D06 960 21290 RTA00002690F.a.18.2.P M00042437B:G03 961 21307 RTA22200001F.g.08.1.P M00042702D:B02 962 21339 RTA22200011F.f.10.1.P M00056569A:B12 963 21345 W79308 RG:346944:10009:A01 964 21349 K2.E02.Laf3_325124 RG:376801:10009:C01 965 21391 RTA22200016F.o.05.1.P M00057273B:H10 966 21407 RTA22200017F.e.08.1.P M00057336A:C12 967 21539 1.C02.Beta5_309495 M00055932A:C02 968 21543 1.G02.Beta5_309499 M00055935D:B06 969 21546 2.J01.Beta5_309870 M00056908D:D08 970 21568 2.P13.Beta5_310068 M00056952B:C08 971 21569 4.A02.Beta5_310645 M00054728C:E03 972 21575 4.G02.Beta5_310651 M00054730D:F06 973 21650 RTA22200009F.o.15.1.P M00042867B:F03 974 21654 RTA22200009F.o.18.1.P M00042868A:A06 975 21658 RTA22200009F.p.01.1.P M00042869D:B09 976 21660 RTA22200009F.p.01.1.P M00042869D:B09 977 21671 2.G01.Beta5_309867 M00056719C:G03 978 21693 2.M13.Beta5_310065 M00056785D:G01 979 21694 AI251081 RG:2007272:20003:G07 980 21701 AI066797 RG:1637588:10014:C01 981 21705 AI123832 RG:1651303:10014:E01 982 21735 3.G01.Beta5_310251 M00043310D:E11 983 21766 RTA22200025F.o.18.2.P M00055398B:C07 984 21781 RTA22200012F.a.23.1.P M00056667C:H09 985 21786 RTA22200026F.d.20.1.P M00055423C:C03 986 21791 3.P14.Beta5_310468 M00056669B:E07 987 21947 4.K15.Beta5_310863 M00054684B:C07 988 21966 5.N03.Beta5_311058 M00057194B:G12 989 22003 RTA22200001F.g.22.1.P M00042711B:G09 990 22040 ovarian1.G15.amp3_326923 RG:1862072:20001:D08 991 22071 W87399 RG:417093:10009:D08 992 22078 K2.N16.Laf3_325357 RG:809602:10011:G08 993 22132 RTA22200022F.n.06.1.P M00054980D:H02 994 22227 AI252058 RG:1983965:20002:B08 995 22279 4.G04.Beta5_310683 M00054737D:F10 996 22291 4.C16.Beta5_310871 M00054785D:G05 997 22299 4.K16.Beta5_310879 M00054806B:G03 998 22352 RTA22200009F.l.07.2.P M00042842B:E02 999 22414 AA595123 RG:1102368:10003:G02 1000 22423 AI040910 RG:1647954:10014:D08 1001 22451 RTA00002691F.d.11.3.P M00043372B:B06 1002 22597 RTA22200010F.h.09.1.P M00056417A:F02 1003 22604 1.L05.Beta5_309552 M00056150C:A10 1004 22608 1.P05.Beta5_309556 M00056151C:A12 1005 22627 RTA22200020F.j.04.1.P M00054645B:C12 1006 22629 4.E05.Beta5_310697 M00054646A:B10 1007 22632 4.H05.Beta5_310700 M00054858D:F04 1008 22633 RTA22200020F.j.09.1.P M00054647A:A09 1009 22637 RTA22200020F.j.11.1.P M00054647D:E01 1010 22678 5.F17.Beta5_311274 M00057231A:G04 1011 22697 RTA22200001F.c.18.1.P M00042551B:D12 1012 22698 RTA22200009F.c.12.2.P M00042513A:D03 1013 22703 RTA22200001F.c.21.1.P M00042551D:D12 1014 22710 RTA22200009F.h.06.1.P M00042803C:F11 1015 22714 RTA22200009F.h.11.1.P M00042805D:D12 1016 22715 RTA22200001F.i.13.1.P M00042731A:G04 1017 22729 RTA22200011F.b.21.1.P M00056537D:B06 1018 22775 K2.G18.Laf3_325382 RG:417109:10009:D09 1019 22848 RTA22200022F.o.15.1.P M00054995B:F02 1020 22896 RTA22200007F.b.23.1.P M00056151C:A12 1021 22931 ovarian1.C18.amp3_326967 RG:1983997:20002:B09 1022 22979 4.C06.Beta5_310711 M00054744C:B02 1023 23050 RTA22200009F.l.19.2.P M00042845D:A12 1024 23053 RTA22200001F.o.20.1.P M00054800C:H10 1025 23097 2.I17.Beta5_310125 M00056809B:A12 1026 23118 AA595100 RG:1102907:10003:G03 1027 23120 AA640934 RG:1173536:10003:H03 1028 23127 AI027379 RG:1650120:10014:D09 1029 23143 RTA22200018F.j.04.1.P M00043329D:E09 1030 23153 RTA22200018F.p.12.1.P M00043376A:G08 1031 23193 RTA22200012F.c.07.1.P M00056683B:F08 1032 23351 4.G19.Beta5_310923 M00054700C:E02 1033 23407 1562.P22.gz43_208154 M00042570C:H05 1034 23416 RTA22200009F.i.02.2.P M00042811B:A05 1035 23511 2.H20.Beta5_310172 M00042457C:A05 1036 23513 2.J20.Beta5_310174 M00042457C:A05 1037 23514 RTA22200019F.k.01.1.P M00054520A:D04 1038 23542 RTA22200022F.p.04.1.P M00055001A:B01 1039 23544 RTA22200022F.p.07.1.P M00055002B:G06 1040 23637 AI251722 RG:1984571:20002:C10 1041 23678 2.N19.Beta5_310162 M00056964D:C08 1042 23689 4.I08.Beta5_310749 M00054752A:E11 1043 23695 4.O08.Beta5_310755 M00054760D:B10 1044 23743 RTA22200016F.a.11.1.P M00057156D:C12 1045 23755 RTA22200001F.p.18.1.P M00054917B:G02 1046 23758 RTA22200009F.m.16.1.P M00042850D:A06 1047 23765 RTA22200002F.f.19.1.P M00055468D:D05 1048 23770 RTA22200010F.b.10.1.P M00056360A:D09 1049 23772 RTA22200010F.b.11.1.P M00056360A:E07 1050 23776 RTA22200010F.b.17.1.P M00056362D:E05 1051 23784 AI305307 RG:1997021:20003:D04 1052 23798 AI305997 RG:1996788:20003:C10 1053 23813 AI017336 RG:1638979:10014:C04 1054 23816 AA600197 RG:949960:10003:D04 1055 23831 AI027534 RG:1650444:10014:D10 1056 23847 3.G07.Beta5_310347 M00043350A:C04 1057 23875 3.D08.Beta5_310360 M00056646D:G05 1058 23889 RTA22200012F.c.19.1.P M00056688C:E07 1059 24014 1.N09.Beta5_309618 M00056175D:B05 1060 24033 4.A09.Beta5_310757 M00054654A:F12 1061 24034 4.B09.Beta5_310758 M00054868D:F12 1062 24064 4.P21.Beta5_310964 M00054922B:B04 1063 24074 5.J09.Beta5_311150 M00057211D:A03 1064 24094 5.N21.Beta5_311346 M00057253A:C02 1065 24099 RTA22200001F.e.17.1.P M00042573B:A02 1066 24115 RTA22200001F.k.19.1.P M00042885C:A12 1067 24119 RTA22200001F.k.23.1.P M00042886D:H10 1068 24126 RTA22200009F.i.21.2.P M00042818D:A08 1069 24128 RTA22200009F.i.22.2.P M00042819A:C07 1070 24137 RTA22200011F.d.18.1.P M00056553C:E10 1071 24193 2.B10.Beta5_310006 M00057302A:F08 1072 24209 2.B22.Beta5_310198 M00042460B:A08 1073 24213 2.F22.Beta5_310202 M00042516B:A08 1074 24222 3.M22.Beta5_310593 M00054529C:G04 1075 24246 RTA22200023F.a.09.1.P M00055015C:H02 1076 24289 6.A10.Beta5_311541 M00055204B:C04 1077 24315 6.K22.Beta5_311743 M00055254C:E11 1078 24395 4.K10.Beta5_310783 M00054765A:F10 1079 24450 RTA22200009F.m.19.1.P M00042851D:H04 1080 24452 RTA22200009F.m.22.1.P M00042853A:F01 1081 24457 RTA22200002F.a.12.1.P M00055426A:G06 1082 24464 RTA22200009F.n.13.1.P M00042857C:B11 1083 24466 RTA22200010F.c.04.1.P M00056365B:E08 1084 24467 RTA22200002F.h.01.1.P M00055496A:G12 1085 24472 RTA22200010F.c.13.1.P M00056369A:A06 1086 24479 RTA22200002F.i.14.1.P M00055510D:A08 1087 24483 2.C09.Beta5_309991 M00056748C:B08 1088 24485 2.E09.Beta5_309993 M00056749A:F01 1089 24490 AI223486 RG:2002551:20003:E05 1090 24510 AI246847 RG:2007337:20003:G11 1091 24525 AI056508 RG:1669553:10014:G05 1092 24549 3.E09.Beta5_310377 M00043355B:F10 1093 24558 3.N09.Beta5_310386 M00054557C:D09 1094 24559 3.O09.Beta5_310387 M00043358B:G11 1095 24568 3.H21.Beta5_310572 M00054596B:H09 1096 24587 3.L10.Beta5_310400 M00056659A:D08 1097 24595 RTA22200012F.e.05.1.P M00056701B:A11 1098 24672 RTA22200025F.o.13.2.P M00055396C:E08 1099 24708 1.D11.Beta5_309640 M00056180C:E06 1100 24740 RTA22200022F.b.10.1.P M00054876A:H08 1101 24754 4.B23.Beta5_310982 M00054923C:D01 1102 24755 4.C23.Beta5_310983 M00054725A:E09 1103 24762 4.J23.Beta5_310990 M00054927A:H09 1104 24776 5.H11.Beta5_311180 M00057216C:G01 1105 24792 5.H23.Beta5_311372 M00057259B:B08 1106 24805 RTA22200001F.f.13.1.P M00042695D:D09 1107 24810 RTA22200009F.e.15.1.P M00042772D:F02 1108 24897 2.B12.Beta5_310038 M00057310A:A07 1109 24930 RTA22200022F.l.01.1.P M00054961D:E08 1110 24960 RTA22200023F.b.22.1.P M00055027B:C11 1111 24996 6.D12.Beta5_311576 M00056180C:E06 1112 25011 RTA22200024F.o.16.1.P M00055256D:B12 1113 25030 AA230271 RG:1007983:20004:C06 1114 25111 4.G24.Beta5_311003 M00054831A:G04 1115 25156 RTA22200009F.o.01.1.P M00042862D:A12 1116 25158 RTA22200009F.o.01.1.P M00042862D:A12 1117 25177 RTA22200002F.j.02.1.P M00055514B:A05 1118 25191 2.G11.Beta5_310027 M00056763B:A12 1119 25194 AI223471 RG:2002542:20003:E06 1120 25198 AI251083 RG:2007278:20003:G06 1121 25203 2.C23.Beta5_310215 M00056822A:E08 1122 25205 2.E23.Beta5_310217 M00056822C:G03 1123 25209 2.I23.Beta5_310221 M00056823D:H02 1124 25217 AI000585 RG:1609994:10014:A06 1125 25226 AA573799 RG:1012852:10003:E06 1126 25236 AA488335 RG:842978:10003:B12 1127 25246 AA643320 RG:1172262:10003:G12 1128 25248 AA858424 RG:1420940:10003:H12 1129 25252 3.D11.Beta5_310408 M00054558D:A01 1130 25261 RTA22200018F.n.10.1.P M00043363C:C05 1131 25273 RTA22200019F.c.13.1.P M00043407C:A05 1132 25274 RTA22200020F.g.17.1.P M00054621D:F07 1133 25286 RTA22200026F.c.06.1.P M00055413A:G12 1134 25288 RTA22200026F.c.11.1.P M00055414D:A09 1135 25290 RTA22200026F.c.12.1.P M00055414D:E01 1136 25301 3.F24.Beta5_310618 M00056707B:C01 1137 25349 Incyte5.G11.T3pINCY_352982 I:3134070:10A02:D06 1138 25380 Incyt14.F12.T3pINCY_377245 I:2921194:04B02:C06 1139 25384 Incyt14.J12.T3pINCY_377249 I:2671453:04B02:E06 1140 25389 I1.O12.T3pINCY1_343695 I:1728607:04A02:H06 1141 25392 Incyt14.B24.T3pINCY_377433 I:2655513:04B02:A12 1142 25395 I1.E24.T3pINCY1_343877 I:1510349:04A02:C12 1143 25405 I1.O24.T3pINCY1_343887 I:2683114:04A02:H12 1144 25420 1518323 I:1518323:02B02:G06 1145 25472 035JN007.A01.jet718_287634 035JN007.A01 1146 25481 7264.K01.Beta5_496302 035JN005.F01 1147 25482 7264.L01.Beta5_496303 035JN007.F01 1148 25491 7264.E13.Beta5_496488 035JN005.C07 1149 25510 035JN011.D01.jet718_288405 035JN011.D01 1150 25516 035JN011.G01.jet718_288408 035JN011.G01 1151 25519 035JN009.A07.jet718_288066 035JN009.A07 1152 25529 035JN009.F07.jet718_288071 035JN009.F07 1153 25541 035JN013.D01.SP6_315878 035JN013.D01 1154 25545 035JN013.F01.SP6_315880 035JN013.F01 1155 25551 035JN013.A07.SP6_315923 035JN013.A07 1156 25566 7815.P13.Beta5_497376 035JN015.H07 1157 25571 035JN017.C01.SP6_316549 035JN017.C01 1158 25593 035JN017.F07.SP6_316600 035JN017.F07 1159 25596 7559.N13.Beta5_511475 035JN019.G07 1160 25600 035JN023.A01.SP6_317123 035JN023.A01 1161 25601 035JN021.B01.SP6_316932 035JN021.B01 1162 25610 035JN023.F01.SP6_317128 035JN023.F01 1163 25612 035JN023.G01.SP6_317129 035JN023.G01 1164 25617 035JN021.B07.SP6_316980 035JN021.B07 1165 25621 035JN021.D07.SP6_316982 035JN021.D07 1166 25636 035JN027.C01.GZ43_334632 035Jn027.C01 1167 25643 035JN025.G01.GZ43_334444 035JN025.G01 1168 25647 035JN025.A07.GZ43_334486 035JN025.A07 1169 25648 035JN027.A07.GZ43_334678 035Jn027.A07 1170 25656 035JN027.E07.GZ43_334682 035Jn027.E07 1171 25660 035JN027.G07.GZ43_334684 035Jn027.G07 1172 25666 035JN031.B01.GZ43_406194 035Jn031.B01 1173 25668 7947.F01.Beta5_483642 035Jn031.C01 1174 25691 035JN029.G07.GZ43_334972 035JN029.G07 1175 25697 037XN001.B01.sp6_317640 037XN001.B01 1176 25715 037XN001.C07.sp6_317689 037XN001.C07 1177 25731 037XN005.C01.sp6_318121 037XN005.C01 1178 25736 037XN007.E01.sp6_318507 037XN007.E01 1179 25744 037XN007.A07.sp6_318551 037XN007.A07 1180 25745 037XN005.B07.sp6_318168 037XN005.B07 1181 25751 037XN005.E07.sp6_318171 037XN005.E07 1182 25752 037XN007.E07.sp6_318555 037XN007.E07 1183 25812 035JN004.C07.jet718_284263 035JN004.C07 1184 25822 035JN004.H07.jet718_284268 035JN004.H07 1185 25824 7264.B02.Beta5_496309 035JN008.A01 1186 25826 7264.D02.Beta5_496311 035JN008.B01 1187 25834 7264.L02.Beta5_496319 035JN008.F01 1188 25837 7264.O02.Beta5_496322 035JN006.H01 1189 25838 035JN008.H01.jet718_287833 035JN008.H01 1190 25843 7264.E14.Beta5_496504 035JN006.C07 1191 25844 7264.F14.Beta5_496505 035JN008.C07 1192 25849 035JN006.F07.jet718_287495 035JN006.F07 1193 25853 7264.O14.Beta5_496514 035JN006.H07 1194 25864 7569.J02.Beta5_497578 035JN012.E01 1195 25869 7569.O02.Beta5_497583 035JN010.H01 1196 25872 7569.B14.Beta5_497762 035JN012.A07 1197 25876 7569.F14.Beta5_497766 035JN012.C07 1198 25883 7569.M14.Beta5_497773 035JN010.G07 1199 25893 035JN014.D01.SP6_315974 035JN014.D01 1200 25897 7815.K02.Beta5_497195 035JN014.F01 1201 25898 035JN016.F01.SP6_316360 035JN016.F01 1202 25901 7815.O02.Beta5_497199 035JN014.H01 1203 25906 035JN016.B07.SP6_316404 035JN016.B07 1204 25908 035JN016.C07.SP6_316405 035JN016.C07 1205 25915 035JN014.G07.SP6_316025 035JN014.G07 1206 25919 7559.A02.Beta5_511286 035JN018.A01 1207 25920 035JN020.A01.SP6_316835 035JN020.A01 1208 25922 7559.D02.Beta5_511289 035JN020.B01 1209 25927 7559.I02.Beta5_511294 035JN018.E01 1210 25930 035JN020.F01.SP6_316840 035JN020.F01 1211 25931 7559.M02.Beta5_511298 035JN018.G01 1212 25933 7559.O02.Beta5_511300 035JN018.H01 1213 25936 7559.B14.Beta5_511479 035JN020.A07 1214 25938 035JN020.B07.SP6_316884 035JN020.B07 1215 25951 035JN022.A01.SP6_317027 035JN022.A01 1216 25953 035JN022.B01.SP6_317028 035JN022.B01 1217 25956 7852.F02.Beta5_510907 035JN024.C01 1218 25958 035JN024.D01.SP6_317222 035JN024.D01 1219 25960 7852.J02.Beta5_510911 035JN024.E01 1220 25967 035JN022.A07.SP6_317075 035JN022.A07 1221 25973 7852.G14.Beta5_511100 035JN022.D07 1222 25980 035JN024.G07.SP6_317273 035JN024.G07 1223 25983 035JN026.A01.GZ43_334534 035JN026.A01 1224 26000 035JN028.A07.GZ43_334870 035JN028.A07 1225 26001 035JN026.B07.GZ43_334583 035JN026.B07 1226 26009 035JN026.F07.GZ43_334587 035JN026.F07 1227 26010 7926.L14.Beta5_497004 035JN028.F07 1228 26014 035JN028.H07.GZ43_334877 035JN028.H07 1229 26019 035JN030.C01.GZ43_335035 035JN030.C01 1230 26024 035JN032.E01.GZ43_335229 035JN032.E01 1231 26033 035JN030.B07.GZ43_335082 035JN030.B07 1232 26040 035JN032.E07.GZ43_335277 035JN032.E07 1233 26042 035JN032.F07.GZ43_335278 035JN032.F07 1234 26049 037XN002.B01.sp6_317832 037XN002.B01 1235 26058 037XN004.F01.sp6_318028 037XN004.F01 1236 26059 037XN002.G01.sp6_317837 037XN002.G01 1237 26105 037XN006.F07.sp6_318460 037XN006.F07 1238 26109 037XN006.H07.sp6_318462 037XN006.H07 1239 26167 035JN001.E08.jet718_272145 035JN001.E08 1240 26177 035JN005.B02.jet718_284414 035JN005.B02 1241 26179 035JN005.C02.jet718_284415 035JN005.C02 1242 26182 7264.H03.Beta5_496331 035JN007.D02 1243 26187 035JN005.G02.jet718_284419 035JN005.G02 1244 26194 7264.D15.Beta5_496519 035JN007.B08 1245 26196 7264.F15.Beta5_496521 035JN007.C08 1246 26202 7264.L15.Beta5_496527 035JN007.F08 1247 26204 7264.N15.Beta5_496529 035JN007.G08 1248 26205 7264.O15.Beta5_496530 035JN005.H08 1249 26207 7569.A03.Beta5_497585 035JN009.A02 1250 26213 035JN009.D02.jet718_288029 035JN009.D02 1251 26221 7569.O03.Beta5_497599 035JN009.H02 1252 26228 035JN011.C08.jet718_288460 035JN011.C08 1253 26234 035JN011.F08.jet718_288463 035JN011.F08 1254 26238 035JN011.H08.jet718_288465 035JN011.H08 1255 26240 035JN015.A02.SP6_316075 035JN015.A02 1256 26264 035JN015.E08.SP6_316127 035JN015.E08 1257 26266 035JN015.F08.SP6_316128 035JN015.F08 1258 26269 035JN013.H08.SP6_315938 035JN013.H08 1259 26303 7852.A03.Beta5_510918 035JN021.A02 1260 26315 7852.M03.Beta5_510930 035JN021.G02 1261 26318 7852.P03.Beta5_510933 035JN023.H02 1262 26322 035JN023.B08.SP6_317180 035JN023.B08 1263 26329 7852.K15.Beta5_511120 035JN021.F08 1264 26347 035JN025.G02.GZ43_334452 035JN025.G02 1265 26358 035JN027.D08.GZ43_334689 035Jn027.D08 1266 26364 035JN027.G08.GZ43_334692 035Jn027.G08 1267 26365 035JN025.H08.GZ43_334501 035JN025.H08 1268 26369 035JN029.B02.GZ43_334927 035JN029.B02 1269 26371 035JN029.C02.GZ43_334928 035JN029.C02 1270 26378 035JN031.F02.GZ43_406206 035Jn031.F02 1271 26384 035JN031.A08.GZ43_406249 035Jn031.A08 1272 26387 035JN029.C08.GZ43_334976 035JN029.C08 1273 26389 035JN029.D08.GZ43_334977 035JN029.D08 1274 26396 7947.N15.Beta5_483874 035Jn031.G08 1275 26415 037XN001.A08.sp6_317695 037XN001.A08 1276 26422 037XN003.D08.sp6_317986 037XN003.D08 1277 26425 037XN001.F08.sp6_317700 037XN001.F08 1278 26433 037XN005.B02.sp6_318128 037XN005.B02 1279 26496 035JN004.A02.jet718_284221 035JN004.A02 1280 26500 035JN004.C02.jet718_284223 035JN004.C02 1281 26515 035JN002.C08.jet718_283887 035JN002.C08 1282 26517 035JN002.D08.jet718_283888 035JN002.D08 1283 26522 035JN004.F08.jet718_284274 035JN004.F08 1284 26529 7264.C04.Beta5_496342 035JN006.B02 1285 26531 7264.E04.Beta5_496344 035JN006.C02 1286 26542 035JN008.H02.jet718_287841 035JN008.H02 1287 26550 035JN008.D08.jet718_287885 035JN008.D08 1288 26552 035JN008.E08.jet718_287886 035JN008.E08 1289 26555 7264.M16.Beta5_496544 035JN006.G08 1290 26564 035JN012.C02.jet718_288604 035JN012.C02 1291 26565 035JN010.D02.jet718_288221 035JN010.D02 1292 26574 7569.P04.Beta5_497616 035JN012.H02 1293 26579 7569.E16.Beta5_497797 035JN010.C08 1294 26581 7569.G16.Beta5_497799 035JN010.D08 1295 26588 7569.N16.Beta5_497806 035JN012.G08 1296 26590 7569.P16.Beta5_497808 035JN012.H08 1297 26595 035JN014.C02.SP6_315981 035JN014.C02 1298 26604 035JN016.G02.SP6_316369 035JN016.G02 1299 26617 035JN014.F08.SP6_316032 035JN014.F08 1300 26618 035JN016.F08.SP6_316416 035JN016.F08 1301 26632 035JN020.E02.SP6_316847 035JN020.E02 1302 26636 035JN020.G02.SP6_316849 035JN020.G02 1303 26641 035JN018.B08.SP6_316700 035JN018.B08 1304 26643 035JN018.C08.SP6_316701 035JN018.C08 1305 26654 035JN020.H08.SP6_316898 035JN020.H08 1306 26670 7852.P04.Beta5_510949 035JN024.H02 1307 26676 7852.F16.Beta5_511131 035JN024.C08 1308 26690 035JN028.B02.GZ43_334831 035JN028.B02 1309 26691 035JN026.C02.GZ43_334544 035JN026.C02 1310 26694 035JN028.D02.GZ43_334833 035JN028.D02 1311 26696 035JN028.E02.GZ43_334834 035JN028.E02 1312 26714 035JN028.F08.GZ43_334883 035JN028.F08 1313 26719 035JN030.A02.GZ43_335041 035JN030.A02 1314 26723 035JN030.C02.GZ43_335043 035JN030.C02 1315 26732 035JN032.G02.GZ43_335239 035JN032.G02 1316 26741 035JN030.D08.GZ43_335092 035JN030.D08 1317 26742 7947.H16.Beta5_483884 035JN032.D08 1318 26760 037XN004.E02.sp6_318035 037XN004.E02 1319 26765 037XN002.H02.sp6_317846 037XN002.H02 1320 26771 037XN002.C08.sp6_317889 037XN002.C08 1321 26791 037XN006.E02.sp6_318419 037XN006.E02 1322 26801 037XN006.B08.sp6_318464 037XN006.B08 1323 26803 037XN006.C08.sp6_318465 037XN006.C08 1324 26809 037XN006.F08.sp6_318468 037XN006.F08 1325 26882 7264.D05.Beta5_496359 035JN007.B03 1326 26884 7264.F05.Beta5_496361 035JN007.C03 1327 26889 7264.K05.Beta5_496366 035JN005.F03 1328 26895 7264.A17.Beta5_496548 035JN005.A09 1329 26906 7264.L17.Beta5_496559 035JN007.F09 1330 26909 035JN005.H09.jet718_284476 035JN005.H09 1331 26918 035JN011.D03.jet718_288421 035JN011.D03 1332 26922 035JN011.F03.jet718_288423 035JN011.F03 1333 26924 7569.N05.Beta5_497630 035JN011.G03 1334 26939 035JN009.G09.jet718_288088 035JN009.G09 1335 26942 035JN011.H09.jet718_288473 035JN011.H09 1336 26948 035JN015.C03.SP6_316085 035JN015.C03 1337 26953 035JN013.F03.SP6_315896 035JN013.F03 1338 26958 035JN015.H03.SP6_316090 035JN015.H03 1339 26966 035JN015.D09.SP6_316134 035JN015.D09 1340 26970 035JN015.F09.SP6_316136 035JN015.F09 1341 26974 035JN015.H09.SP6_316138 035JN015.H09 1342 26979 7559.E05.Beta5_511338 035JN017.C03 1343 26995 035JN017.C09.SP6_316613 035JN017.C09 1344 27000 035JN019.E09.SP6_316807 035JN019.E09 1345 27012 035JN023.C03.SP6_317141 035JN023.C03 1346 27017 035JN021.F03.SP6_316952 035JN021.F03 1347 27019 035JN021.G03.SP6_316953 035JN021.G03 1348 27037 7852.O17.Beta5_511156 035JN021.H09 1349 27041 035JN025.B03.GZ43_334455 035JN025.B03 1350 27043 035JN025.C03.GZ43_334456 035JN025.C03 1351 27045 035JN025.D03.GZ43_334457 035JN025.D03 1352 27046 035JN027.D03.GZ43_334649 035Jn027.D03 1353 27050 035JN027.F03.GZ43_334651 035Jn027.F03 1354 27061 035JN025.D09.GZ43_334505 035JN025.D09 1355 27070 