DOUBLE KNOCKOUT (GT/CMAH-KO) PIGS, ORGANS AND TISSUES
The invention provides double knockout transgenic pigs (GT/CMAH-KO pigs) lacking expression of any functional αGAL and CMAH. Double knockout GT/CMAH-KO transgenic organs, tissues and cells are also provided. Methods of making and using the GT/CMAH-KO pigs and tissue are also provided.
This application claims priority to, and the benefit of, U.S. Provisional Patent Application No: 61/717,845, filed Oct. 24, 2012, which is incorporated herein by reference in its entirety for all purposes.
INCORPORATION OF SEQUENCE LISTINGThe sequence listing in text format submitted herewith is herein incorporated by reference in its entirety for all purposes.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENTNot applicable.
FIELD OF THE INVENTIONThe present invention is generally in the field of xenotransplantation and genetic modification to produce transgenic animals, organs tissue, or cells suitable for transplantation into a human.
BACKGROUNDIt is well known that transplants from one animal into another animal of the same species, such as human to human, are a routine treatment option for many serious conditions, including kidney, heart, lung, liver and other organ disease. However, it is also well known that there are not enough suitable organs available for transplant to meet current or expected clinical demands for organ transplants.
Xenotransplantation, the transplant of organs, tissue or cells from one animal into another animal of a different species, such as the transplantation of a pig organ into a human recipient, has the potential to eliminate the shortage of organs available for transplant, potentially helping hundreds of thousands of people worldwide. For instance, suitable organs for transplant from non-human donors, such as from a pig, could help keep seriously ill patients alive, either permanently or temporarily, until a suitable human organ is available for transplant.
While many mammalian animals may be suitable candidates for xenotransplantation, much of the current focus is on the pig. Using pig organs, tissue or cells for xenotransplantaion offers many advantages over other non-human mammalian donors. For instance, pigs are easily obtainable, they are inexpensive to breed and maintain, and, most importantly, many pig organs are similar to humans in size, shape and function.
However, xenotransplantation using standard, unmodified pig tissue into a human (or other primate) is accompanied by severe rejection of the transplanted tissue. The rejection may be a hyperacute rejection, an acute rejection or a chronic rejection. The hyperacute response to the pig antibodies present on the transplanted tissue is so strong that the transplant is typically damaged by the human immune system within minutes or hours of transplant into the human recipient.
Pig cells express α1,3 galactosyltransferase (αGal) and cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH), which are not found in human cells. The αGal enzyme produces the αGal epitope. CMAH converts the sialic acid N-acetylneuraminic acid (Neu5Ac) to N-glycolylneuraminic acid (Neu5Gc). Accordingly, when pig tissue is transplanted into a human, these epitopes elicit an antibody-mediated rejection from the human patient immediately following implantation. The antibodies are present in the patient's blood prior to implantation of the tissue, resulting in the intense and immediate rejection of the implanted tissue.
Many strategies have been employed to address the rejection caused by αGal and CMAH, including removing the genes encoding αGal or CMAH to prevent expression of the enzymes, modifying the genes encoding αGal or CMAH to reduce or limit expression of the enzymes or otherwise limiting the ability of the enzymes to trigger a rejection response. For instance, U.S. Pat. No. 7,547,816 to Day et al. describes a knockout pig with decreased expression of αGal as compared to wild-type pigs. U.S. Pat. Nos. 7,166,278 and 8,034,330 to Zhu et al. describe methods for making porcine organs for transplantation that are less likely to be subject to hyperacute rejection. However, progress in this field is critically dependent upon the development of the genetically modified pigs.
Unfortunately, developing homozygous knockout pigs is a slow process, requiring as long as three years using homologous recombination in fetal fibroblasts followed by somatic cell nuclear transfer (SCNT), and then breeding of heterozygous knockout animals. The development of new knockout pigs for xenotransplantation has been hampered by the lack of pluripotent stem cells, relying instead on the fetal fibroblast as the cell upon which genetic engineering was carried out. For instance, the production of the first live pigs lacking any functional expression of αGal (GTKO) was first reported in 2003. U.S. Pat. No. 7,795,493 to Phelps et al. describes a method for the production of a pig that lacks any expression of functional αGal.