035JN027.H09.GZ43_334701 035Jn027.H09 1356 27083 035JN029.G03.GZ43_334940 035JN029.G03 1357 27089 035JN029.B09.GZ43_334983 035JN029.B09 1358 27091 035JN029.C09.GZ43_334984 035JN029.C09 1359 27093 035JN029.D09.GZ43_334985 035JN029.D09 1360 27095 035JN029.E09.GZ43_334986 035JN029.E09 1361 27096 035JN031.E09.GZ43_406261 035Jn031.E09 1362 27098 7947.L17.Beta5_483904 035Jn031.F09 1363 27109 037XN001.D03.sp6_317658 037XN001.D03 1364 27113 037XN001.F03.sp6_317660 037XN001.F03 1365 27114 037XN003.F03.sp6_317948 037XN003.F03 1366 27123 037XN001.C09.sp6_317705 037XN001.C09 1367 27133 037XN001.H09.sp6_317710 037XN001.H09 1368 27148 037XN007.G03.sp6_318525 037XN007.G03 1369 27158 037XN007.D09.sp6_318570 037XN007.D09 1370 27205 035JN002.D03.jet718_283848 035JN002.D03 1371 27221 035JN002.D09.jet718_283896 035JN002.D09 1372 27244 035JN008.G03.jet718_287848 035JN008.G03 1373 27249 035JN006.B09.jet718_287507 035JN006.B09 1374 27268 7569.F06.Beta5_497638 035JN012.C03 1375 27269 7569.G06.Beta5_497639 035JN010.D03 1376 27275 7569.M06.Beta5_497645 035JN010.G03 1377 27298 035JN016.B03.SP6_316372 035JN016.B03 1378 27306 035JN016.F03.SP6_316376 035JN016.F03 1379 27316 7815.F18.Beta5_497446 035JN016.C09 1380 27318 035JN016.D09.SP6_316422 035JN016.D09 1381 27323 035JN014.G09.SP6_316041 035JN014.G09 1382 27331 035JN018.C03.SP6_316661 035JN018.C03 1383 27336 035JN020.E03.SP6_316855 035JN020.E03 1384 27344 035JN020.A09.SP6_316899 035JN020.A09 1385 27350 035JN020.D09.SP6_316902 035JN020.D09 1386 27366 035JN024.D03.SP6_317238 035JN024.D03 1387 27368 035JN024.E03.SP6_317239 035JN024.E03 1388 27369 035JN022.F03.SP6_317048 035JN022.F03 1389 27378 035JN024.B09.SP6_317284 035JN024.B09 1390 27386 035JN024.F09.SP6_317288 035JN024.F09 1391 27389 7852.O18.Beta5_511172 035JN022.H09 1392 27406 035JN028.H03.GZ43_334845 035JN028.H03 1393 27427 035JN030.C03.GZ43_335051 035JN030.C03 1394 27431 035JN030.E03.GZ43_335053 035JN030.E03 1395 27433 035JN030.F03.GZ43_335054 035JN030.F03 1396 27435 035JN030.G03.GZ43_335055 035JN030.G03 1397 27450 035JN032.F09.GZ43_335294 035JN032.F09 1398 27451 035JN030.G09.GZ43_335103 035JN030.G09 1399 27453 035JN030.H09.GZ43_335104 035JN030.H09 1400 27517 037XN006.H09.sp6_318478 037XN006.H09 1401 27574 035JN003.D10.jet718_284096 035JN003.D10 1402 27576 035JN003.E10.jet718_284097 035JN003.E10 1403 27581 035JN001.H10.jet718_272164 035JN001.H10 1404 27586 7264.D07.Beta5_496391 035JN007.B04 1405 27599 035JN005.A10.jet718_284477 035JN005.A10 1406 27603 7264.E19.Beta5_496584 035JN005.C10 1407 27612 035JN007.G10.jet718_287712 035JN007.G10 1408 27616 035JN011.A04.jet718_288426 035JN011.A04 1409 27634 035JN011.B10.jet718_288475 035JN011.B10 1410 27640 035JN011.E10.jet718_288478 035JN011.E10 1411 27654 035JN015.D04.SP6_316094 035JN015.D04 1412 27666 035JN015.B10.SP6_316140 035JN015.B10 1413 27674 7815.L19.Beta5_497468 035JN015.F10 1414 27676 7815.N19.Beta5_497470 035JN015.G10 1415 27677 035JN013.H10.SP6_315954 035JN013.H10 1416 27699 7559.E19.Beta5_511562 035JN017.C10 1417 27705 035JN017.F10.SP6_316624 035JN017.F10 1418 27719 035JN021.E04.SP6_316959 035JN021.E04 1419 27721 035JN021.F04.SP6_316960 035JN021.F04 1420 27722 035JN023.F04.SP6_317152 035JN023.F04 1421 27726 035JN023.H04.SP6_317154 035JN023.H04 1422 27732 035JN023.C10.SP6_317197 035JN023.C10 1423 27735 035JN021.E10.SP6_317007 035JN021.E10 1424 27752 035JN027.E04.GZ43_334658 035Jn027.E04 1425 27753 035JN025.F04.GZ43_334467 035JN025.F04 1426 27754 035JN027.F04.GZ43_334659 035Jn027.F04 1427 27767 035JN025.E10.GZ43_334514 035JN025.E10 1428 27773 035JN025.H10.GZ43_334517 035JN025.H10 1429 27793 035JN029.B10.GZ43_334991 035JN029.B10 1430 27794 7947.D19.Beta5_483928 035Jn031.B10 1431 27799 035JN029.E10.GZ43_334994 035JN029.E10 1432 27801 035JN029.F10.GZ43_334995 035JN029.F10 1433 27831 037XN001.E10.sp6_317715 037XN001.E10 1434 27919 035JN002.A10.jet718_283901 035JN002.A10 1435 27932 035JN004.G10.jet718_284291 035JN004.G10 1436 27935 7264.A08.Beta5_496404 035JN006.A04 1437 27939 7264.E08.Beta5_496408 035JN006.C04 1438 27943 035JN006.E04.jet718_287470 035JN006.E04 1439 27948 035JN008.G04.jet718_287856 035JN008.G04 1440 27952 035JN008.A10.jet718_287898 035JN008.A10 1441 27979 7569.M08.Beta5_497677 035JN010.G04 1442 27984 035JN012.A10.jet718_288666 035JN012.A10 1443 27990 7569.H20.Beta5_497864 035JN012.D10 1444 27992 035JN012.E10.jet718_288670 035JN012.E10 1445 28002 035JN016.B04.SP6_316380 035JN016.B04 1446 28021 035JN014.D10.SP6_316046 035JN014.D10 1447 28040 035JN020.E04.SP6_316863 035JN020.E04 1448 28048 7559.B20.Beta5_511575 035JN020.A10 1449 28076 035JN024.G04.SP6_317249 035JN024.G04 1450 28085 035JN022.D10.SP6_317102 035JN022.D10 1451 28106 7926.L08.Beta5_496908 035JN028.F04 1452 28108 035JN028.G04.GZ43_334852 035JN028.G04 1453 28115 7926.E20.Beta5_497093 035JN026.C10 1454 28116 035JN028.C10.GZ43_334896 035JN028.C10 1455 28122 035JN028.F10.GZ43_334899 035JN028.F10 1456 28125 035JN026.H10.GZ43_334613 035JN026.H10 1457 28130 035JN032.B04.GZ43_335250 035JN032.B04 1458 28138 035JN032.F04.GZ43_335254 035JN032.F04 1459 28139 035JN030.G04.GZ43_335063 035JN030.G04 1460 28147 035JN030.C10.GZ43_335107 035JN030.C10 1461 28167 037XN002.E04.sp6_317859 037XN002.E04 1462 28189 037XN002.H10.sp6_317910 037XN002.H10 1463 28213 037XN006.D10.sp6_318482 037XN006.D10 1464 28215 037XN006.E10.sp6_318483 037XN006.E10 1465 28219 037XN006.G10.sp6_318485 037XN006.G10 1466 28222 037XN008.H10.sp6_318678 037XN008.H10 1467 28284 035JN003.G11.jet718_284107 035JN003.G11 1468 28289 035JN005.B05.jet718_284438 035JN005.B05 1469 28290 7264.D09.Beta5_496423 035JN007.B05 1470 28291 035JN005.C05.jet718_284439 035JN005.C05 1471 28292 7264.F09.Beta5_496425 035JN007.C05 1472 28299 7264.M09.Beta5_496432 035JN005.G05 1473 28325 035JN009.D05.jet718_288053 035JN009.D05 1474 28330 7569.L09.Beta5_497692 035JN011.F05 1475 28341 035JN009.D11.jet718_288101 035JN009.D11 1476 28382 7815.P21.Beta5_497504 035JN015.H11 1477 28384 7559.B09.Beta5_511399 035JN019.A05 1478 28397 035JN017.H05.SP6_316586 035JN017.H05 1479 28399 7559.A21.Beta5_511590 035JN017.A11 1480 28409 035JN017.F11.SP6_316632 035JN017.F11 1481 28413 035JN017.H11.SP6_316634 035JN017.H11 1482 28416 035JN023.A05.SP6_317155 035JN023.A05 1483 28437 7852.G21.Beta5_511212 035JN021.D11 1484 28439 035JN021.E11.SP6_317015 035JN021.E11 1485 28444 7852.N21.Beta5_511219 035JN023.G11 1486 28469 035JN025.D11.GZ43_334521 035JN025.D11 1487 28475 7926.M21.Beta5_497117 035JN025.G11 1488 28485 035JN029.D05.GZ43_334953 035JN029.D05 1489 28492 7947.N09.Beta5_483778 035Jn031.G05 1490 28503 035JN029.E11.GZ43_335002 035JN029.E11 1491 28506 7947.L21.Beta5_483968 035Jn031.F11 1492 28507 035JN029.G11.GZ43_335004 035JN029.G11 1493 28523 037XN001.G05.sp6_317677 037XN001.G05 1494 28546 037XN007.B05.sp6_318536 037XN007.B05 1495 28562 037XN007.B11.sp6_318584 037XN007.B11 1496 28569 037XN005.F11.sp6_318204 037XN005.F11 1497 28607 035JN002.A05.jet718_283861 035JN002.A05 1498 28608 035JN004.A05.jet718_284245 035JN004.A05 1499 28615 035JN002.E05.jet718_283865 035JN002.E05 1500 28625 035JN002.B11.jet718_283910 035JN002.B11 1501 28629 035JN002.D11.jet718_283912 035JN002.D11 1502 28631 035JN002.E11.jet718_283913 035JN002.E11 1503 28632 035JN004.E11.jet718_284297 035JN004.E11 1504 28650 035JN008.F05.jet718_287863 035JN008.F05 1505 28669 035JN006.H11.jet718_287529 035JN006.H11 1506 28670 035JN008.H11.jet718_287913 035JN008.H11 1507 28683 035JN010.G05.jet718_288248 035JN010.G05 1508 28693 035JN010.D11.jet718_288293 035JN010.D11 1509 28696 035JN012.E11.jet718_288678 035JN012.E11 1510 28706 035JN016.B05.SP6_316388 035JN016.B05 1511 28737 035JN018.B05.SP6_316676 035JN018.B05 1512 28738 7559.D10.Beta5_511417 035JN020.B05 1513 28743 035JN018.E05.SP6_316679 035JN018.E05 1514 28754 7559.D22.Beta5_511609 035JN020.B11 1515 28773 035JN022.D05.SP6_317062 035JN022.D05 1516 28774 7852.H10.Beta5_511037 035JN024.D05 1517 28787 7852.E22.Beta5_511226 035JN022.C11 1518 28799 035JN026.A05.GZ43_334566 035JN026.A05 1519 28800 035JN028.A05.GZ43_334854 035JN028.A05 1520 28802 035JN028.B05.GZ43_334855 035JN028.B05 1521 28813 035JN026.H05.GZ43_334573 035JN026.H05 1522 28827 035JN026.G11.GZ43_334620 035JN026.G11 1523 28829 035JN026.H11.GZ43_334621 035JN026.H11 1524 28830 035JN028.H11.GZ43_334909 035JN028.H11 1525 28838 035JN032.D05.GZ43_335260 035JN032.D05 1526 28840 035JN032.E05.GZ43_335261 035JN032.E05 1527 28842 035JN032.F05.GZ43_335262 035JN032.F05 1528 28847 035JN030.A11.GZ43_335113 035JN030.A11 1529 28849 035JN030.B11.GZ43_335114 035JN030.B11 1530 28853 035JN030.D11.GZ43_335116 035JN030.D11 1531 28858 035JN032.F11.GZ43_335310 035JN032.F11 1532 28863 037XN002.A05.sp6_317863 037XN002.A05 1533 28881 037XN002.B11.sp6_317912 037XN002.B11 1534 28890 037XN004.F11.sp6_318108 037XN004.F11 1535 28899 037XN006.C05.sp6_318441 037XN006.C05 1536 28911 037XN006.A11.sp6_318487 037XN006.A11 1537 28961 035JN001.B06.jet718_272126 035JN001.B06 1538 28996 035JN007.C06.jet718_287676 035JN007.C06 1539 28997 7264.G11.Beta5_496458 035JN005.D06 1540 29000 7264.J11.Beta5_496461 035JN007.E06 1541 29002 7264.L11.Beta5_496463 035JN007.F06 1542 29016 7264.J23.Beta5_496653 035JN007.E12 1543 29022 035JN007.H12.jet718_287729 035JN007.H12 1544 29023 035JN009.A06.jet718_288058 035JN009.A06 1545 29025 7569.C11.Beta5_497715 035JN009.B06 1546 29027 7569.E11.Beta5_497717 035JN009.C06 1547 29038 035JN011.H06.jet718_288449 035JN011.H06 1548 29044 7569.F23.Beta5_497910 035JN011.C12 1549 29057 035JN013.B06.SP6_315916 035JN013.B06 1550 29064 7815.J11.Beta5_497338 035JN015.E06 1551 29065 035JN013.F06.SP6_315920 035JN013.F06 1552 29067 035JN013.G06.SP6_315921 035JN013.G06 1553 29081 035JN013.F12.SP6_315968 035JN013.F12 1554 29105 035JN017.B12.SP6_316636 035JN017.B12 1555 29119 035JN021.A06.SP6_316971 035JN021.A06 1556 29122 035JN023.B06.SP6_317164 035JN023.B06 1557 29124 7852.F11.Beta5_511051 035JN023.C06 1558 29129 035JN021.F06.SP6_316976 035JN021.F06 1559 29142 7852.H23.Beta5_511245 035JN023.D12 1560 29145 7852.K23.Beta5_511248 035JN021.F12 1561 29147 035JN021.G12.SP6_317025 035JN021.G12 1562 29158 035JN027.D06.GZ43_334673 035Jn027.D06 1563 29191 035JN029.E06.GZ43_334962 035JN029.E06 1564 29194 7947.L11.Beta5_483808 035Jn031.F06 1565 29204 7947.F23.Beta5_483994 035Jn031.C12 1566 29219 037XN001.C06.sp6_317681 037XN001.C06 1567 29221 037XN001.D06.sp6_317682 037XN001.D06 1568 29224 037XN003.E06.sp6_317971 037XN003.E06 1569 29235 037XN001.C12.sp6_317729 037XN001.C12 1570 29245 037XN001.H12.sp6_317734 037XN001.H12 1571 29267 037XN005.C12.sp6_318209 037XN005.C12 1572 29327 035JN002.A12.jet718_283917 035JN002.A12 1573 29341 035JN002.H12.jet718_283924 035JN002.H12 1574 29348 035JN008.C06.jet718_287868 035JN008.C06 1575 29349 7264.G12.Beta5_496474 035JN006.D06 1576 29350 035JN008.D06.jet718_287869 035JN008.D06 1577 29352 035JN008.E06.jet718_287870 035JN008.E06 1578 29356 035JN008.G06.jet718_287872 035JN008.G06 1579 29361 7264.C24.Beta5_496662 035JN006.B12 1580 29362 035JN008.B12.jet718_287915 035JN008.B12 1581 29369 7264.K24.Beta5_496670 035JN006.F12 1582 29370 035JN008.F12.jet718_287919 035JN008.F12 1583 29378 7569.D12.Beta5_497732 035JN012.B06 1584 29383 7569.I12.Beta5_497737 035JN010.E06 1585 29386 035JN012.F06.jet718_288639 035JN012.F06 1586 29388 035JN012.G06.jet718_288640 035JN012.G06 1587 29395 7569.E24.Beta5_497925 035JN010.C12 1588 29421 035JN014.H06.SP6_316018 035JN014.H06 1589 29427 7815.E24.Beta5_497541 035JN014.C12 1590 29442 035JN020.B06.SP6_316876 035JN020.B06 1591 29444 035JN020.C06.SP6_316877 035JN020.C06 1592 29454 7559.P12.Beta5_511461 035JN020.H06 1593 29474 035JN024.B06.SP6_317260 035JN024.B06 1594 29476 7852.F12.Beta5_511067 035JN024.C06 1595 29481 035JN022.F06.SP6_317072 035JN022.F06 1596 29490 035JN024.B12.SP6_317308 035JN024.B12 1597 29493 7852.G24.Beta5_511260 035JN022.D12 1598 29496 035JN024.E12.SP6_317311 035JN024.E12 1599 29498 7852.L24.Beta5_511265 035JN024.F12 1600 29502 7852.P24.Beta5_511269 035JN024.H12 1601 29516 035JN028.G06.GZ43_334868 035JN028.G06 1602 29529 035JN026.F12.GZ43_334627 035JN026.F12 1603 29534 035JN028.H12.GZ43_334917 035JN028.H12 1604 29535 035JN030.A06.GZ43_335073 035JN030.A06 1605 29540 035JN032.C06.GZ43_335267 035JN032.C06 1606 29544 035JN032.E06.GZ43_335269 035JN032.E06 1607 29547 035JN030.G06.GZ43_335079 035JN030.G06 1608 29548 035JN032.G06.GZ43_335271 035JN032.G06 1609 29553 035JN030.B12.GZ43_335122 035JN030.B12 1610 29557 7947.G24.Beta5_484011 035JN030.D12 1611 29573 037XN002.D06.sp6_317874 037XN002.D06 1612 29619 037XN006.C12.sp6_318497 037XN006.C12 1613 29621 037XN006.D12.sp6_318498 037XN006.D12 1614 29652 016923 M00001610C:D05 1615 29668 538.C01.BETA5_582849 1TNT051800C01 1616 29678 538.H01.BETA5_582854 1TNT051800H01 1617 29684 1TNT051800.C07.GZ43_421387 1TNT051800C07 1618 29690 538.F07.BETA5_582900 1TNT051800F07 1619 29691 5383.F07.T3_583092 3TNT052200F07 1620 29702 539.G01.Laf3_581001 RG:2169096:8119907:D01 1621 29704 AI656423 RG:2244263:8119907:E01 1622 29706 AI632432 RG:2305132:8119907:F01 1623 29708 539.M01.Laf3_581007 RG:2330779:8119907:G01 1624 29710 539.O01.Laf3_581009 RG:2343699:8119907:H01 1625 29716 539.E13.Laf3_581191 RG:2162304:8119907:C07 1626 29724 AI693174 RG:2336749:8119907:G07 1627 29754 518.K13.laf3_548279 RG:233016:12039905:F07 1628 29757 AI347985 RG:1926969:12039908:G07 1629 29771 519.L01.laf3_548472 RG:267235:Order7TM21:F01 1630 29796 N94487 RG:309893:Order7TM23:C01 1631 29805 520.N01.laf3_558990 RG:2370175:OrderK03:G01 1632 29808 N95025 RG:306549:Order7TM23:A07 1633 29814 520.G13.laf3_559175 RG:323370:Order7TM23:D07 1634 29834 521.K01.laf3_559371 RG:46429:Order7TM02:F01 1635 29846 521.G13.laf3_559559 RG:43428:Order7TM02:D07 1636 29859 522.D01.laf3_559748 RG:469703:Order7TM27:B01 1637 29870 522.O01.laf3_559759 RG:450056:Order7TM26:H01 1638 29880 AA203687 RG:446190:Order7TM26:E07 1639 29886 AA700861 RG:452343:Order7TM26:H07 1640 29888 523.A01.laf3_560129 RG:725230:Order7TM31:A01 1641 29891 523.D01.laf3_560132 RG:1160829:Order7TM33:B01 1642 29907 523.D13.laf3_560324 RG:1161304:Order7TM33:B07 1643 29957 525.F01.laf3_560902 RG:2149250:Order7TM41:C01 1644 29966 AA937194 RG:1507689:Order7TM37:H01 1645 29987 AI270150 RG:1985920:20003:B01 1646 29997 AI250101 RG:2006710:20003:G01 1647 30013 AI251081 RG:2007272:20003:G07 1648 30016 5382.A01.BETA5_582943 2TNT052200A01 1649 30022 5382.D01.BETA5_582946 2TNT052200D01 1650 30024 5382.E01.BETA5_582947 2TNT052200E01 1651 30027 PL4B052400.A04.GZ43_421705 PL4B052400A04 1652 30043 PL4B052400.G04.GZ43_421711 PL4B052400G04 1653 30047 PL4B052400.G07.GZ43_421735 PL4B052400G07 1654 30073 539.J14.Laf3_581212 RG:326321:OrderK01:E07 1655 30080 518.A02.laf3_548093 RG:342025:12039906:A01 1656 30092 518.M02.laf3_548105 RG:704530:12039906:G01 1657 30094 AA625677 RG:744852:12039906:H01 1658 30095 518.P02.laf3_548108 RG:1486908:Order7TM11:H01 1659 30097 AA643303 RG:1172246:Order7TM11:A07 1660 30099 AA657977 RG:1174569:Order7TM11:B07 1661 30114 519.C02.laf3_548479 RG:200526:Order7TM20:B01 1662 30120 519.I02.laf3_548485 RG:219754:Order7TM20:E01 1663 30137 W05177 RG:295191:Order7TM22:E07 1664 30156 AA016156 RG:360639:Order7TM24:G01 1665 30205 521.N14.laf3_559582 RG:152346:Order7TM17:G07 1666 30231 522.H14.laf3_559960 RG:712130:Order7TM30:D07 1667 30232 AA059350 RG:381856:Order7TM25:E07 1668 30241 AA741244 RG:1286112:Order7TM34:A01 1669 30248 AA465303 RG:814153:Order7TM32:E01 1670 30274 524.C02.laf3_560531 RG:1387330:Order7TM36:B01 1671 30282 524.K02.laf3_560539 RG:1408000:Order7TM36:F01 1672 30303 524.P14.laf3_560736 RG:1569511:Order7TM38:H07 1673 30329 525.J14.laf3_561114 RG:2393918:Order7TM42:E07 1674 30372 538.C02.BETA5_582857 1TNT051800C02 1675 30374 1TNT051800.D02.GZ43_421348 1TNT051800D02 1676 30377 3TNT052200.E02.T3_421561 3TNT052200E02 1677 30380 1TNT051800.G02.GZ43_421351 1TNT051800G02 1678 30394 1TNT051800.F08.GZ43_421398 1TNT051800F08 1679 30397 3TNT052200.G08.T3_421611 3TNT052200G08 1680 30420 539.E15.Laf3_581223 RG:2166404:8119907:C08 1681 30457 AI143947 RG:1737690:12039908:E08 1682 30462 518.O15.laf3_548315 RG:322130:12039905:H08 1683 30463 518.P15.laf3_548316 RG:2114092:12039908:H08 1684 30472 519.I03.laf3_548501 RG:182411:Order7TM19:E02 1685 30486 519.G15.laf3_548691 RG:180757:Order7TM19:D08 1686 30489 N26748 RG:266375:Order7TM21:E08 1687 30492 519.M15.laf3_548697 RG:188269:Order7TM19:G08 1688 30510 520.O03.laf3_559023 RG:342337:Order7TM23:H02 1689 30538 521.K03.laf3_559403 RG:46640:Order7TM02:F02 1690 30541 521.N03.laf3_559406 RG:128956:Order7TM16:G02 1691 30546 521.C15.laf3_559587 RG:41160:Order7TM02:B08 1692 30569 AA125857 RG:490269:Order7TM27:E02 1693 30579 AA031460 RG:470675:Order7TM27:B08 1694 30597 523.F03.laf3_560166 RG:1185595:Order7TM33:C02 1695 30603 AA746602 RG:1256454:Order7TM33:F02 1696 30606 523.O03.laf3_560175 RG:739884:Order7TM31:H02 1697 30617 AA731737 RG:1251980:Order7TM33:E08 1698 30641 524.B15.laf3_560738 RG:1584415:Order7TM39:A08 1699 30660 525.E03.laf3_560933 RG:1468027:Order7TM37:C02 1700 30662 525.G03.laf3_560935 RG:1470342:Order7TM37:D02 1701 30685 AI688238 RG:2326234:Order7TM41:G08 1702 30690 R28103 RG:133909:OrderP01:B02 1703 30708 H85938 RG:222589:OrderP01:C08 1704 30715 AI279390 RG:2006302:20003:F08 1705 30720 2TNT052200.A02.GZ43_421441 2TNT052200A02 1706 30722 2TNT052200.B02.GZ43_421442 2TNT052200B02 1707 30723 5384.B02.T3_583144 4ATNT052400F02 1708 30725 5384.C02.T3_583145 4ATNT052400B04 1709 30728 5382.E02.BETA5_582955 2TNT052200E02 1710 30731 PL4B052400.B04.GZ43_421706 PL4B052400B04 1711 30787 518.D04.laf3_548128 RG:1173695:Order7TM11:B02 1712 30789 AA650509 RG:1191849:Order7TM11:C02 1713 30795 518.L04.laf3_548136 RG:1420834:Order7TM11:F02 1714 30796 518.M04.laf3_548137 RG:713079:12039906:G02 1715 30798 AA625800 RG:744928:12039906:H02 1716 30803 AA827000 RG:1174978:Order7TM11:B08 1717 30818 519.C04.laf3_548511 RG:200526:Order7TM20:B02 1718 30819 519.D04.laf3_548512 RG:279704:Order7TM22:B02 1719 30825 519.J04.laf3_548518 RG:293781:Order7TM22:E02 1720 30831 519.P04.laf3_548524 RG:301734:Order7TM22:H02 1721 30836 H48592 RG:207207:Order7TM20:C08 1722 30840 519.I16.laf3_548709 RG:221499:Order7TM20:E08 1723 30841 519.J16.laf3_548710 RG:295687:Order7TM22:E08 1724 30852 W72005 RG:345670:Order7TM24:C02 1725 30853 520.F04.laf3_559030 RG:25631:Order7TM01:C02 1726 30860 AA015780 RG:360663:Order7TM24:G02 1727 30881 521.B04.laf3_559410 RG:136866:Order7TM17:A02 1728 30898 521.C16.laf3_559603 RG:155253:Order7TM18:B08 1729 30905 521.J16.laf3_559610 RG:147116:Order7TM17:E08 1730 30906 521.K16.laf3_559611 RG:163644:Order7TM18:F08 1731 30908 521.M16.laf3_559613 RG:166144:Order7TM18:G08 1732 30910 H18391 RG:171738:Order7TM18:H08 1733 30914 AA032228 RG:375685:Order7TM25:B02 1734 30925 522.N04.laf3_559806 RG:714002:Order7TM30:G02 