Unfortunately, while the GTKO pig may have eliminated anti-αGal antibodies as a barrier to xenotransplantation, studies using GTKO cardiac and renal xenografts in baboons show that the GTKO organs still trigger an immunogenic response, resulting in rejection or damage to the transplanted organ. Baboons transplanted with GTKO kidneys and treated with two different immunosuppressive regimens died within 16 days of surgery. Chen et al. concluded “genetic depletion of Gal antigens does not provide a major benefit in xenograft survival” (Chen et al., 2005, Nature Med. 11(12):1295-1298. Basnet et al examined the cytotoxic response of human serum to CMAH−/− mouse cells. Basnet et al. concluded “the anti-NeuGc Ab-mediated immune response may be significantly involved in graft loss in xenogeneic cell transplantation, but not in organ transplantation” (Basnet et al., 2010, Xenotransplantation, 17(6):440-448).
Thus, there is a need in the art for an improved, simple, replicable, efficient and standardized method of producing double knockout (αGAL and CMAH) pigs having no αGAL and CMAH expression (GT/CMAH-KO) as a source of human transplant material for organs, tissue and cells for human transplant recipients.
BRIEF SUMMARYThis disclosure relates generally to methods of making porcine organs, tissues or cells for transplantation into a human that do not express αGal and CMAH.
The present disclosure provides, in one embodiment, a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein expression of functional α(1,3)-galactosyltransferase and CMAH in the knockout pig is decreased as compared to a wild-type pig and when tissue from said pig is transplanted into a human, hyperacute rejection is decreased as compared to when tissue from a wild-type pig is transplanted into a human.
In another embodiment, the specification provides porcine organs, tissue or cells for transplantation into a human having reduced expression of αGal and CMAH on the porcine organs, tissue or cells.
In another embodiment, the specification provides a method for modifying a porcine organs, tissue or cells for transplantation into a human, the method comprising removing or reducing expression of αGal and CMAH on the porcine organs, tissue or cells. The porcine organs, tissue, or cells may be selected from the group consisting of red blood cells, skin, heart, livers, kidneys, lung, pancreas, thyroid, small bowel, and components thereof.
In another embodiment, the specification provides a method for making porcine organs, tissue or cells for transplantation into a human, the method comprising reducing expression of αGal and CMAH on the porcine organs, tissue or cells. The porcine organs, tissue, or cells may be selected from the group consisting of red blood cells, skin, heart, liver, kidneys, lung, pancreas, small bowel, and components thereof.
In another embodiment, the specification provides a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein expression of functional α(1,3)-galactosyltransferase and CMAH in the knockout pig is decreased as compared to a wild-type pig and wherein a human transplanted with tissue from said pig undergoes less thrombocytopenia than a human transplanted with tissue from a wild-type pig.
In another embodiment, the specification provides a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein expression of functional α(1,3)-galactosyltransferase and CMAH in the knockout pig is decreased as compared to a wild-type pig and wherein a liver from said pig exhibits reduced uptake of human platelets when said liver is exposed to said human platelets.
In another embodiment, the specification provides a method of increasing the duration of the period between when a human subject is identified as a subject in need of human liver transplant and when said human liver transplant occurs, said method comprising providing a liver from a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein expression of functional α(1,3)-galactosyltransferase and CMAH in the knockout pig is decreased as compared to a wild-type swine and surgically attaching said liver from said knockout pig to said human subject in a therapeutically effective manner. The liver from the knockout pig may be internal or external to the human subject, and may be directly or indirectly attached to the human subject.
In another embodiment, the specification provides a method of preparing organs, tissues, or cells for xenotransplantation into human patients with reduced rejection, the method comprising providing a transgenic pig as a source of transplant material wherein the transplant material is selected from the group consisting of organs, tissues, or cells, and wherein the pig masks or reduces the expression of at least two xenoreactive antigens on the transplant material. At least two xenoreactive antigens may be αGal and Neu5Gc.
In another embodiment, the specification provides a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein the disruption of said α(1,3)-galactosyltransferase gene is a 3 base pair deletion adjacent to a G to A substitution, wherein the disruption of said CMAH gene is a four base pair insertion and wherein expression of functional α(1,3)-galactosyltransferase and CMAH in said knockout swine is decreased as compared to a wild-type swine and tissue from said knockout pig exhibits decreased hyperacute rejection as compared to tissue from a wild-type swine when transplanted into a human.
In another embodiment, the specification provides a method of improving symptoms of hyperacute rejection in a patient comprising transplanting porcine organs, tissue or cells having reduced expression of αGal and CMAH on the porcine organs, tissue or cells into a human, wherein the symptoms of hyperacute rejection are improved as compared to tissue from a wild-type swine when transplanted into a human.