1735 30934 522.G16.laf3_559991 RG:380369:Order7TM25:D08 1736 30938 AA709067 RG:384795:Order7TM25:F08 1737 30940 522.M16.laf3_559997 RG:397720:Order7TM25:G08 1738 30943 522.P16.laf3_560000 RG:724677:Order7TM30:H08 1739 30963 523.D16.laf3_560372 RG:1290416:Order7TM34:B08 1740 30988 AA846062 RG:1414105:Order7TM36:G02 1741 30999 524.H16.laf3_560760 RG:1541688:Order7TM38:D08 1742 31004 524.M16.laf3_560765 RG:1415237:Order7TM36:G08 1743 31006 524.O16.laf3_560767 RG:1455902:Order7TM36:H08 1744 31007 524.P16.laf3_560768 RG:1570363:Order7TM38:H08 1745 31013 525.F04.laf3_560950 RG:2362806:Order7TM42:C02 1746 31016 525.I04.laf3_560953 RG:1939313:Order7TM40:E02 1747 31044 526.E04.laf3_561333 RG:1369150:OrderP02:C02 1748 31048 526.I04.laf3_561337 RG:1750632:OrderP02:E02 1749 31076 538.C03.BETA5_582865 1TNT051800C03 1750 31080 1TNT051800.E03.GZ43_421357 1TNT051800E03 1751 31085 5383.G03.T3_583061 3TNT052200G03 1752 31091 5383.B09.T3_583104 3TNT052200B09 1753 31092 1TNT051800.C09.GZ43_421403 1TNT051800C09 1754 31094 538.D09.BETA5_582914 1TNT051800D09 1755 31098 538.F09.BETA5_582916 1TNT051800F09 1756 31100 538.G09.BETA5_582917 1TNT051800G09 1757 31105 539.B05.Laf3_581060 RG:796055:12039907:A03 1758 31107 539.D05.Laf3_581062 RG:986456:12039907:B03 1759 31123 AA639504 RG:1159614:12039907:B09 1760 31127 AA844912 RG:1411982:12039907:D09 1761 31130 AI676053 RG:2314226:8119907:F09 1762 31149 518.N05.laf3_548154 RG:1902348:12039908:G03 1763 31159 AA996029 RG:1606839:12039908:D09 1764 31187 519.D17.laf3_548720 RG:252455:Order7TM21:B09 1765 31192 H44426 RG:183706:Order7TM19:E09 1766 31195 519.L17.laf3_548728 RG:269238:Order7TM21:F09 1767 31232 521.A05.laf3_559425 RG:38689:Order7TM02:A03 1768 31282 522.C17.laf3_560003 RG:417746:Order7TM26:B09 1769 31286 522.G17.laf3_560007 RG:435378:Order7TM26:D09 1770 31296 523.A05.laf3_560193 RG:725269:Order7TM31:A03 1771 31299 523.D05.laf3_560196 RG:1160942:Order7TM33:B03 1772 31300 523.E05.laf3_560197 RG:726119:Order7TM31:C03 1773 31303 AA652642 RG:1188375:Order7TM33:D03 1774 31309 523.N05.laf3_560206 RG:1270265:Order7TM33:G03 1775 31312 523.A17.laf3_560385 RG:725415:Order7TM31:A09 1776 31314 AA292293 RG:725865:Order7TM31:B09 1777 31335 AI051307 RG:1657255:Order7TM39:D03 1778 31337 AI076453 RG:1675585:Order7TM39:E03 1779 31351 524.H17.laf3_560776 RG:1667691:Order7TM39:D09 1780 31361 525.B05.laf3_560962 RG:2115059:Order7TM41:A03 1781 31367 AI623315 RG:2237582:Order7TM41:D03 1782 31369 AI659657 RG:2252059:Order7TM41:E03 1783 31389 525.N17.laf3_561166 RG:2327992:Order7TM41:G09 1784 31393 AI733957 RG:1985759:20003:A03 1785 31399 AI305310 RG:1997027:20003:D03 1786 31408 526.A17.laf3_561537 RG:126566:OrderP01:A09 1787 31410 R87386 RG:166034:OrderP01:B09 1788 31419 AI265909 RG:2006498:20003:F09 1789 31426 5382.B03.BETA5_582960 2TNT052200B03 1790 31435 PL4B052400.C04.GZ43_421707 PL4B052400C04 1791 31444 5382.C09.BETA5_583009 2TNT052200C09 1792 31447 PL4B052400.A02.GZ43_421689 PL4B052400A02 1793 31449 PL4B052400.E03.GZ43_421701 PL4B052400E03 1794 31451 PL4B052400.A05.GZ43_421713 PL4B052400A05 1795 31499 AA858353 RG:1420889:Order7TM11:F03 1796 31512 518.I18.laf3_548357 RG:1675510:12039906:E09 1797 31515 518.L18.laf3_548360 RG:1422884:Order7TM11:F09 1798 31526 H68010 RG:211252:Order7TM20:D03 1799 31535 519.P06.laf3_548556 RG:301871:Order7TM22:H03 1800 31538 519.C18.laf3_548735 RG:202264:Order7TM20:B09 1801 31549 519.N18.laf3_548746 RG:301416:Order7TM22:G09 1802 31554 520.C06.laf3_559059 RG:344661:Order7TM24:B03 1803 31572 520.E18.laf3_559253 RG:346417:Order7TM24:C09 1804 31601 521.B18.laf3_559634 RG:139207:Order7TM17:A09 1805 31629 522.N06.laf3_559838 RG:714036:Order7TM30:G03 1806 31640 522.I18.laf3_560025 RG:381998:Order7TM25:E09 1807 31647 522.P18.laf3_560032 RG:724738:Order7TM30:H09 1808 31663 523.P06.laf3_560224 RG:1323963:Order7TM34:H03 1809 31702 524.G18.laf3_560791 RG:1404328:Order7TM36:D09 1810 31708 524.M18.laf3_560797 RG:1415437:Order7TM36:G09 1811 31729 525.B18.laf3_561170 RG:2350539:Order7TM42:A09 1812 31739 AI858001 RG:2408051:Order7TM42:F09 1813 31748 526.E06.laf3_561365 RG:1408115:OrderP02:C03 1814 31763 AI251231 RG:1983997:20002:B09 1815 31780 538.C04.BETA5_582873 1TNT051800C04 1816 31782 1TNT051800.D04.GZ43_421364 1TNT051800D04 1817 31786 538.F04.BETA5_582876 1TNT051800F04 1818 31787 5383.F04.T3_583068 3TNT052200F04 1819 31788 1TNT051800.G04.GZ43_421367 1TNT051800G04 1820 31796 538.C10.BETA5_582921 1TNT051800C10 1821 31799 5383.D10.T3_583114 3TNT052200D10 1822 31804 1TNT051800.G10.GZ43_421415 1TNT051800G10 1823 31805 3TNT052200.G10.T3_421627 3TNT052200G10 1824 31813 539.F07.Laf3_581096 RG:1269319:12039907:C04 1825 31850 518.K07.laf3_548183 RG:230376:12039905:F04 1826 31856 T85544 RG:114712:12039905:A10 1827 31862 518.G19.laf3_548371 RG:195021:12039905:D10 1828 31865 AI148954 RG:1752672:12039908:E10 1829 31869 518.N19.laf3_548378 RG:2028487:12039908:G10 1830 31871 518.P19.laf3_548380 RG:2124370:12039908:H10 1831 31886 H39120 RG:192444:Order7TM19:H04 1832 31887 519.P07.laf3_548572 RG:273979:Order7TM21:H04 1833 31928 520.I19.laf3_559273 RG:324794:Order7TM23:E10 1834 31952 521.A19.laf3_559649 RG:39899:Order7TM02:A10 1835 31965 R25637 RG:132735:Order7TM16:G10 1836 31997 522.N19.laf3_560046 RG:504638:Order7TM27:G10 1837 32006 523.G07.laf3_560231 RG:726383:Order7TM31:D04 1838 32007 523.H07.laf3_560232 RG:1188503:Order7TM33:D04 1839 32023 523.H19.laf3_560424 RG:1218621:Order7TM33:D10 1840 32043 AI092466 RG:1692984:Order7TM39:F04 1841 32062 AA836494 RG:1370254:Order7TM35:H10 1842 32065 525.B07.laf3_560994 RG:2115148:Order7TM41:A04 1843 32068 AA884832 RG:1468143:Order7TM37:C04 1844 32082 525.C19.laf3_561187 RG:1466558:Order7TM37:B10 1845 32097 AI734002 RG:1985794:20003:A04 1846 32103 AI305307 RG:1997021:20003:D04 1847 32104 526.I07.laf3_561385 RG:299652:OrderP01:E04 1848 32125 AI249647 RG:2007319:20003:G10 1849 32128 5382.A04.BETA5_582967 2TNT052200A04 1850 32139 PL4B052400.D04.GZ43_421708 PL4B052400D04 1851 32142 2TNT052200.H04.GZ43_421464 2TNT052200H04 1852 32155 PL4B052400.B05.GZ43_421714 PL4B052400B05 1853 32158 5382.H10.BETA5_583022 2TNT052200H10 1854 32198 AA428964 RG:769707:12039906:D04 1855 32208 518.A20.laf3_548381 RG:347271:12039906:A10 1856 32209 AA641485 RG:1172529:Order7TM11:A10 1857 32212 AA411086 RG:724468:12039906:C10 1858 32217 AA826627 RG:1420265:Order7TM11:E10 1859 32219 AA828222 RG:1422995:Order7TM11:F10 1860 32221 AA862155 RG:1485919:Order7TM11:G10 1861 32231 519.H08.laf3_548580 RG:291488:Order7TM22:D04 1862 32241 519.B20.laf3_548766 RG:279067:Order7TM22:A10 1863 32248 H86259 RG:223442:Order7TM20:E10 1864 32275 520.D20.laf3_559284 RG:24729:Order7TM01:B10 1865 32282 AA013201 RG:360131:Order7TM24:F10 1866 32284 AA018407 RG:362533:Order7TM24:G10 1867 32285 R49164 RG:36797:Order7TM01:G10 1868 32288 521.A08.laf3_559473 RG:153781:Order7TM18:A04 1869 32292 521.E08.laf3_559477 RG:155964:Order7TM18:C04 1870 32295 521.H08.laf3_559480 RG:144155:Order7TM17:D04 1871 32304 R53113 RG:154422:Order7TM18:A10 1872 32309 521.F20.laf3_559670 RG:143670:Order7TM17:C10 1873 32317 R49761 RG:152624:Order7TM17:G10 1874 32320 522.A08.laf3_559857 RG:365486:Order7TM25:A04 1875 32347 AA292684 RG:713779:Order7TM30:F10 1876 32358 AA460529 RG:796624:Order7TM32:D04 1877 32371 AA761894 RG:1290472:Order7TM34:B10 1878 32386 524.C08.laf3_560627 RG:1387448:Order7TM36:B04 1879 32388 AA844385 RG:1390752:Order7TM36:C04 1880 32395 AA913293 RG:1554722:Order7TM38:F04 1881 32465 AI254029 RG:1983593:20002:A10 1882 32469 AI251722 RG:1984571:20002:C10 1883 32480 1TNT051800.A05.GZ43_421369 1TNT051800A05 1884 32484 1TNT051800.C05.GZ43_421371 1TNT051800C05 1885 32488 538.E05.BETA5_582883 1TNT051800E05 1886 32499 5383.B11.T3_583120 3TNT052200B11 1887 32506 538.F11.BETA5_582932 1TNT051800F11 1888 32512 539.A09.Laf3_581123 RG:2124082:8119907:A05 1889 32516 539.E09.Laf3_581127 RG:2160113:8119907:C05 1890 32544 T81096 RG:109165:12039905:A05 1891 32556 N30787 RG:257079:12039905:G05 1892 32558 518.O09.laf3_548219 RG:300634:12039905:H05 1893 32564 R55625 RG:154770:12039905:C11 1894 32574 518.O21.laf3_548411 RG:325930:12039905:H11 1895 32580 519.E09.laf3_548593 RG:179266:Order7TM19:C05 1896 32583 519.H09.laf3_548596 RG:263993:Order7TM21:D05 1897 32591 519.P09.laf3_548604 RG:273969:Order7TM21:H05 1898 32594 519.C21.laf3_548783 RG:178479:Order7TM19:B11 1899 32596 H51124 RG:179642:Order7TM19:C11 1900 32628 520.E21.laf3_559301 RG:321260:Order7TM23:C11 1901 32645 T77432 RG:113840:Order7TM16:C05 1902 32652 521.M09.laf3_559501 RG:48922:Order7TM02:G05 1903 32654 521.O09.laf3_559503 RG:50127:Order7TM02:H05 1904 32662 521.G21.laf3_559687 RG:44286:Order7TM02:D11 1905 32666 521.K21.laf3_559691 RG:48256:Order7TM02:F11 1906 32670 521.O21.laf3_559695 RG:51009:Order7TM02:H11 1907 32684 AA702455 RG:447950:Order7TM26:G05 1908 32688 522.A21.laf3_560065 RG:415681:Order7TM26:A11 1909 32702 AA779154 RG:452641:Order7TM26:H11 1910 32725 AA650031 RG:1187678:Order7TM33:C11 1911 32733 AA743401 RG:1272563:Order7TM33:G11 1912 32751 524.P09.laf3_560656 RG:1752807:Order7TM39:H05 1913 32775 AI638529 RG:2240207:Order7TM41:D05 1914 32799 525.P21.laf3_561232 RG:2342176:Order7TM41:H11 1915 32811 AI223784 RG:2003087:20003:F05 1916 32828 AA250856 RG:684365:OrderP01:G11 1917 32829 AI246847 RG:2007337:20003:G11 1918 32830 526.O21.laf3_561615 RG:753277:OrderP01:H11 1919 32835 4ATNT052400.A03.T3_421661 4ATNT052400A03 1920 32839 PL4B052400.E01.GZ43_421685 PL4B052400E01 1921 32842 5382.F05.BETA5_582980 2TNT052200F05 1922 32843 PL4B052400.E04.GZ43_421709 PL4B052400E04 1923 32848 5382.A11.BETA5_583023 2TNT052200A11 1924 32854 5382.D11.BETA5_583026 2TNT052200D11 1925 32872 AI150354 RG:1752018:OrderK02:E05 1926 32883 539.D22.Laf3_581334 RG:180447:OrderK01:B11 1927 32891 539.L22.Laf3_581342 RG:470447:OrderK01:F11 1928 32904 AI033477 RG:1655516:12039906:E05 1929 32907 AA834081 RG:1422219:Order7TM11:F05 1930 32930 519.C10.laf3_548607 RG:201469:Order7TM20:B05 1931 32932 519.E10.laf3_548609 RG:205963:Order7TM20:C05 1932 32934 519.G10.laf3_548611 RG:211565:Order7TM20:D05 1933 32938 519.K10.laf3_548615 RG:232881:Order7TM20:F05 1934 32940 519.M10.laf3_548617 RG:236186:Order7TM20:G05 1935 32952 519.I22.laf3_548805 RG:229279:Order7TM20:E11 1936 32963 520.D10.laf3_559124 RG:23984:Order7TM01:B05 1937 32998 521.G10.laf3_559511 RG:158151:Order7TM18:D05 1938 33016 521.I22.laf3_559705 RG:163004:Order7TM18:E11 1939 33018 521.K22.laf3_559707 RG:165830:Order7TM18:F11 1940 33023 521.P22.laf3_559712 RG:153398:Order7TM17:H11 1941 33037 522.N10.laf3_559902 RG:714057:Order7TM30:G05 1942 33044 522.E22.laf3_560085 RG:378869:Order7TM25:C11 1943 33047 522.H22.laf3_560088 RG:712463:Order7TM30:D11 1944 33109 AA919075 RG:1535701:Order7TM38:C11 1945 33122 AI263529 RG:1857034:Order7TM40:B05 1946 33125 525.F10.laf3_561046 RG:2365503:Order7TM42:C05 1947 33135 525.P10.laf3_561056 RG:2504825:Order7TM42:H05 1948 33136 AI248597 RG:1850163:Order7TM40:A11 1949 33147 AI820024 RG:2408918:Order7TM42:F11 1950 33148 AI553937 RG:2090491:Order7TM40:G11 1951 33155 AI251395 RG:1983835:20002:B05 1952 33180 526.M22.laf3_561629 RG:2271099:OrderP02:G11 1953 33191 5383.D06.T3_583082 3TNT052200D06 1954 33202 538.B12.BETA5_582936 1TNT051800B12 1955 33204 538.C12.BETA5_582937 1TNT051800C12 1956 33209 5383.E12.T3_583131 3TNT052200E12 1957 33216 539.A11.Laf3_581155 RG:2124966:8119907:A06 1958 33218 AI457674 RG:2144771:8119907:B06 1959 33220 AI478225 RG:2161567:8119907:C06 1960 33221 539.F11.Laf3_581160 RG:1322461:12039907:C06 1961 33222 539.G11.Laf3_581161 RG:2213638:8119907:D06 1962 33232 539.A23.Laf3_581347 RG:2131578:8119907:A12 1963 33235 AA662728 RG:1218062:12039907:B12 1964 33244 539.M23.Laf3_581359 RG:2341674:8119907:G12 1965 33248 518.A11.laf3_548237 RG:110380:12039905:A06 1966 33249 518.B11.laf3_548238 RG:1412814:12039908:A06 1967 33253 518.F11.laf3_548242 RG:1526787:12039908:C06 1968 33254 518.G11.laf3_548243 RG:183599:12039905:D06 1969 33261 AI346645 RG:1926602:12039908:G06 1970 33275 518.L23.laf3_548440 RG:1872818:12039908:F12 1971 33287 N28612 RG:264033:Order7TM21:D06 1972 33291 519.L11.laf3_548632 RG:269093:Order7TM21:F06 1973 33293 519.N11.laf3_548634 RG:271623:Order7TM21:G06 1974 33294 H38515 RG:192671:Order7TM19:H06 1975 33301 519.F23.laf3_548818 RG:262317:Order7TM21:C12 1976 33328 520.A23.laf3_559329 RG:308004:Order7TM23:A12 1977 33330 520.C23.laf3_559331 RG:309559:Order7TM23:B12 1978 33350 R61591 RG:37697:Order7TM02:D06 1979 33351 T91350 RG:116459:Order7TM16:D06 1980 33355 521.L11.laf3_559532 RG:126266:Order7TM16:F06 1981 33359 521.P11.laf3_559536 RG:134800:Order7TM16:H06 1982 33360 521.A23.laf3_559713 RG:39932:Order7TM02:A12 1983 33374 521.O23.laf3_559727 RG:51276:Order7TM02:H12 1984 33396 AA678187 RG:430831:Order7TM26:C12 1985 33417 AA731087 RG:1251730:Order7TM33:E06 1986 33434 523.K23.laf3_560491 RG:728661:Order7TM31:F12 1987 33458 AA810410 RG:1338465:Order7TM35:B12 1988 33486 AA902928 RG:1516750:Order7TM37:H06 1989 33496 AA909778 RG:1476569:Order7TM37:E12 1990 33506 526.C11.laf3_561443 RG:151456:OrderP01:B06 1991 33513 AI223471 RG:2002542:20003:E06 1992 33531 AI265824 RG:2006592:20003:F12 1993 33533 AI246860 RG:2007366:20003:G12 1994 33539 5384.B06.T3_583176 4ATNT052400B03 1995 33551 PL4B052400.F07.GZ43_421734 PL4B052400F07 1996 33554 5382.B12.BETA5_583032 2TNT052200B12 1997 33555 5384.B12.T3_583224 4ATNT052400H03 1998 33561 PL4B052400.H03.GZ43_421704 PL4B052400H03 1999 33563 PL4B052400.D05.GZ43_421716 PL4B052400D05 2000 33565 PL4B052400.H06.GZ43_421728 PL4B052400H06 2001 33593 539.J24.Laf3_581372 RG:362359:OrderK01:E12 2002 33603 518.D12.laf3_548256 RG:1173873:Order7TM11:B06 2003 33607 AA837505 RG:1410138:Order7TM11:D06 2004 33615 518.P12.laf3_548268 RG:1592447:Order7TM11:H06 2005 33618 AA702766 RG:447683:12039906:B12 2006 33621 518.F24.laf3_548450 RG:1239284:Order7TM11:C12 2007 33623 AA838525 RG:1418951:Order7TM11:D12 2008 33629 518.N24.laf3_548458 RG:1486533:Order7TM11:G12 2009 33634 519.C12.laf3_548639 RG:201628:Order7TM20:B06 2010 33636 R98050 RG:206795:Order7TM20:C06 2011 33664 520.A12.laf3_559153 RG:343572:Order7TM24:A06 2012 33672 W95805 RG:358318:Order7TM24:E06 2013 33680 520.A24.laf3_559345 RG:344338:Order7TM24:A12 2014 33682 520.C24.laf3_559347 RG:345553:Order7TM24:B12 2015 33690 AA016156 RG:360639:Order7TM24:F12 2016 33693 R34661 RG:36928:Order7TM01:G12 2017 33703 521.H12.laf3_559544 RG:144675:Order7TM17:D06 2018 33704 H22158 RG:160545:Order7TM18:E06 2019 33716 R73930 RG:156777:Order7TM18:C12 2020 33727 R48093 RG:153417:Order7TM17:H12 2021 33729 AA278452 RG:703940:Order7TM30:A06 2022 33740 AA701039 RG:397599:Order7TM25:G06 2023 33742 522.O12.laf3_559935 RG:399390:Order7TM25:H06 2024 33748 AA778077 RG:379708:Order7TM25:C12 2025 33755 522.L24.laf3_560124 RG:713954:Order7TM30:F12 2026 33800 AA843787 RG:1405420:Order7TM36:E06 2027 33802 524.K12.laf3_560699 RG:1409375:Order7TM36:F06 2028 33819 524.L24.laf3_560892 RG:1559941:Order7TM38:F12 2029 33823 524.P24.laf3_560896 RG:1571250:Order7TM38:H12 2030 33842 AI264420 RG:1872799:Order7TM40:B12 2031 33851 525.L24.laf3_561276 RG:2408975:Order7TM42:F12 2032 33892 529.D01.beta5_565388 M00074843D:D02 2033 33902 529.N01.beta5_565398 M00074844D:F09 2034 33919 529.O13.beta5_565591 M00073985B:C09 2035 33923 527.C01.beta5_564619 M00073796C:C06 2036 33925 2540.F24.GZ43_372151 M00073796D:B08 2037 33930 527.J01.beta5_564626 M00072996B:A10 2038 33938 527.B13.beta5_564810 M00074343B:B03 2039 33940 2472.E21.GZ43_360966 M00074343B:B09 2040 33950 2472.G02.GZ43_360995 M00074346D:A10 2041 33951 527.O13.beta5_564823 M00073812A:E09 2042 33965 536.N02.beta5_568934 M00073442B:D12 2043 33973 536.F14.beta5_569118 M00073469B:A09 2044 33979 2367.I16.GZ43_346202 M00073469D:C06 2045 33983 536.P14.beta5_569128 M00073469D:H04 2046 34000 535.P01.beta5_568536 M00073824A:C04 2047 34002 535.B13.beta5_568714 M00073839A:D05 2048 34003 535.C13.beta5_568715 M00075619B:A04 2049 34005 2499.F08.GZ43_365363 M00075621A:F06 2050 34012 535.L13.beta5_568724 M00073843A:C10 2051 34033 532.A13.beta5_566793 M00075166A:A12 2052 34034 532.B13.beta5_566794 M00074666D:B04 2053 34041 2491.A18.GZ43_363614 M00075167A:E12 2054 34058 2472.N19.GZ43_361180 M00074374D:A08 2055 34062 531.N01.beta5_566230 M00074377C:G04 2056 34066 531.B13.beta5_566410 M00074402C:C03 2057 34072 531.H13.beta5_566416 M00074423A:B06 2058 34075 2474.J01.GZ43_361834 M00074481A:G09 2059 34120 534.H01.beta5_567760 M00073715A:F05 2060 34124 534.L01.beta5_567764 M00073715B:B06 2061 34131 534.C13.beta5_567947 M00073885B:E06 2062 34134 534.F13.beta5_567950 M00073738C:F01 2063 34139 534.K13.beta5_567955 M00073885D:G11 2064 34142 534.N13.beta5_567958 M00073741A:G07 2065 34167 530.G13.beta5_565967 M00073001A:F07 2066 34168 530.H13.beta5_565968 M00074235A:F11 2067 34184 2506.D23.GZ43_366652 M00073853B:C04 2068 34188 2506.E17.GZ43_366670 M00073854B:G11 2069 34195 2467.D11.GZ43_360548 M00074962C:C08 2070 34202 533.J13.beta5_567186 M00073863C:F12 2071 34203 2467.D20.GZ43_360557 M00074966D:E08 2072 34228 537.D13.beta5_569868 M00074277C:C10 2073 34238 2459.C06.GZ43_357046 M00074278B:F02 2074 34252 2561.C08.GZ43_376287 M00074111A:E09 2075 34260 529.D14.beta5_565596 M00074135D:E06 2076 34270 529.N14.beta5_565606 M00074138D:A08 2077 34271 529.O14.beta5_565607 M00074019C:H06 2078 34272 529.P14.beta5_565608 M00074138D:E07 2079 34274 2560.C15.GZ43_375142 M00074079A:E07 2080 34278 527.F02.beta5_564638 M00074079C:H03 2081 34283 527.K02.beta5_564643 M00074198C:A10 2082 34287 527.O02.beta5_564647 M00074198D:D10 2083 34289 527.A14.beta5_564825 M00074208B:G09 2084 34290 527.B14.beta5_564826 M00074091D:F06 2085 34294 527.F14.beta5_564830 M00074093B:G07 2086 34300 527.L14.beta5_564836 M00074094B:F10 2087 34302 527.N14.beta5_564838 M00074095C:E06 2088 34310 536.E01.beta5_568909 M00074159A:C10 2089 34322 536.A13.beta5_569097 M00074175D:D08 2090 34330 536.I13.beta5_569105 M00074177A:G11 2091 34345 2475.O20.GZ43_362357 M00074567C:E04 2092 34359 535.G14.beta5_568735 M00074602A:F03 2093 34365 535.M14.beta5_568741 M00074604C:G09 2094 34366 535.N14.beta5_568742 M00073517C:B05 2095 34370 532.B02.beta5_566618 M00073897B:D12 2096 34375 532.G02.beta5_566623 M00074872B:A12 2097 34376 2542.N11.GZ43_373098 M00073898B:B05 2098 34392 2555.D22.GZ43_373253 M00073916A:B07 2099 34402 531.B02.beta5_566234 M00074296B:B03 2100 34412 531.L02.beta5_566244 M00074298B:E09 2101 34432 531.P14.beta5_566440 M00074320C:A06 2102 34498 2562.P24.GZ43_375847 M00075409D:H01 2103 34514 530.B14.beta5_565978 M00075412A:G03 2104 34518 530.F14.beta5_565982 M00075431D:F08 2105 34542 2491.K18.GZ43_363854 M00075216B:A03 2106 34544 2491.K21.GZ43_363857 M00075217A:B04 2107 34548 2496.B16.GZ43_364123 M00075241A:F08 2108 34560 2496.D03.GZ43_364158 M00075245A:A06 2109 34563 537.C02.beta5_569691 M00074909B:C10 2110 34565 537.E02.beta5_569693 M00074909D:F05 2111 34569 537.I02.beta5_569697 M00074910B:C09 2112 34574 537.N02.beta5_569702 M00074738C:G02 2113 34575 2465.P03.GZ43_358427 M00074911B:F05 2114 34588 2483.G10.GZ43_359809 M00074757A:F04 2115 34607 529.O03.beta5_565431 M00073969A:A02 2116 34610 529.B15.beta5_565610 M00074857C:F04 2117 34615 529.G15.beta5_565615 M00073986C:B02 2118 34616 529.H15.beta5_565616 M00074858C:E07 2119 34659 2367.D02.GZ43_346068 M00073445C:C02 2120 34661 2367.D05.GZ43_346071 M00073445D:H03 2121 34671 536.P04.beta5_568968 M00073447D:F01 2122 34683 536.L16.beta5_569156 M00073471C:F03 2123 34691 535.C03.beta5_568555 M00075560B:E01 2124 34713 2499.G09.GZ43_365388 M00075626A:F03 2125 34714 535.J15.beta5_568754 M00073844D:F01 2126 34719 535.O15.beta5_568759 M00075626D:H03 2127 34729 2490.I24.GZ43_363428 M00075088A:H02 2128 34734 2481.E13.GZ43_358996 M00074641D:A12 2129 34741 532.E15.beta5_566829 M00075172D:H03 2130 34766 531.N03.beta5_566262 M00074409D:A04 2131 34783 531.O15.beta5_566455 M00074493C:D09 2132 34784 2473.J12.GZ43_361461 M00074413A:G11 2133 34818 2554.D24.GZ43_375943 M00073716A:D06 2134 34825 2506.P15.GZ43_366932 M00073873A:A10 2135 34838 534.F15.beta5_567982 M00073744B:D02 2136 34839 534.G15.beta5_567983 M00073888A:C05 2137 34845 534.M15.beta5_567989 M00073888B:E05 2138 34848 2554.O09.GZ43_376192 M00073745C:F11 2139 34849 530.A03.beta5_565801 M00072973B:F11 2140 34851 530.C03.beta5_565803 M00072973C:C03 2141 34856 530.H03.beta5_565808 M00074225C:B10 2142 34858 530.J03.beta5_565810 M00074225C:G04 2143 34865 2505.C14.GZ43_366235 M00073002C:G11 2144 34868 2458.E05.GZ43_356709 M00074239C:A09 2145 34870 530.F15.beta5_565998 M00074240D:H06 2146 34877 530.M15.beta5_566005 M00073003D:A10 2147 34890 533.J03.beta5_567026 M00073855D:H02 2148 34898 533.B15.beta5_567210 M00073864B:B04 2149 34899 533.C15.beta5_567211 M00074968B:A10 2150 34901 2467.E15.GZ43_360576 M00074968B:G06 2151 34903 533.G15.beta5_567215 M00074969B:B06 2152 34912 533.P15.beta5_567224 M00073866C:B06 2153 34921 2535.I23.GZ43_370302 M00073586B:D12 2154 34927 2535.J12.GZ43_370315 M00073587C:B03 2155 34938 2459.D06.GZ43_357070 M00074280D:E06 2156 34940 537.L15.beta5_569908 M00074280D:H03 2157 34945 529.A04.beta5_565433 M00074005A:F07 2158 34956 529.L04.beta5_565444 M00074115C:A05 2159 34971 529.K16.beta5_565635 M00074021B:C04 2160 34983 2457.B22.GZ43_356258 M00074200A:B03 2161 34985 527.I04.beta5_564673 M00074200A:E09 2162 34992 527.P04.beta5_564680 M00074084D:B04 2163 35002 527.J16.beta5_564866 M00074096D:G12 2164 35030 536.E15.beta5_569133 M00074177C:H08 2165 35033 536.J15.beta5_569138 M00074552A:B02 2166 35046 2367.O10.GZ43_346340 M00073493B:A02 2167 35060 535.D16.beta5_568764 M00073518A:F06 2168 35063 2480.L16.GZ43_358783 M00074610B:C08 2169 35080 532.H04.beta5_566656 M00073899D:F10 2170 35088 2542.P02.GZ43_373137 M00073905B:A03 2171 35107 531.C04.beta5_566267 M00074694B:H04 2172 35113 531.I04.beta5_566273 M00074696D:E01 2173 35120 531.P04.beta5_566280 M00074303B:D06 2174 35121 531.A16.beta5_566457 M00074719C:A10 2175 35126 531.F16.beta5_566462 M00074831D:E12 2176 35127 531.G16.beta5_566463 M00074720B:A07 2177 35131 531.K16.beta5_566467 M00074721B:H07 2178 35132 2464.C10.GZ43_357738 M00074832C:F06 2179 35215 530.O04.beta5_565831 M00073762C:D01 2180 35242 533.J04.beta5_567042 M00075219D:H04 2181 35248 533.P04.beta5_567048 M00075221B:F03 2182 35256 533.H16.beta5_567232 M00075247A:C11 2183 35260 2496.E04.GZ43_364183 M00075248B:E06 2184 35267 537.C04.beta5_569723 M00074912B:A10 2185 35285 537.E16.beta5_569917 M00074924B:H01 2186 35287 537.G16.beta5_569919 M00074924D:C03 2187 35320 529.H17.beta5_565648 M00074859D:H07 2188 35321 529.I17.beta5_565649 M00073988D:F09 2189 35330 527.B05.beta5_564682 M00073000C:A09 2190 35342 2472.B03.GZ43_360876 M00074327C:C03 2191 35344 527.P05.beta5_564696 M00074328A:B01 2192 35347 2540.P01.GZ43_372368 M00073813D:A12 2193 35349 527.E17.beta5_564877 M00073813D:B06 2194 35355 527.K17.beta5_564883 M00073814A:C01 2195 35357 527.M17.beta5_564885 M00073814C:B04 2196 35360 2472.J07.GZ43_361072 M00074358B:H11 2197 35396 535.D05.beta5_568588 M00073830A:C02 2198 35403 535.K05.beta5_568595 M00075559B:F11 2199 35405 535.M05.beta5_568597 M00075584C:F03 2200 35434 532.J05.beta5_566674 M00074645A:D05 2201 35438 2481.G06.GZ43_359037 M00074646B:E09 2202 35455 532.O17.beta5_566871 M00075187A:D04 2203 35460 531.D05.beta5_566284 M00074437B:F04 2204 35462 531.F05.beta5_566286 M00074390A:A07 2205 35468 531.L05.beta5_566292 M00074406C:D02 2206 35469 531.M05.beta5_566293 M00074460B:G08 2207 35474 531.B17.beta5_566474 M00074416A:B04 2208 35483 531.K17.beta5_566483 M00074500D:D01 2209 35485 531.M17.beta5_566485 M00074501A:G07 2210 35486 531.N17.beta5_566486 M00074443D:D10 2211 35524 534.D05.beta5_567820 M00073720B:B08 2212 35532 534.L05.beta5_567828 M00073722D:G11 2213 35569 530.A17.beta5_566025 M00073003D:F02 2214 35579 2505.E11.GZ43_366280 M00073006B:D05 2215 35608 533.H17.beta5_567248 M00073866D:G02 2216 35612 533.L17.beta5_567252 M00073867A:F07 2217 35622 537.F05.beta5_569742 M00073048C:G12 2218 35624 537.H05.beta5_569744 M00073049A:H04 2219 35626 2510.N13.GZ43_369350 M00073049B:B03 2220 35632 537.P05.beta5_569752 M00073049C:F01 2221 35633 2536.A09.GZ43_370480 M00073603C:C02 2222 35640 537.H17.beta5_569936 M00074284B:B03 2223 35656 529.H06.beta5_565472 M00074120A:D10 2224 35668 529.D18.beta5_565660 M00074145B:C04 2225 35670 529.F18.beta5_565662 M00074146C:D12 2226 35676 2561.O08.GZ43_376575 M00074148A:C01 2227 35678 2561.O09.GZ43_376576 M00074148A:G12 2228 35682 527.B06.beta5_564698 M00074084D:F11 2229 35688 527.H06.beta5_564704 M00074085B:E06 2230 35689 2457.C17.GZ43_356277 M00074201A:D12 2231 35694 527.N06.beta5_564710 M00074086A:G02 2232 35702 527.F18.beta5_564894 M00074098C:B09 2233 35703 527.G18.beta5_564895 M00074215D:E01 2234 35730 2456.K07.GZ43_356075 M00074179C:B01 2235 35733 2475.L12.GZ43_362277 M00074556C:F07 2236 35735 536.H17.beta5_569168 M00074556D:F07 2237 35743 536.P17.beta5_569176 M00074557C:C12 2238 35780 2542.P15.GZ43_373150 M00073907A:D03 2239 35790 532.N06.beta5_566694 M00073908C:C08 2240 35792 532.P06.beta5_566696 M00073908C:D09 2241 35798 2555.G05.GZ43_373308 M00073919B:D07 2242 35803 532.K18.beta5_566883 M00074904A:H09 2243 35812 2459.L07.GZ43_357263 M00074304B:C09 2244 35813 531.E06.beta5_566301 M00074698D:D01 2245 35818 531.J06.beta5_566306 M00074304D:D07 2246 35820 531.L06.beta5_566308 M00074304D:G12 2247 35825 2482.K23.GZ43_359534 M00074722C:A04 2248 35907 530.C06.beta5_565851 M00073763C:D03 2249 35912 2498.G11.GZ43_365006 M00075439B:B12 2250 35914 530.J06.beta5_565858 M00075441D:E10 2251 35934 530.N18.beta5_566054 M00075494A:E02 2252 35968 2496.G14.GZ43_364241 M00075255A:F10 2253 35985 2466.F18.GZ43_360219 M00074927B:E02 2254 35987 2466.F22.GZ43_360223 M00074927C:C07 2255 36016 529.P07.beta5_565496 M00074852B:E04 2256 36025 529.I19.beta5_565681 M00073994B:D01 2257 36026 529.J19.beta5_565682 M00074863C:F07 2258 36043 527.K07.beta5_564723 M00073804A:C10 2259 36045 2540.J12.GZ43_372235 M00073804B:E02 2260 36055 527.G19.beta5_564911 M00073816B:E11 2261 36057 527.I19.beta5_564913 M00073816C:G07 2262 36058 527.J19.beta5_564914 M00074359D:B10 2263 36065 2367.F17.GZ43_346131 M00073457C:B05 2264 36075 536.L08.beta5_569028 M00073462D:D11 2265 36085 2367.K13.GZ43_346247 M00073474C:F08 2266 36089 536.J20.beta5_569218 M00073475B:E12 2267 36099 2511.I14.GZ43_369615 M00075567B:A03 2268 36102 2541.I21.GZ43_372604 M00073832A:F12 2269 36103 2511.J11.GZ43_369636 M00075559D:F05 2270 36114 535.B19.beta5_568810 M00073846B:B01 2271 36125 535.M19.beta5_568821 M00075640C:C05 2272 36131 532.C07.beta5_566699 M00075137C:H04 2273 36143 532.O07.beta5_566711 M00075161D:D08 2274 36157 532.M19.beta5_566901 M00075191D:G11 2275 36162 531.B07.beta5_566314 M00074415C:G02 2276 36165 2474.E09.GZ43_361722 M00074461D:E04 2277 36174 2473.C15.GZ43_361296 M00074420B:H05 2278 36175 2474.F14.GZ43_361751 M00074465B:E06 2279 36180 531.D19.beta5_566508 M00074395A:C03 2280 36236 534.L07.beta5_567860 M00073730B:A06 2281 36255 2542.K06.GZ43_373021 M00073892A:G06 2282 36262 530.F07.beta5_565870 M00074228D:H10 2283 36268 530.L07.beta5_565876 M00074230A:D01 2284 36273 530.A19.beta5_566057 M00073006D:E04 2285 36276 2458.H07.GZ43_356783 M00074248C:E12 2286 36285 2505.G06.GZ43_366323 M00073009B:C08 2287 36312 533.H19.beta5_567280 M00073867D:F10 2288 36313 2467.H15.GZ43_360648 M00074980D:C01 2289 36314 533.J19.beta5_567282 M00073868A:D02 2290 36320 533.P19.beta5_567288 M00073868B:H11 2291 36321 2535.L05.GZ43_370356 M00073590D:C01 2292 36346 537.J19.beta5_569970 M00074287D:G09 2293 36352 537.P19.beta5_569976 M00074288A:F11 2294 36360 529.H08.beta5_565504 M00074122D:H01 2295 36377 529.I20.beta5_565697 M00074025A:F06 2296 36380 529.L20.beta5_565700 M00074151C:C06 2297 36387 2457.D13.GZ43_356297 M00074202B:F08 2298 36392 527.H08.beta5_564736 M00074087B:C09 2299 36398 2560.G18.GZ43_375241 M00074087C:G05 2300 36410 527.J20.beta5_564930 M00074102A:G02 2301 36414 2560.O16.GZ43_375431 M00074102B:D02 2302 36428 536.K07.beta5_569011 M00074170D:D12 2303 36438 2456.M06.GZ43_356122 M00074184D:B01 2304 36446 536.M19.beta5_569205 M00074187C:G10 2305 36449 535.A08.beta5_568633 M00074582D:B09 2306 36454 535.F08.beta5_568638 M00073505A:G06 2307 36467 535.C20.beta5_568827 M00074619D:F03 2308 36469 535.E20.beta5_568829 M00074620A:F03 2309 36481 532.A08.beta5_566713 M00074886B:G06 2310 36483 2465.F22.GZ43_358206 M00074886B:H08 2311 36484 532.D08.beta5_566716 M00073909C:B03 2312 36490 532.J08.beta5_566722 M00073911B:G10 2313 36497 532.A20.beta5_566905 M00074904C:G12 2314 36505 2465.L22.GZ43_358350 M00074905D:A01 2315 36506 2555.H13.GZ43_373340 M00073921A:B03 2316 36508 532.L20.beta5_566916 M00073921B:F09 2317 36510 532.N20.beta5_566918 M00073922B:B12 2318 36520 531.H08.beta5_566336 M00074308B:D08 2319 36535 2482.M06.GZ43_359565 M00074726C:G03 2320 36537 531.I20.beta5_566529 M00074727B:D05 2321 36635 530.K20.beta5_566083 M00073790A:A12 2322 36638 530.N20.beta5_566086 M00075489C:D01 2323 36648 533.H08.beta5_567104 M00075229D:H01 2324 36662 2496.G19.GZ43_364246 M00075255D:F11 2325 36681 537.I08.beta5_569793 M00074914D:G01 2326 36689 2466.G14.GZ43_360239 M00074928D:C11 2327 36696 537.H20.beta5_569984 M00074773B:B08 2328 36701 2466.H09.GZ43_360258 M00074929D:F03 2329 36704 537.P20.beta5_569992 M00074773C:G04 2330 36707 529.C09.beta5_565515 M00073979B:B05 2331 36713 529.I09.beta5_565521 M00073979C:G07 2332 36714 529.J09.beta5_565522 M00074853A:B10 2333 36715 529.K09.beta5_565523 M00073980A:E06 2334 36717 2557.H23.GZ43_374118 M00073980B:H11 2335 36718 2464.L10.GZ43_357954 M00074853C:C08 2336 36726 529.F21.beta5_565710 M00074865A:F05 2337 36730 529.J21.beta5_565714 M00074866A:G12 2338 36741 2540.K07.GZ43_372254 M00073806B:H03 2339 36756 2472.K12.GZ43_361101 M00074361B:G05 2340 36768 2472.L16.GZ43_361129 M00074366A:H07 2341 36781 2367.H05.GZ43_346167 M00073465D:E09 2342 36783 2367.H06.GZ43_346168 M00073465D:G02 2343 36785 536.B22.beta5_569242 M00073480A:D03 2344 36795 2367.M04.GZ43_346286 M00073482B:H04 2345 36799 2367.M14.GZ43_346296 M00073484B:A05 2346 36804 535.D09.beta5_568652 M00073834D:H06 2347 36805 535.E09.beta5_568653 M00075586A:G06 2348 36808 535.H09.beta5_568656 M00073836D:E05 2349 36813 535.M09.beta5_568661 M00075601A:E09 2350 36822 535.F21.beta5_568846 M00073849A:H07 2351 36826 535.J21.beta5_568850 M00073849C:D11 2352 36833 532.A09.beta5_566729 M00075097C:C10 2353 36859 532.K21.beta5_566931 M00075199D:D11 2354 36860 2482.A10.GZ43_359281 M00074682A:D04 2355 36865 531.A09.beta5_566345 M00074465B:H12 2356 36867 531.C09.beta5_566347 M00074465C:E10 2357 36875 531.K09.beta5_566355 M00074468C:A04 2358 36883 2474.O20.GZ43_361973 M00074510B:A11 2359 36895 531.O21.beta5_566551 M00074513A:F05 2360 36934 2554.I07.GZ43_376046 M00073732A:G02 2361 36937 2542.D20.GZ43_372867 M00073880B:G01 2362 36939 534.K09.beta5_567891 M00073881C:A01 2363 36942 2554.I17.GZ43_376056 M00073733A:C03 2364 36944 2554.J10.GZ43_376073 M00073735B:B11 2365 36956 534.L21.beta5_568084 M00073753C:A02 2366 36960 534.P21.beta5_568088 M00073754B:D03 2367 36963 2504.P01.GZ43_366150 M00072977D:F11 2368 36966 530.F09.beta5_565902 M00074230C:F02 2369 36967 2504.P17.GZ43_366166 M00072978B:C07 2370 36976 2458.A21.GZ43_356629 M00074231C:G02 2371 36989 2505.H18.GZ43_366359 M00073012C:C08 2372 36990 530.N21.beta5_566102 M00074256A:D06 2373 36999 533.G09.beta5_567119 M00074958A:E09 2374 37011 533.C21.beta5_567307 M00072951D:B02 2375 37017 533.I21.beta5_567313 M00072953C:G08 2376 37018 2506.N09.GZ43_366878 M00073869C:A02 2377 37023 2467.I24.GZ43_360681 M00072981D:F06 2378 37027 537.C09.beta5_569803 M00073594A:C01 2379 37035 537.K09.beta5_569811 M00073595A:A10 2380 37046 537.F21.beta5_569998 M00074290C:B05 2381 37049 2536.E11.GZ43_370578 M00073616A:F06 2382 37053 2536.E23.GZ43_370590 M00073617B:F03 2383 37054 2459.H03.GZ43_357163 M00074293B:H08 2384 37056 537.P21.beta5_570008 M00074293C:G09 2385 37062 529.F10.beta5_565534 M00074131A:H09 2386 37065 529.I10.beta5_565537 M00074014B:C11 2387 37072 529.P10.beta5_565544 M00074132C:F10 2388 37073 529.A22.beta5_565721 M00074026C:C06 2389 37085 2558.M22.GZ43_374621 M00074027D:G03 2390 37087 529.O22.beta5_565735 M00074028C:C04 2391 37088 529.P22.beta5_565736 M00074156B:E07 2392 37103 2457.E24.GZ43_356332 M00074206A:H12 2393 37108 2560.O19.GZ43_375434 M00074102C:E01 2394 37109 527.E22.beta5_564957 M00074218C:B12 2395 37125 536.F09.beta5_569038 M00074535D:H03 2396 37130 2456.G16.GZ43_355988 M00074172C:D05 2397 37136 536.O09.beta5_569047 M00074174A:C02 2398 37144 536.G21.beta5_569231 M00074191B:B05 2399 37146 2456.O10.GZ43_356174 M00074191C:D08 2400 37149 536.N21.beta5_569238 M00074561D:D12 2401 37152 536.O21.beta5_569239 M00074192C:C10 2402 37162 2368.C09.GZ43_346435 M00073512B:E12 2403 37172 535.D22.beta5_568860 M00073530B:A02 2404 37176 535.H22.beta5_568864 M00073531B:H02 2405 37215 532.O22.beta5_566951 M00074906C:H07 2406 37218 531.B10.beta5_566362 M00074310D:B04 2407 37220 531.D10.beta5_566364 M00074310D:D02 2408 37243 2482.N14.GZ43_359597 M00074730D:F06 2409 37248 2464.F24.GZ43_357824 M00074839D:A04 2410 37315 530.C10.beta5_565915 M00073768B:D10 2411 37322 530.J10.beta5_565922 M00075425C:G02 2412 37324 2498.K17.GZ43_365108 M00075454D:A11 2413 37330 530.B22.beta5_566106 M00075498C:B11 2414 37336 2507.L15.GZ43_367220 M00075501A:F10 2415 37346 2491.O22.GZ43_363954 M00075231D:D09 2416 37379 537.C10.beta5_569819 M00074916C:H10 2417 37381 537.E10.beta5_569821 M00074916D:B12 2418 37397 537.E22.beta5_570013 M00074930B:D04 2419 37398 537.F22.beta5_570014 M00074774A:D03 2420 37401 2466.H22.GZ43_360271 M00074932A:F01 2421 37431 529.G23.beta5_565743 M00074001D:G02 2422 37433 529.I23.beta5_565745 M00074002A:D11 2423 37434 529.J23.beta5_565746 M00074869D:D08 2424 37437 529.M23.beta5_565749 M00074002B:E10 2425 37438 529.N23.beta5_565750 M00074870B:C05 2426 37447 527.G11.beta5_564783 M00073808C:H06 2427 37457 527.A23.beta5_564969 M00073819A:A12 2428 37467 527.K23.beta5_564979 M00073819C:F05 2429 37469 527.M23.beta5_564981 M00073819D:A05 2430 37479 2367.H19.GZ43_346181 M00073468A:G03 2431 37510 2541.L10.GZ43_372665 M00073838C:F02 2432 37522 2506.C08.GZ43_366613 M00073850A:H09 2433 37528 2506.C14.GZ43_366619 M00073850D:A03 2434 37532 535.L23.beta5_568884 M00073851A:C04 2435 37551 532.O11.beta5_566775 M00075165D:B06 2436 37561 2491.I06.GZ43_363794 M00075203A:G06 2437 37575 531.G11.beta5_566383 M00074473B:A09 2438 37579 531.K11.beta5_566387 M00074474D:F08 2439 37581 531.M11.beta5_566389 M00074476A:A06 2440 37584 531.P11.beta5_566392 M00074441B:A02 2441 37591 2474.P14.GZ43_361991 M00074514A:E08 2442 37592 531.H23.beta5_566576 M00074425C:E05 2443 37595 531.K23.beta5_566579 M00074515A:E02 2444 37597 531.M23.beta5_566581 M00074515A:G08 2445 37637 534.E11.beta5_567917 M00073884A:D12 2446 37638 534.F11.beta5_567918 M00073735C:E04 2447 37660 534.L23.beta5_568116 M00073757A:G10 2448 37662 534.N23.beta5_568118 M00073757C:B09 2449 37667 2505.A09.GZ43_366182 M00072979C:F02 2450 37677 530.M11.beta5_565941 M00072980B:C06 2451 37680 2458.C03.GZ43_356659 M00074234B:B05 2452 37682 2458.L01.GZ43_356873 M00074256D:D03 2453 37688 2458.L05.GZ43_356877 M00074258A:G05 2454 37692 530.L23.beta5_566132 M00074258B:F07 2455 37702 2506.I05.GZ43_366754 M00073861B:C11 2456 37707 533.K11.beta5_567155 M00074960C:H09 2457 37715 2467.J18.GZ43_360699 M00072983C:F04 2458 37724 533.L23.beta5_567348 M00073870A:E04 2459 37729 537.A11.beta5_569833 M00073595D:H05 2460 37731 2535.N11.GZ43_370410 M00073596B:B12 2461 37734 2459.A22.GZ43_357014 M00074274D:F10 2462 37735 537.G11.beta5_569839 M00073597A:A03 2463 37743 2535.O02.GZ43_370425 M00073597D:H01 2464 37748 537.D23.beta5_570028 M00074293D:H07 2465 37760 537.P23.beta5_570040 M00074296B:B11 2466 37764 529.D12.beta5_565564 M00074134A:E08 2467 37768 2561.K01.GZ43_376472 M00074135A:F02 2468 37794 527.B12.beta5_564794 M00074089D:E03 2469 37805 527.M12.beta5_564805 M00074208B:F09 2470 37826 2456.H06.GZ43_356002 M00074174B:H08 2471 37827 2475.H07.GZ43_362176 M00074540C:E02 2472 37831 536.H11.beta5_569072 M00074541C:E08 2473 37834 536.I11.beta5_569073 M00074175A:D08 2474 37859 535.C12.beta5_568699 M00074594B:A07 2475 37861 535.E12.beta5_568701 M00074594B:E10 2476 37865 2480.I08.GZ43_358703 M00074596D:B12 2477 37868 535.L12.beta5_568708 M00073514A:G01 2478 37874 2368.H23.GZ43_346569 M00073532C:H12 2479 37877 2481.B11.GZ43_358922 M00074633B:H01 2480 37882 535.J24.beta5_568898 M00073537D:C03 2481 37887 2481.C09.GZ43_358944 M00074635B:C07 2482 37895 2465.H15.GZ43_358247 M00074890B:C01 2483 37897 2465.H17.GZ43_358249 M00074890B:D05 2484 37914 532.J24.beta5_566978 M00073925B:A01 2485 37926 531.F12.beta5_566398 M00074315C:F09 2486 37929 531.I12.beta5_566401 M00074713B:F02 2487 37947 531.K24.beta5_566595 M00074735C:A11 2488 37951 531.O24.beta5_566599 M00074735D:G06 2489 38020 2498.M13.GZ43_365152 M00075444D:F05 2490 38022 2498.M15.GZ43_365154 M00075448D:A02 2491 38026 530.J12.beta5_565954 M00075414D:G01 2492 38029 2565.N09.GZ43_398087 M00073773D:B10 2493 38048 530.P24.beta5_566152 M00075474C:G02 2494 38050 2496.A04.GZ43_364087 M00075235C:E03 2495 38068 533.D24.beta5_567356 M00075283A:F04 2496 38074 533.J24.beta5_567362 M00075285D:A02 2497 38083 2466.C04.GZ43_360133 M00074918B:F03 2498 38089 2466.C16.GZ43_360145 M00074919C:D12 2499 38091 2466.C22.GZ43_360151 M00074919D:H09 2500 38096 537.P12.beta5_569864 M00074754C:G02 2501 38101 537.E24.beta5_570045 M00074935A:D06 2502 38103 537.G24.beta5_570047 M00074935B:C06 2503 38107 537.K24.beta5_570051 M00074935C:E08 2504 38110 537.N24.beta5_570054 M00074782B:F01 2505 38112 537.P24.beta5_570056 M00074783B:B11