In another embodiment, the disclosure provides a cell culture reagent derived from a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein the disruption of said α(1,3)-galactosyltransferase gene is a three base pair deletion adjacent to a G to A substitution, wherein the disruption of said CMAH gene is a four base pair insertion and wherein expression of functional α(1,3)-galactosyltransferase and CMAH in said knockout pig is decreased as compared to a wild-type swine. A cell culture reagent may be selected from the group of cell culture reagents comprising cell culture media, cell culture serum, a cell culture additive and an isolated cell capable of proliferation.
In a further embodiment, the invention provides a method of producing a glycoprotein of interest comprising the step of incubating an isolated cell capable of expressing the glycoprotein of interest with a cell culture reagent derived from a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein the amount of Neu5Gc or αGal epitopes on the glycoprotein of interest is lower than the amount of Neu5Gc or αGal epitopes on the glycoprotein of interest when an isolated cell capable of expressing said glycoprotein of interest is incubated with a cell culture reagent derived from a wild-type pig. The glycoprotein of interest may be selected from the group comprising an antibody, growth factor, cytokine, hormone and clotting factor. In an aspect of the disclosure, the disruption of the α(1,3)galactosyltransferase gene is a three base pair deletion adjacent to a G to A substitution, the disruption of the CMAH gene is a four base pair insertion and expression of the functional α(1,3) galactosyltransferase and CMAH in the knockout pig from which the cell culture reagent is derived is decrease compared to a wild-type pig.
While multiple embodiments are disclosed, still other embodiments of the present invention will become apparent to those skilled in the art from the following detailed description. As will be apparent, the invention is capable of modifications in various obvious aspects, all without departing from the spirit and scope of the present invention. Accordingly, the detailed descriptions are to be regarded as illustrative in nature and not restrictive.
The disclosure will be better understood and features, aspects and advantages other than those set forth above will become apparent when consideration is given to the following detailed description thereof. Such detailed description makes reference to the following drawings.
The present invention provides pigs and porcine organs, tissues or cells for transplantation into a human that do not express αGal and CMAH and methods of making the same. In one embodiment, the invention provides a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein expression of functional α(1,3)-galactosyltransferase and CMAH in the knockout pig is decreased as compared to a wild-type pig and when tissue from said pig is transplanted into a human, hyperacute rejection is decreased as compared to when tissue from a wild-type pig is transplanted into a human.
I. IN GENERALIn the specification and in the claims, the terms “including” and “comprising” are open-ended terms and should be interpreted to mean “including, but not limited to . . . .” These terms encompass the more restrictive terms “consisting essentially of” and “consisting of:”
As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. As well, the terms “a” (or “an”), “one or more” and “at least one” can be used interchangeably herein. It is also to be noted that the terms “comprising”, “including”, “characterized by” and “having” can be used interchangeably.
Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications and patents specifically mentioned herein are incorporated by reference in their entirety for all purposes including describing and disclosing the chemicals, instruments, statistical analyses and methodologies which are reported in the publications which might be used in connection with the invention. All references cited in this specification are to be taken as indicative of the level of skill in the art. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
II. THE INVENTIONThe present invention provides transgenic animals suitable for use in xenotransplantation and methods of producing mammals suitable for use in xenotransplantation. Specifically, the present invention describes the production of homozygous double knockout pigs lacking any functional expression of alpha 1,3 galactosyltransferase (αGAL) and CMAH. In one embodiment, the production of pigs with copies of the αGal and CMAH genes genes knocked out prior to somatic cell nuclear transfer (SCNT) is described. The time to create a two gene homozygous knockout took less than 10 months, significantly reducing the time required to create new pigs to speed up the progress of xenotransplantation research.
The term “knockout mammal” refers to a transgenic mammal wherein a given gene has been altered, removed or disrupted. By a “double knockout” we mean a transgenic mammal wherein two genes have been altered, removed or disrupted. It is to be emphasized that the term is intended to include all progeny generations. Thus, the founder animal and all F1, F2, F3, and so on, progeny thereof are included. In principle, knockout animals may have one or both copies of the gene sequence of interest disrupted. In the latter case, in which a homozygous disruption is present, the mutation is termed a “null” mutation. In the case where only one copy of the nucleic acid sequence of interest is disrupted, the knockout animal is termed a “heterozygous knockout animal”. The knockout animals of the invention are typically homozygous for the disruption of both genes being targeted.