Table 16 provides the results for gene products expressed by at least 2-fold or greater in the prostate tumor samples relative to normal tissue samples in at least 20% of the patients tested. Table 16 includes: 1) the spot identification number (“Spot ID”); 2) the GenBank Accession Number of the publicly available sequence corresponding to the polynucleotide (“GenBankHit”); 3) a description of the GenBank sequence (“GenBankDesc”); 4) the score of the similarity of the polynucleotide sequence and the GenBank sequence (“GenBankScore”); 5) the number of patients analyzed; 6) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was at least 2-fold greater in cancerous tissue than in matched normal tissue (“>=2×”); 7) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was at least 5-fold greater in cancerous tissue than in matched normal tissue (“>=5×”); and 8) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was less than or equal to ½ of the expression level in matched normal cells (“<=halfx”).

Table 17 provides the results for gene products in which expression levels of the gene in prostate tumor cells was less than or equal to ½ of the expression level in normal tissue samples in at least 20% of the patients tested. Table 17 includes: 1) the spot identification number (“Spot ID”); 2) the GenBank Accession Number of the publicly available sequence corresponding to the polynucleotide (“GenBankHit”); 3) a description of the GenBank sequence (“GenBankDesc”); 4) the score of the similarity of the polynucleotide sequence and the GenBank sequence (“GenBankScore”); 5) the number of patients analyzed; 6) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was at least 2-fold greater in cancerous tissue than in matched normal tissue (“>=2×”); 7) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was at least 5-fold greater in cancerous tissue than in matched normal tissue (“>=5×”); and 8) the percentage of patients tested in which expression levels (e.g., as message level) of the gene was less than or equal to ½ of the expression level in matched normal cells (“<=half×”).

Tables 16 and 17 also include the results from each patient, identified by the patient ID number (e.g., 93). This data represents the ratio of differential expression for the samples tested from that particular patient's tissues (e.g., “93” is the ratio from the tissue samples of patient ID no. 93). The ratios of differential expression are expressed as a normalized hybridization signal associated with the tumor probe divided by the normalized hybridization signal with the normal probe. Thus, a ratio greater than 1 indicates that the gene product is increased in expression in cancerous cells relative to normal cells, while a ratio of less than 1 indicates the opposite.

These data provide evidence that the genes represented by the polynucleotides having the indicated sequences are differentially expressed in prostate cancer as compared to normal non-cancerous prostate tissue.

Example 21 Antisense Regulation of Gene Expression

The expression of the differentially expressed genes represented by the polynucleotides in the cancerous cells can be analyzed using antisense knockout technology to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting a metastatic phenotype.

A number of different oligonucleotides complementary to the mRNA generated by the differentially expressed genes identified herein can be designed as potential antisense oligonucleotides, and tested for their ability to suppress expression of the genes. Sets of antisense oligomers specific to each candidate target are designed using the sequences of the polynucleotides corresponding to a differentially expressed gene and the software program HYB simulator Version 4 (available for Windows 95/Windows NT or for Power Macintosh, RNAture, Inc. 1003 Health Sciences Road, West, Irvine, Calif. 92612 USA). Factors that are considered when designing antisense oligonucleotides include: 1) the secondary structure of oligonucleotides; 2) the secondary structure of the target gene; 3) the specificity with no or minimum cross-hybridization to other expressed genes; 4) stability; 5) length and 6) terminal GC content. The antisense oligonucleotide is designed so that it will hybridize to its target sequence under conditions of high stringency at physiological temperatures (e.g., an optimal temperature for the cells in culture to provide for hybridization in the cell, e.g., about 37° C.), but with minimal formation of homodimers.

Using the sets of oligomers and the HYB simulator program, three to ten antisense oligonucleotides and their reverse controls are designed and synthesized for each candidate mRNA transcript, which transcript is obtained from the gene corresponding to the target polynucleotide sequence of interest. Once synthesized and quantitated, the oligomers are screened for efficiency of a transcript knock-out in a panel of cancer cell lines. The efficiency of the knock-out is determined by analyzing mRNA levels using lightcycler quantification. The oligomers that resulted in the highest level of transcript knock-out, wherein the level was at least about 50%, preferably about 80-90%, up to 95% or more up to undetectable message, are selected for use in a cell-based proliferation assay, an anchorage independent growth assay, and an apoptosis assay.

The ability of each designed antisense oligonucleotide to inhibit gene expression is tested through transfection into LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate carcinoma cells. For each transfection mixture, a carrier molecule (such as a lipid, lipid derivative, lipid-like molecule, cholesterol, cholesterol derivative, or cholesterol-like molecule) is prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide is then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide is further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, the carrier molecule, typically in the amount of about 1.5-2 nmol carrier/μg antisense oligonucleotide, is diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide is immediately added to the diluted carrier and mixed by pipetting up and down. Oligonucleotide is added to the cells to a final concentration of 30 nM.

The level of target mRNA that corresponds to a target gene of interest in the transfected cells is quantitated in the cancer cell lines using the Roche LightCycler™ real-time PCR machine. Values for the target mRNA are normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) is placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water is added to a total volume of 12.5 μl. To each tube is added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents are mixed by pipetting up and down, and the reaction mixture is incubated at 42° C. for 1 hour. The contents of each tube are centrifuged prior to amplification.

An amplification mixture is prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT is added, and amplification is carried out according to standard protocols. The results are expressed as the percent decrease in expression of the corresponding gene product relative to non-transfected cells, vehicle-only transfected (mock-transfected) cells, or cells transfected with reverse control oligonucleotides.

Example 22 Effect of Expression on Proliferation

The effect of gene expression on the inhibition of cell proliferation can be assessed in metastatic breast cancer cell lines (MDA-MB-231 (“231”)); SW620 colon colorectal carcinoma cells; SKOV3 cells (a human ovarian carcinoma cell line); or LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells.

Cells are plated to approximately 60-80% confluency in 96-well dishes. Antisense or reverse control oligonucleotide is diluted to 2 μM in OptiMEM™. The oligonucleotide-OptiMEM™ can then be added to a delivery vehicle, which delivery vehicle can be selected so as to be optimized for the particular cell type to be used in the assay. The oligo/delivery vehicle mixture is then further diluted into medium with serum on the cells. The final concentration of oligonucleotide for all experiments can be about 300 nM.

Antisense oligonucleotides are prepared as described above (see Example 21). Cells are transfected overnight at 37° C. and the transfection mixture is replaced with fresh medium the next morning. Transfection is carried out as described above in Example 21.

Those antisense oligonucleotides that result in inhibition of proliferation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit proliferation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of proliferation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit proliferation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.

Example 23 Effect of Gene Expression on Cell Migration

The effect of gene expression on the inhibition of cell migration can be assessed in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells using static endothelial cell binding assays, non-static endothelial cell binding assays, and transmigration assays.

For the static endothelial cell binding assay, antisense oligonucleotides are prepared as described above (see Example 21). Two days prior to use, prostate cancer cells (CaP) are plated and transfected with antisense oligonucleotide as described above (see Examples 21 and 22). On the day before use, the medium is replaced with fresh medium, and on the day of use, the medium is replaced with fresh medium containing 2 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in DMEM/1% BSA/10 mM HEPES pH 7.0. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.

Endothelial cells (EC) are plated onto 96-well plates at 40-50% confluence 3 days prior to use. On the day of use, EC are washed 1× with PBS and 50λ DMDM/1% BSA/10 mM HEPES pH 7 is added to each well. To each well is then added 50K (50λ) CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. The plates are incubated for an additional 30 min and washed 5× with PBS containing Ca++ and Mg++. After the final wash, 100 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).

For the non-static endothelial cell binding assay, CaP are prepared as described above. EC are plated onto 24-well plates at 30-40% confluence 3 days prior to use. On the day of use, a subset of EC are treated with cytokine for 6 hours then washed 2× with PBS. To each well is then added 150-200K CaP cells in DMEM/1% BSA/10 mM HEPES pH 7. Plates are placed on a rotating shaker (70 RPM) for 30 min and then washed 3× with PBS containing Ca++ and Mg++. After the final wash, 500 μL PBS is added to each well and fluorescence is read on a fluorescent plate reader (Ab492/Em 516 nm).