The term “chimera,” “mosaic” or “chimeric mammal” refers to a transgenic mammal with a knockout in some of its genome-containing cells.
The term “heterozygote” or “heterozygotic mammal” refers to a transgenic mammal with a disruption on one of a chromosome pair in all of its genome containing cells.
The term “homozygote” or “homozygotic mammal” refers to a transgenic mammal with a disruption on both members of a chromosome pair in all of its genome-containing cells.
A “non-human mammal” of the invention includes mammals such as rodents, sheep, dogs, ovine such as lamb, bovine such as beef cattle and milk cows, and swine such as pigs and hogs. Although the invention uses a typical non-human animal (e.g., porcine), other mammals can similarly be genetically modified using the methods and compositions of the invention.
A “mutation” is a detectable change in the genetic material in the animal, which is transmitted to the animal's progeny. A mutation is usually a change in one or more deoxyribonucleotides, such as, for example, adding, deleting, inverting, or substituting nucleotides.
By “pig” we mean any pig known to the art, including a wild pig, a domestic pig, mini pigs, a Sus scrofa pig, a Sus scrofa domesticus pig, as well as inbred pigs. Without limitation, the pig can be selected from the group consisting of, for example, Landrace, Yorkshire, Hampshire, Duroc, Chinese Meishan, Chester White, Berkshire Goettingen, Landrace/York/Chester White, Yucatan, Bama Xiang Zhu, Wuzhishan, Xi Shuang Banna, and Pietrain pigs. Porcine organs, tissue or cells are organs, tissue or cells from a pig.
Transgenic Animals. The present invention provides a transgenic animal lacking any expression of functional αGal and CMAH genes. The animal can be any mammal suitable for xenotransplantation. In a specific embodiment, the animal is a pig.
Transgenic Material. In another embodiment, the invention provides organs, tissue and/or cells from animals lacking any expression of functional αGal and CMAH for use as xenografts. The tissues from animals lacking any functional expression of the αGal and CMAH gene can be obtained from a prenatal, neonatal, immature, or fully mature animal, such as a porcine, bovine or ovine. The organ may be used as a temporary or permanent organ replacement for a patient in need of an organ transplant. Any porcine organ can be used, including but not limited to the brain, heart, lungs, eye, stomach, pancreas, kidneys, liver, intestines, uterus, bladder, skin, hair, nails, ears, glands, nose, mouth, lips, spleen, gums, teeth, tongue, salivary glands, tonsils, pharynx, esophagus, large intestine, small intestine, rectum, anus, thyroid gland, thymus gland, bones, cartilage, tendons, ligaments, suprarenal capsule, skeletal muscles, smooth muscles, blood vessels, blood, spinal cord, trachea, ureters, urethra, hypothalamus, pituitary, pylorus, adrenal glands, ovaries, oviducts, uterus, vagina, mammary glands, testes, seminal vesicles, penis, lymph, lymph nodes and lymph vessels.
In another embodiment, the invention provides non-human tissues that are useful for xenotransplantation. In one embodiment, the non-human tissue is porcine tissue. Any porcine tissue can be used, including but not limited to epithelium, connective tissue, blood, bone, cartilage, muscle, nerve, adenoid, adipose, areolar, bone, brown adipose, cancellous, muscle, cartaginous, cavernous, chondroid, chromaffin, dartoic, elastic, epithelial, fatty, fibrohyaline, fibrous, Gamgee, gelatinous, granulation, gut-associated lymphoid, skeletal muscle, Haller's vascular, indifferent, interstitial, investing, islet, lymphatic, lymphoid, mesenchymal, mesonephric, multilocular adipose, mucous connective, myeloid, nasion soft, nephrogenic, nodal, osteoid, osseous, osteogenic, retiform, periapical, reticular, rubber, smooth muscle, hard hemopoietic, and subcutaneous tissue.