For the transmigration assay, CaP are prepared as described above with the following changes. On the day of use, CaP medium is replaced with fresh medium containing 5 μM CellTracker green CMFDA (Molecular Probes, Inc.) and cells are incubated for 30 min. Following incubation, CaP medium is replaced with fresh medium (no CMFDA) and cells are incubated for an additional 30-60 min. CaP cells are detached using CMF PBS/2.5 mM EDTA or trypsin, spun and resuspended in EGM-2-MV medium. Finally, CaP cells are counted and resuspended at a concentration of 1×106 cells/ml.

EC are plated onto FluorBlok transwells (BD Biosciences) at 30-40% confluence 5-7 days before use. Medium is replaced with fresh medium 3 days before use and on the day of use. To each transwell is then added 50K labeled CaP. 30 min prior to the first fluorescence reading, 1014 of FITC-dextran (10K MW) is added to the EC plated filter. Fluorescence is then read at multiple time points on a fluorescent plate reader (Ab492/Em 516 nm).

Those antisense oligonucleotides that result in inhibition of binding of LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells to endothelial cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous prostate cells. Those antisense oligonucleotides that result in inhibition of endothelial cell transmigration by LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 prostate cancer cells indicate that the corresponding gene plays a role in the production or maintenance of the cancerous phenotype in cancerous prostate cells.

Example 24 Effect of Gene Expression on Colony Formation

The effect of gene expression upon colony formation of SW620 cells, SKOV3 cells, MD-MBA-231 cells, LNCaP cells, PC3 cells, 22Rv1 cells, MDA-PCA-2b cells, and DU145 cells can be tested in a soft agar assay. Soft agar assays are conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer is formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells are counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for the soft agar assay. 2000 cells are plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo (produced as described above) is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies form in 10 days to 3 weeks. Fields of colonies are counted by eye. Wst-1 metabolism values can be used to compensate for small differences in starting cell number. Larger fields can be scanned for visual record of differences.

Those antisense oligonucleotides that result in inhibition of colony formation of SW620 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous colon cells. Those antisense oligonucleotides that inhibit colony formation in SKOV3 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous breast cells. Those antisense oligonucleotides that result in inhibition of colony formation of MDA-MB-231 cells indicate that the corresponding gene plays a role in production or maintenance of the cancerous phenotype in cancerous ovarian cells. Those antisense oligonucleotides that inhibit colony formation in LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells represent genes that play a role in production or maintenance of the cancerous phenotype in cancerous prostate cells.

Example 25 Induction of Cell Death Upon Depletion of Polypeptides by Depletion of mRNA (“Antisense Knockout”)

In order to assess the effect of depletion of a target message upon cell death, LNCaP, PC3, 22Rv1, MDA-PCA-2b, or DU145 cells, or other cells derived from a cancer of interest, can be transfected for proliferation assays. For cytotoxic effect in the presence of cisplatin (cis), the same protocol is followed but cells are left in the presence of 2 μM drug. Each day, cytotoxicity is monitored by measuring the amount of LDH enzyme released in the medium due to membrane damage. The activity of LDH is measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). A positive control using antisense and reverse control oligonucleotides for BCL2 (a known anti-apoptotic gene) is included; loss of message for BCL2 leads to an increase in cell death compared with treatment with the control oligonucleotide (background cytotoxicity due to transfection).

Example 26 Functional Analysis of Gene Products Differentially Expressed in Prostate Cancer in Patients

The gene products of sequences of a gene differentially expressed in cancerous cells can be further analyzed to confirm the role and function of the gene product in tumorigenesis, e.g., in promoting or inhibiting development of a metastatic phenotype. For example, the function of gene products corresponding to genes identified herein can be assessed by blocking function of the gene products in the cell. For example, where the gene product is secreted or associated with a cell surface membrane, blocking antibodies can be generated and added to cells to examine the effect upon the cell phenotype in the context of, for example, the transformation of the cell to a cancerous, particularly a metastatic, phenotype. In order to generate antibodies, a clone corresponding to a selected gene product is selected, and a sequence that represents a partial or complete coding sequence is obtained. The resulting clone is expressed, the polypeptide produced isolated, and antibodies generated. The antibodies are then combined with cells and the effect upon tumorigenesis assessed.

Where the gene product of the differentially expressed genes identified herein exhibits sequence homology to a protein of known function (e.g., to a specific kinase or protease) and/or to a protein family of known function (e.g., contains a domain or other consensus sequence present in a protease family or in a kinase family), then the role of the gene product in tumorigenesis, as well as the activity of the gene product, can be examined using small molecules that inhibit or enhance function of the corresponding protein or protein family.

Additional functional assays include, but are not necessarily limited to, those that analyze the effect of expression of the corresponding gene upon cell cycle and cell migration. Methods for performing such assays are well known in the art.

Example 27 Contig Assembly and Additional Gene Characterization

The sequences of the polynucleotides provided in the present invention can be used to extend the sequence information of the gene to which the polynucleotides correspond (e.g., a gene, or mRNA encoded by the gene, having a sequence of the polynucleotide described herein). This expanded sequence information can in turn be used to further characterize the corresponding gene, which in turn provides additional information about the nature of the gene product (e.g., the normal function of the gene product). The additional information can serve to provide additional evidence of the gene product's use as a therapeutic target, and provide further guidance as to the types of agents that can modulate its activity.

In one example, a contig is assembled using a sequence of a polynucleotide of the present invention, which is present in a clone. A “contig” is a contiguous sequence of nucleotides that is assembled from nucleic acid sequences having overlapping (e.g., shared or substantially similar) sequence information. The sequences of publicly-available ESTs (Expressed Sequence Tags) and the sequences of various clones from several cDNA libraries synthesized at Chiron can be used in the contig assembly.

The contig is assembled using the software program Sequencher, version 4.05, according to the manufacturer's instructions and an overview alignment of the contiged sequences is produced. The sequence information obtained in the contig assembly can then be used to obtain a consensus sequence derived from the contig using the Sequencher program. The consensus sequence is used as a query sequence in a TeraBLASTN search of the DGTI DoubleTwist Gene Index (DoubleTwist, Inc., Oakland, Calif.), which contains all the EST and non-redundant sequence in public databases.

Through contig assembly and the use of homology searching software programs, the sequence information provided herein can be readily extended to confirm, or confirm a predicted, gene having the sequence of the polynucleotides described in the present invention. Further the information obtained can be used to identify the function of the gene product of the gene corresponding to the polynucleotides described herein. While not necessary to the practice of the invention, identification of the function of the corresponding gene, can provide guidance in the design of therapeutics that target the gene to modulate its activity and modulate the cancerous phenotype (e.g., inhibit metastasis, proliferation, and the like).

Example 28 Expression of Chondroitin 4-O Sulfotransferase 2 (C4S-2)

Laser Capture Microdissection (LCM) was used to dissect cancerous cells, as well as peritumoral normal cells from patients with prostate cancer (various grades), colon cancer, breast cancer and stomach cancer. Total RNA was prepared from these samples by standard methods. cDNA probes were made from this RNA and fluorescently labeled. The labeled cDNAs were used to probe a microarray chip containing sequences of multiple genes. As shown in Table 16, Spot ED 25837, which corresponds to chondroitin 4-O sulfotransferase 2 (C4S-2) and SEQ ID 847 (see Table 15), revealed a differential expression between normal and cancerous cells. The data displayed in FIG. 22 show an up-regulation of C4S-2 mRNA in prostate, colon and stomach cancer. The table headings are as follows: “# Patients” indicates the number of patients whose RNA was analyzed for each cancer type, and the percentages of each of the patient groups is expressed in the table; “>2×” indicates a greater than two-fold up-regulation (cancer over normal) at the mRNA level; “>5×” indicates a greater than 5-fold up-regulation at the mRNA level; “<0.5×” indicates a greater than 2-fold down-regulation at the mRNA level. Further experimental details of this example may be found in Example 20 of this disclosure.

Trending analysis revealed that several genes trend in patient expression with C4S-2 (FIG. 34). These genes may have significance in pathways, both upstream and downstream of C4S-2.

Example 29 C4S-2 mRNA Expression in Laser Capture Microdissected Tissues

Quantitative PCR of a number of normal tissues and tumor cell lines, particularly colorectal and prostate carcinoma cell lines was used to analyze expression of C4S2. Quantitative real-time PCR was performed by first isolating RNA from cells using a Roche RNA Isolation kit according to manufacturer's directions. One microgram of RNA was used to synthesize a first-strand cDNA using MMLV reverse transcriptase (Ambion) using the manufacturers buffer and recommended concentrations of oligo dT, nucleotides, and Rnasin.

First, primers were designed. The primers were blasted against known genes and sequences to confirm the specificity of the primers to the target. The sequences of the primers are, for set 1: Forward: ATCTCCGCCTTCCGCAGCAA (SEQ ID NO: 14067) and reverse: TCGTTGAAGGGCGCCAGCTT (SEQ ID NO: 14068), and set 2: forward: CATCTACTGCTACGTG (SEQ ID NO: 14069) and reverse: ACTTCTTGAGCTTGACC (SEQ ID NO: 14070). These primers were used in a test qPCR using the primers against normal RTd tissue, as well as a mock RT to pick up levels of possible genomic contamination.

Quantitative PCR of a panel of normal tissue, total cancer tissue, LCM tissue, and cancer cell lines were used to determine the expression levels of C4S2. qPCR was performed by first isolating the RNA from the above mentioned tissue/cells using a Qiagen RNeasy mini prep kit. In the case of the LCM tissue, RNA was amplified via PCR to increase concentration after initial RNA isolation. 0.5 micrograms of RNA was used to generate a first strand cDNA using Stratagene MuLV Reverse Transcriptase, using recommended concentrations of buffer, enzyme, and Rnasin. Concentrations and volumes of dNTP, and oligo dT, or random hexamers were lower than recommended to reduce the level of background primer dimerization in the qPCR.

The cDNA is then used for qPCR to determine the levels of expression of C4S2 using the GeneAmp 7000 by ABI as recommended by the manufacturer. Primers for housekeeping were also run in order to normalized the values, and eliminate possible variations in cDNA template concentrations, pipetting error, etc. Three housekeepers were run depending on the type of tissue, beta-actin for cell lines, GusB for LCM tissue, HPRT for whole tissue.

A subset of patient RNA used to probe the microarray chip was analyzed by semi-quantitative RT-PCR to confirm the microarray results. Pools of 7 or 8 patient RNA samples were analyzed using primers that specifically recognize C4S-2. The data is expressed as mRNA expression level relative to a housekeeping gene (GUSB). Consistent with the microarray data, the data, displayed in FIG. 23, show an up-regulation of C4S-2 mRNA in prostate and colon cancer and a down-regulation in breast cancer. Furthermore, the data reveal that peri-tumoral normal cells in high grade prostate cancer display an elevated expression relative to peri-tumoral normal cells in low grade prostate cancer, suggesting a global up-regulation of C4S-2 mRNA with progression in grade. “(2×)” indicates RNA was amplified two times; “N” indicates peri-tumoral normal epithelial cells; “C” indicates cancerous epithelial cells; “LG” indicates low grade; “HG” indicates high grade.

Example 30 C4S-2 mRNA Expression in Tissue Samples

Using the RT-PCR methods described above, C4S-2 specific primers were used to assess the expression of C4S-2 mRNA obtained from normal tissues (from commercial sources), as well as RNA expression whole tumor tissue (pools of 7 or 8 patients). This tissue contains cell types other than epithelium. The data is expressed as mRNA expression level relative to a housekeeping gene (HPRT). The data, shown in FIG. 24, reveal that C4S-2 mRNA is ubiquitously expressed, throughout the body, with highest expression in normal adrenal, lung and breast tissue. The data further reveal significant expression in colon and prostate cancer (marked with a “C”) and down-regulation in breast cancer, relative to normal breast tissue.

Example 31 C4S-2 mRNA Expression in Prostate Cell Lines

Using the RT-PCR methods described above, C4S-2 specific primers were used to assess the expression of C4S-2 mRNA obtained from various prostate cell lines. The data is expressed as mRNA expression level relative to a housekeeping gene (actin). The data, displayed in FIG. 25, show that C4S-2 mRNA is expressed at higher levels in cell lines derived from prostate cancer tumors than in cell lines derived from normal prostate epithelium.

Example 32 Antisense Regulation of C4S-2 Expression

Additional functional information on C4S-2 was generated using antisense knockout technology. A number of different oligonucleotides complementary to C4S-2 mRNA were designed (FIG. 26) as potential antisense oligonucleotides, and tested for their ability to suppress expression of C4S-2. For each transfection mixture, a carrier molecule, preferably a lipitoid or cholesteroid, was prepared to a working concentration of 0.5 mM in water, sonicated to yield a uniform solution, and filtered through a 0.45 μm PVDF membrane. The antisense or control oligonucleotide was then prepared to a working concentration of 100 μM in sterile Millipore water. The oligonucleotide was further diluted in OptiMEM™ (Gibco/BRL), in a microfuge tube, to 2 μM, or approximately 20 μg oligo/ml of OptiMEM™. In a separate microfuge tube, lipitoid or cholesteroid, typically in the amount of about 1.5-2 nmol lipitoid/μg antisense oligonucleotide, was diluted into the same volume of OptiMEM™ used to dilute the oligonucleotide. The diluted antisense oligonucleotide was immediately added to the diluted lipitoid and mixed by pipetting up and down. Oligonucleotide was added to the cells to a final concentration of 30 nM.

The level of target mRNA (C4S-2) in the transfected cells was quantitated in the cancer cell lines using the methods described above. Values for the target mRNA were normalized versus an internal control (e.g., beta-actin). For each 20 μl reaction, extracted RNA (generally 0.2-1 μg total) was placed into a sterile 0.5 or 1.5 ml microcentrifuge tube, and water was added to a total volume of 12.5 μl. To each tube was added 7.5 μl of a buffer/enzyme mixture, prepared by mixing (in the order listed) 2.5 μl H2O, 2.0 μl 10× reaction buffer, 10 μl oligo dT (20 pmol), 1.0 μl dNTP mix (10 mM each), 0.5 μl RNAsin® (20 u) (Ambion, Inc., Hialeah, Fla.), and 0.5 μl MMLV reverse transcriptase (50 u) (Ambion, Inc.). The contents were mixed by pipetting up and down, and the reaction mixture was incubated at 42° C. for 1 hour. The contents of each tube were centrifuged prior to amplification.

An amplification mixture was prepared by mixing in the following order: 1×PCR buffer II, 3 mM MgCl2, 140 μM each dNTP, 0.175 pmol each oligo, 1:50,000 dil of SYBR® Green, 0.25 mg/ml BSA, 1 unit Taq polymerase, and H2O to 20 μl. (PCR buffer II is available in 10× concentration from Perkin-Elmer, Norwalk, Conn.). In 1× concentration it contains 10 mM Tris pH 8.3 and 50 mM KCl. SYBR® Green (Molecular Probes, Eugene, Oreg.) is a dye which fluoresces when bound to double stranded DNA. As double stranded PCR product is produced during amplification, the fluorescence from SYBR® Green increases. To each 20 μl aliquot of amplification mixture, 2 μl of template RT was added, and amplification was carried out according to standard protocols.

FIG. 26 shows examples of anti-sense oligonucleotide sequences that inhibit C4S-2 mRNA expression when transfected into cells. Functional data described in the following examples was obtained using C210-3, 4 & 6. C4S-2 mRNA reduction ranged from about 60 to about 90%, as compared to cells transfected with reverse (i.e. sense) control oligonucleotides.

In separate experiments, inhibitory RNA molecules are used to inhibit C4S-2 mRNA expression in cells. FIG. 27 lists inhibitory RNA oligonucleotides that may be used in these experiments.

Example 33 Effects of C4S-2 Antisense Molecules on Cellular Proliferation

PC3 cells were plated at 5000 cells/well in 96-well plate and grown overnight. Reverse control or antisense oligonucleotide was diluted to 2 μM in OptiMEM™ and mixed with 30 μM Lipitoid1, a delivery vehicle, also diluted in OptiMEM™. This mixture of oligonucleotide and lipitoid in OptiMEM™ was then mixed with serum containing medium and then overlayed onto the cells overnight. The next day the transfection mix was removed and replaced with fresh media. Final concentration of oligonucleotide for these experiments was 300 nM and the ratio of oligonucleotide to Lipitoid 1 was 1.5 nmol lipoid per oligonucleotide. Cell proliferation was quantified using CyQUANT® Cell Proliferation Assay Kit (Molecular Probes #C-7026).

MDAPca2b cells were plated to 50% confluency and similarly transfected with 300 nM reverse control or antisense oligonucleotide with 30 μM Lipitoid1 overnight. After transfection, the cells were detached with trypsin, washed twice with medium, counted and plated at 5000 cells/well in 96-well plates. Cell proliferation was quantified using CellTiter-Glo™ Luminescent Cell Viability Assay (Promega #G7573).

Using these methods, anti-sense oligonucleotides described in FIG. 26 were transfected into PC3 cells. This usually resulted in a 60-90% knockdown of C4S-2 mRNA compared to controls. As controls, cells were left either untreated or were transfected with reverse control oligonucleotides. The cells were assessed for their ability to grow on tissue culture plastic in a time course that spanned 7 days. The number of cells on any given day was assessed using either the CyQuant assay or the luciferase assay. As shown in the two repeats of the same experiment described in FIG. 28, the ability of PC3 cells to grow in vitro is inhibited by anti-sense oligonucleotides that inhibit C4S-2 expression.

Anti-sense oligonucleotides described in FIG. 26 were transfected into MDA Pca 2b cells. This resulted in a 60-90% knockdown of C4S-2 mRNA. As controls, cells were left either untreated or were transfected with reverse control oligonucleotides. The cells were assessed for their ability to grow on tissue culture plastic in a time course that spanned 7 days. The number of cells on any given day was assessed using either the CyQuant assay or the luciferase assay (depending on the experiment). As shown in FIG. 29, the ability of MDA Pca 2b cells to grow in vitro is inhibited by anti-sense oligonucleotides that inhibit C4S-2 expression (“RC” is a control oligonucleotide; measurements 1, 2 and 3 were taken on three days).

Example 34 Effects of C4S-2 Antisense Molecules on Colony Formation

The effect of C4S-2 expression upon colony formation was tested in a soft agar assay. Soft agar assays were conducted by first establishing a bottom layer of 2 ml of 0.6% agar in media plated fresh within a few hours of layering on the cells. The cell layer was formed on the bottom layer by removing cells transfected as described above from plates using 0.05% trypsin and washing twice in media. The cells were counted in a Coulter counter, and resuspended to 106 per ml in media. 10 μl aliquots are placed with media in 96-well plates (to check counting with WST1), or diluted further for soft agar assay. 2000 cells are plated in 800 μl 0.4% agar in duplicate wells above 0.6% agar bottom layer. After the cell layer agar solidifies, 2 ml of media is dribbled on top and antisense or reverse control oligo is added without delivery vehicles. Fresh media and oligos are added every 3-4 days. Colonies are formed in 10 days to 3 weeks. Fields of colonies were counted by eye.

PC3 cells were transfected as described above. Transfected cells were then assessed for their ability to grow in soft-agar to determine the effect of inhibiting C4S-2 on anchorage-independent growth. PC3 cells were plated at either 400, 600 or 1000 (“1 k”) cells per well. Multiple transfection conditions were used (L1 or L1/C1). As shown in FIG. 30, PC3 cells transfected with C4S-2 anti-sense oligos consistently yielded fewer colonies than those transfected with reverse control oligos. “UT” denotes untransfected cells; “RC” denotes transfected with reverse control oligos; “AS” denotes transfected with anti-sense oligos;

MDA Pca 2b cells were transfected as described above and also assessed for their ability to grow in soft-agar to determine the effect of inhibiting C4S-2 on anchorage-independent growth. MDA Pca 2b cells were plated at either 400, 600 or 1000 cells per well. As shown in FIG. 31, MDA Pca 2b cells transfected with C4S-2 anti-sense oligos consistently yielded fewer colonies than those transfected with reverse control oligos.

Example 34 Effects of C4S-2 Antisense Molecules on Spheroids

Spheroids were assayed as follows: briefly, 96-well plates were coated with poly(2-hydroxyethyl methacrylate or poly-HEMA at 12 ug/ml in 95% ethanol. Poly-HEMA was slowly evaporated at room temperature until plates were dry. Prior to adding cells plates were rinsed twice with 1×PBS. Approximately 10 000 cells/well were then added and transfected with either anti-sense or reverse control oligonucleotide, directly in suspension with similar conditions as described elsewhere. The cells were allowed to grow in suspension for 5 days. The effects of inhibiting C4S-2 mRNA expression were assessed both visually and using the LDH assay to assess degree of cytotoxicity.

Lactate dehydrogenase (LDH) activity is measured, using the Cytotoxicity Detection Kit (Roche Catalog number: 1 644 793) by collecting culture supernatant and adding 100 ul ALPHA MEM medium w/o FBS in V-bottom 96 well plate, transferring all the culture supernatant (100 ul) to the V-bottom plate, mixing, spinning the plate at 2000 rpm for 10 mins, and removing 100 μl for an LDH assay. Alternatively, culture supernatant was removed, and 200 ul ALPHA MEM medium w/o FBS and containing 2% Triton-X 100 was added to the plate, incubated for 1 minute to all for lysis, spun at 2000 rpm for 10 min and 100 μl removed for LDH detection.

LDH was measured using a 1:45 mixture of catalyst, diaphoreses/NAD+ mixture, lyophilizate resuspended H2O and dye solution containing sodium lactate, respectively. 100 ul of this mix is added to each well, and the sample incubated at room temperature for 20 mins. Plates can be reat in a microtiter plate reader with 490 nm filter.

rLDH/tLDH ratio is calculated as follows: the total amount of LDH (tLDH) is calculated by adding released LDH (rLDH, from culture supernatant) to the intracellular LDH (iLDH, from cell lysate): tLDH=rLDH+iLDH. In order to compare the amount of cytotoxicity between AS and RC treated samples, the ratio between rLDH and tLDH is used.

MDA Pca 2b were plated under non-adherent conditions and transfected in suspension with either anti-sense or reverse control oligonucleotides. The cells were allowed to grow in suspension for 5 days. The effects of inhibiting C4S-2 mRNA expression were assessed both visually (FIG. 32A-C) and using the LDH assay to assess degree of cytotoxicity (FIG. 32D). Inhibiting C4S-2 mRNA expression inhibited the ability of MDA Pca 2b to grow in suspension and furthermore, induced cytotoxicity.

Example 35 Effects of C4S-2 Antisense Molecules on Cytotoxicity

Cells were transfected, and the activity of LDH was measured using the Cytotoxicity Detection Kit from Roche Molecular Biochemicals, as described above. The data is provided as a ratio of LDH released in the medium vs. the total LDH present in the well at the same time point and treatment (rLDH/tLDH). MRC9 cells were transfected with multiple pairs of C4S-2 anti-sense and reverse control oligonucleotides and allowed to grow for 3 days. The C4S-2 anti-sense oligonucleotides did not induce cytoxicity (above reverse control) in this “normal” (i.e. non-cancerous) fibroblast cell line (FIG. 33A). Controls antisense molecules, such as those for Bcl2, induced cytotoxicity. mRNA levels were also measured (FIG. 33B), showing that C4S-2 mRNA expression is lower in these cells than in other cells, and that no morphological differences in the antisensed cells as compared to control cells were observed (FIG. 33C).

184B5 cells were also transfected with multiple pairs of C4S-2 anti-sense and reverse control oligonucleotides and allowed to grow for 3 days. The C4S-2 anti-sense oligonucleotides did not induce cytoxicity (above reverse control) in this “normal” (i.e. non-cancerous) breast epithelial cell line (FIG. 34).

Example 36 Effects of C4S-2 Antisense Molecules on Proliferation of Normal Cells

MRC9 and 184B5 cells were transfected with multiple pairs of C4S-2 anti-sense and reverse control oligonucleotides and allowed to grow for 4 days. The C4S-2 anti-sense oligonucleotides did not inhibit proliferation (above reverse control) in these non-cancerous cell lines (FIG. 35).

Example 37 Screening Assays

Screening assays are performed according to Burkart & Wong Anal Biochem 274:131-137 (1999), with modifications.

Using primers flanking the open reading frame, C4S-2 is cloned into a shuttle vector, from which it can be shuttled into multiple expression vectors. Protein expression is assessed using a polyclonal antibody. Activity is assessed using standard assays, i.e. those designed to assay sulfate transfer to chondroitin, chondroitin sulfate or dermatan sulfate. βAST-IV is also cloned and expressed as described in the above report Burkart et al, supra.

C4S-2-modulatory agents are counter-screened to ensure specificity. Included in the counterscreen are C4S-1, C4S-3 and HNK1ST (closest relatives to C4S-2 with approximately 30-42% homology). Additionally, representatives from other classes of sulfotransferases (heparin sulfotransferase, estrogen sulfotransferase, phenol sulfotransferase, tyrosine sulfotransferase) with low homology are also screened. Additionally, representatives from classes of kinases will be used in the counter-screen.

C4S-2 will transfer a sulfonyl group from PAPS to chondroitin sulfate, thus generating PAP. βAST-IV will regenerate PAPS, using p-nitrophenyl sulfate as the sulfate donor. One of the resulting products from the latter reaction—p-nitrophenol can be monitored colorimetrically.

Inhibitors are assessed for their ability to inhibit C4S-2, as determined by an inhibition of p-nitrophenol generation. Control screens include regeneration of PAPS from PAP by βAST-IV, in the absence of C4S-2, to ensure that inhibitors of βAST-IV are not selected. Compounds that inhibit C4S-2 activity are counterscreened against relevant enzymes listed above.

Inhibitors passing the above screens are tested in cell-based functional assays (Proliferation, LDH, spheroid and soft-agar assays). The tested cell lines include PC3, MDA Pca 2b, DU145, Colo320, KM12C, A431, MDA435, MDA469, etc. Additionally, cell lines stably transfected to over-express C4S-2 are assessed compared to parental and control transfected lines.

Inhibitors that show efficacy in the cell line functional assays are tested in xenograft mouse models. A subset of the lines, including PC3, DU145 and MDA435, etc. is in these animal models.

Example 38 Source of Biological Materials

The cells used for detecting differential expression of breast cancer related genes were those previously described for the HMT-3522 tumor reversion model, disclosed in U.S. Pat. Nos. 5,846,536 and 6,123,941, herein incorporated by reference. The model utilizes both non-tumorigenic (HMT-3522 S1) and tumorigenic (HMT-3522 T4-2) cells derived by serial passaging from a single reduction mammoplasty. In two dimensional (2D) monolayers on plastic, both S1 and T4-2 cells display similar morphology. But in three dimensional (3D) matrigel cultures, Si form phenotypically normal mammary tissue structures while T4-2 cells fail to organize into these structures and instead disseminate into the matrix. This assay was designated as a tumor reversion model, in that the T4-2 cells can be induced to form S1-like structures in 3D by treatment with beta-1 integrin or EGFR blocking antibodies, or by treating with a chemical inhibitor of the EGFR signaling pathway (tyrophostin AG 1478). These treated T4-2 cells, called T4R cells, are non-tumorigenic.

Example 39 Cell Growth and RNA Isolation

Growth of Cells 2D and 3D for Microarray Experiments: HMT3522 S1 and T4-2 cells were grown 2D and 3D and T4-2 cells reverted with anti-EGFR, anti-beta 1 integrin, or tyrophostin AG 1478 as previously described (Weaver et al J. Cell Biol. 137:231-45, 1997; and Wang et al PNAS 95:14821-14826, 1998). Anti-EGFR (mAb 225) was purchased from Oncogene and introduced into the matrigel at the time of gelation at a concentration of 4 ug/ml purified mouse IgG1. Anti-beta 1 integrin (mAb AIIB2) was a gift from C. Damsky at the University of California at San Francisco and was also introduced into the matrigel at the time of gelation at a concentration of 100 ug/ml ascites protein (which corresponds to 4-10 ug/ml purified rat IgG1). Tyrophostin AG 1478 was purchased from Calbiochem and used at a concentration of 100 nM.

Isolation of RNA for Microarray Experiments: RNA was prepared from: S1 passage 60 2D cultures; T4-2 passage 41 2D cultures; S1 passage 59 3D cultures; and T4-2 and T4-2 revertant (with anti-EGFR, anti-beta 1 integrin, and tyrophostin) passage 35 3D cultures.

All RNA for microarray experiments was isolated using the commercially available RNeasy Mini Kit from Qiagen. Isolation of total RNA from cells grown 2D was performed as instructed in the kit handbook. Briefly, media was aspirated from the cells and kit Buffer RLT was added directly to the flask. The cell lysate was collected with a rubber cell scraper, and the lysate passed 5 times through a 20-G needle fitted to a syringe. One volume of 70% ethanol was added to the homogenized lysate and mixed well by pipetting. Up to 700 ul of sample was applied to an RNeasy mini spin column sitting in a 2-ml collection tube and centrifuged for 15 seconds at >8000×g. 700 ul Buffer RW1 was added to the column and centrifuged for 15 seconds at >8000×g to wash. The column was transferred to a new collection tube. 500 ul Buffer RPE was added to the column and centrifuged for 15 seconds at >8000×g to wash. Another 500 ul Buffer RPE was added to the column for additional washing, and the column centrifuged for 2 minutes at maximum speed to dry. The column was transferred to a new collection tube and RNA eluted from the column with 30 ul RNase-free water by centrifuging for 1 minute at >8000×g.

Isolation of total RNA from cells grown 3D was performed as described above, except cells were isolated from matrigel prior to RNA isolation. The cells were isolated as colonies from matrigel using ice-cold PBS/EDTA (0.01 M sodium phosphate pH 7.2 containing 138 mM sodium chloride and 5 mM EDTA). See Weaver et al, J Cell Biol 137:231-245, 1997; and Wang et al. PNAS 95:14821-14826, 1998.

Example 40 Detection and Identification of Genes Exhibiting Differential Expression

The relative expression levels of a selected sequence (which in turn is representative of a single transcript) were examined in the tumorigenic versus non-tumorigenic cell lines described above, following culturing of the cells (S1, T4-2 and T4R) in either two-dimensional (2D) monolayers or three-dimensional (3D) matrigel cultures as described above. Differential expression for a selected sequence was assessed by hybridizing mRNA from S1 and T4-2 2D cultures, and S1, T4-2 and T4R 3D cultures to microarray chips as described below, as follows: Exp1=T4-2 2D/S1 2D; Exp2=T4-2 3D/S1 3D; Exp3=Si 3D/S1 2D; Exp4=T4-2 3D/T4-2 2D; Exp5=T4-2 3D/T4R (anti-EGFR) 3D; Exp6=T4-2 3D/T4R (anti-beta1 integrin) 3D; and Exp7=T4-2 3D/T4R (tyrophostin AG 1478) 3D.

Each array used had an identical spatial layout and control spot set. Each microarray was divided into two areas, each area having an array with, on each half, twelve groupings of 32×12 spots for a total of about 9,216 spots on each array. The two areas are spotted identically which provide for at least two duplicates of each clone per array. Spotting was accomplished using PCR amplified products from 0.5 kb to 2.0 kb and spotted using a Molecular Dynamics Gen III spotter according to the manufacturer's recommendations. The first row of each of the 24 regions on the array had about 32 control spots, including 4 negative control spots and 8 test polynucleotides.

The test polynucleotides were spiked into each sample before the labeling reaction with a range of concentrations from 2-600 pg/slide and ratios of 1:1. For each array design, two slides were hybridized with the test samples reverse-labeled in the labeling reaction. This provided for about 4 duplicate measurements for each clone, two of one color and two of the other, for each sample.

Identification Of Differentially Expressed Genes: “Differentially expressed” in the context of the present example meant that there was a difference in expression of a particular gene between tumorigenic vs. non-tumorigenic cells, or cells grown in three-dimensional culture vs. cells grown in two-dimensional culture. To identify differentially expressed genes, total RNA was first reverse transcribed into cDNA using a primer containing a T7 RNA polymerase promoter, followed by second strand DNA synthesis. cDNA was then transcribed in vitro to produce antisense RNA using the T7 promoter-mediated expression (see, e.g., Luo et al. (1999) Nature Med 5:117-122), and the antisense RNA was then converted into cDNA. The second set of cDNAs were again transcribed in vitro, using the T7 promoter, to provide antisense RNA. Optionally, the RNA was again converted into cDNA, allowing for up to a third round of T7-mediated amplification to produce more antisense RNA. Thus the procedure provided for two or three rounds of in vitro transcription to produce the final RNA used for fluorescent labeling.

Fluorescent probes were generated by first adding control RNA to the antisense RNA mix, and producing fluorescently labeled cDNA from the RNA starting material. Fluorescently labeled cDNAs prepared from tumorigenic RNA sample were compared to fluorescently labeled cDNAs prepared from non-tumorigenic cell RNA sample. For example, the cDNA probes from the non-tumorigenic cells were labeled with Cy3 fluorescent dye (green) and the cDNA probes prepared from the tumorigenic cells were labeled with Cy5 fluorescent dye (red).

The differential expression assay was performed by mixing equal amounts of probes from tumorigenic cells and non-tumorigenic cells, and/or cells grown in 3D vs. those grown in 2D. The arrays were prehybridized by incubation for about 2 hrs at 60° C. in 5×SSC/0.2% SDS/1 mM EDTA, and then washed three times in water and twice in isopropanol. Following prehybridization of the array, the probe mixture was then hybridized to the array under conditions of high stringency (overnight at 42° C. in 50% formamide, 5×SSC, and 0.2% SDS). After hybridization, the array was washed at 55° C. three times as follows: 1) first wash in 1×SSC/0.2% SDS; 2) second wash in 0.1×SSC/0.2% SDS; and 3) third wash in 0.1×SSC.

The arrays were then scanned for green and red fluorescence using a Molecular Dynamics Generation III dual color laser-scanner/detector. The images were processed using BioDiscovery Autogene software, and the data from each scan set normalized to provide for a ratio of expression relative to non-tumorigenic or tumorigenic cells grown two-dimensionally or three-dimensionally. Data from the microarray experiments was analyzed according to the algorithms described in U.S. application Ser. No. 60/252,358, filed Nov. 20, 2000, by E. J. Moler, M. A. Boyle, and F. M. Randazzo, and entitled “Precision and accuracy in cDNA microarray data,” which application is specifically incorporated herein by reference.

The experiment was repeated, this time labeling the two probes with the opposite color in order to perform the assay in both “color directions.” Each experiment was sometimes repeated with two more slides (one in each color direction). The level fluorescence for each sequence on the array expressed as a ratio of the geometric mean of 8 replicate spots/genes from the four arrays or 4 replicate spots/gene from 2 arrays or some other permutation. The data were normalized using the spiked positive controls present in each duplicated area, and the precision of this normalization was included in the final determination of the significance of each differential. The fluorescence intensity of each spot was also compared to the negative controls in each duplicated area to determine which spots have detected significant expression levels in each sample.

A statistical analysis of the fluorescent intensities was applied to each set of duplicate spots to assess the precision and significance of each differential measurement, resulting in a p-value testing the null hypothesis that there is no differential in the expression level between the tumorigenic and non-tumorigenic cells or cells grown two-dimensionally versus three-dimensionally. During initial analysis of the microarrays, the hypothesis was accepted if p>10−3, and the differential ratio was set to 1.000 for those spots. All other spots have a significant difference in expression between the two samples compared. For example, if the tumorigenic sample has detectable expression and the non-tumorigenic does not, the ratio is truncated at 1000 since the value for expression in the non-tumorigenic sample would be zero, and the ratio would not be a mathematically useful value (e.g., infinity). If the non-tumorigenic sample has detectable expression and the tumorigenic does not, the ratio is truncated to 0.001, since the value for expression in the tumor sample would be zero and the ratio would not be a mathematically useful value. These latter two situations are referred to herein as “on/off.” Database tables were populated using a 95% confidence level (p>0.05).

In general, a polynucleotide is said to represent a significantly differentially expressed gene between two samples when there is detectable levels of expression in at least one sample and the ratio value is greater than at least about 1.2 fold, at least about 1.5 fold, or at least about 2 fold, where the ratio value is calculated using the method described above.

A differential expression ratio of 1 indicates that the expression level of the gene in tumorigenic cells was not statistically different from expression of that gene in the specific non-tumorigenic cells compared. A differential expression ratio significantly greater than 1 in tumorigenic breast cells relative to non-tumorigenic breast cells indicates that the gene is increased in expression in tumorigenic cells relative to non-tumorigenic cells, suggesting that the gene plays a role in the development of the tumorigenic phenotype, and may be involved in promoting metastasis of the cell. Detection of gene products from such genes can provide an indicator that the cell is cancerous, and may provide a therapeutic and/or diagnostic target. Likewise, a differential expression ratio significantly less than 1 in tumorigenic breast cells relative to non-tumorigenic breast cells indicates that, for example, the gene is involved in suppression of the tumorigenic phenotype. Increasing activity of the gene product encoded by such a gene, or replacing such activity, can provide the basis for chemotherapy. Such gene can also serve as markers of cancerous cells, e.g., the absence or decreased presence of the gene product in a breast cell relative to a non-tumorigenic breast cell indicates that the cell is cancerous.

Using the above methodology, three hundred and sixty-seven (367) genes or products thereof were identified from 20,000 chip clones analyzed as being overexpressed 2-fold or more in one or more of these experiments, with a p-value of 0.001 or less. These identified genes or products thereof are listed in Table 18, according to the Spot ID of the spotted polynucleotide, the Sample ID, the corresponding GenBank Accession Number (No.), the GenBank description (if available) for the corresponding Genbank Accession Number, and the GenBank score (p-value; the probability that the association between the SEQ ID NO. and the gene or product thereof occurred by chance). The polynucleotide and polypeptide sequences, as provided by any disclosed Genbank entries are herein incorporated by reference to the corresponding Genbank accession number. The differential hybridization results from the seven differential expression microarray experiments listed above are provided in Table 19, where sequences have a measurement corresponding to its ratio of expression in the 7 experiments, e.g. spot ID 10594 is 2.2-fold overexpressed in 3D T4-2 cells as compared to 3D Si cells. SEQ ID NOS:1-3004, representing the sequences corresponding to the spot Ids listed in Tables 18 and 19 are provided in the sequence listing. Table 20 is a lookup table showing the relationship between the spot Ids (i.e. the nucleic acids spotted on the microarray) and the sequences provided in the sequence listing.

TABLE 18 GENBANK GENBANK SPOTID SAMPLE ID NO GENBANK DESCRIPTION SCORE