The invention also provides cells and cell lines from porcine animals that lack expression of functional αGal and CMAH. In one embodiment, these cells or cell lines can be used for xenotransplantation. Cells from any porcine tissue or organ can be used, including, but not limited to: epithelial cells, fibroblast cells, neural cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B and T), macrophages, monocytes, mononuclear cells, cardiac muscle cells, other muscle cells, granulosa cells, cumulus cells, epidermal cells, endothelial cells, Islets of Langerhans cells, pancreatic insulin secreting cells, pancreatic alpha-2 cells, pancreatic beta cells, pancreatic alpha-1 cells, blood cells, blood precursor cells, bone cells, bone precursor cells, neuronal stem cells, primordial stem cells, hepatocytes, keratinocytes, umbilical vein endothelial cells, aortic endothelial cells, microvascular endothelial cells, fibroblasts, liver stellate cells, aortic smooth muscle cells, cardiac myocytes, neurons, Kupffer cells, smooth muscle cells, Schwann cells, and epithelial cells, erythrocytes, platelets, neutrophils, lymphocytes, monocytes, eosinophils, basophils, adipocytes, chondrocytes, pancreatic islet cells, thyroid cells, parathyroid cells, parotid cells, tumor cells, glial cells, astrocytes, red blood cells, white blood cells, macrophages, epithelial cells, somatic cells, pituitary cells, adrenal cells, hair cells, bladder cells, kidney cells, retinal cells, rod cells, cone cells, heart cells, pacemaker cells, spleen cells, antigen presenting cells, memory cells, T cells, B cells, plasma cells, muscle cells, ovarian cells, uterine cells, prostate cells, vaginal epithelial cells, sperm cells, testicular cells, germ cells, egg cells, leydig cells, peritubular cells, sertoli cells, lutein cells, cervical cells, endometrial cells, mammary cells, follicle cells, mucous cells, ciliated cells, nonkeratinized epithelial cells, keratinized epithelial cells, lung cells, goblet cells, columnar epithelial cells, dopamiergic cells, squamous epithelial cells, osteocytes, osteoblasts, osteoclasts, dopaminergic cells, embryonic stem cells, fibroblasts and fetal fibroblasts.
Nonviable derivatives include tissues stripped of viable cells by enzymatic or chemical treatment these tissue derivatives can be further processed through crosslinking or other chemical treatments prior to use in transplantation. In a preferred embodiment, the derivatives include extracelluar matrix derived from a variety of tissues, including skin, urinary, bladder or organ submucosal tissues. In addition, tendons, joints and bones stripped of viable tissue to include heart valves and other nonviable tissues as medical devices are provided. In an embodiment, serum or medium suitable for cell culture are provided.
In an embodiment, a cell culture reagent derived from a transgenic pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes is provided. Cell culture reagents are reagents utilized for tissue culture, in vitro tissue culture, microfluidic tissue culture, cell culture or other means of growing isolated cells or cell lines. Cell culture reagents may include but are not limited to cell culture media, cell culture serum, a cell culture additive, a feeder cell, and an isolated cell capable of proliferation. By an “isolated cell capable of proliferation” is intended a cell isolated or partially isolated from other cell types or other cells wherein the cell is capable of proliferating, dividing, or multiplying into at least one additional clonal cell.
Cells grown in culture may synthesize or metabolically incorporate antigenic epitopes into glycoproteins secreted by the cultured cell. The antigenic epitopes may result in increased binding by human antibodies and decreased efficacy of the glycoprotein. See Ghaderi et al, 2010 Nature Biotechnology 28(8):863-867, herein incorporated by reference in its entirety. Growing the producing cell in a cell culture reagent with less αGal or Neu5Gc may reduce the amount of αGal, Neu5Gc, or both αGal and Neu5Gc epitopes on the glycoprotein of interest. Glycoproteins of interest may include any glycoprotein, particularly glycoproteins intended for use in human subjects such as but not limited to, an antibody, growth factor, cytokine, hormone, or clotting factor.
In summary, xenoantigens αGal and Neu5Gc were eliminated in transgenic pigs by genetic modification. The double knockout pigs (GT/CMAH-KO) were produced within 5-10 months.
In embodiments of the present invention, tissues are provided in which both the αGal and CMAH genes are rendered inactive, such that the resultant αGal and CMAH products can no longer generate alpha 1,3-galactosyl epitopes or Neu5Gc on the cell surface. In an alternative embodiment, the αGal and CMAH genes can be inactivated in such a way that no transcription of the gene occurs.
In yet another aspect, the present invention provides a method for producing viable pigs lacking any functional expression of αGal and CMAH. In one embodiment, the pigs are produced as described below. Methods of making transgenic pigs, and the challenges thereto, are discussed in Galli et al. 2010 Xenotransplantation, 17(6) p. 397-410, incorporated by reference herein for all purposes. The methods and cell cultures of the invention are further detailed below.
In another embodiment, the invention provides a method of improving symptoms of hyperacute rejection in a patient comprising transplanting porcine organs, tissue or cells having reduced expression of αGal and Neu5Gc on the porcine organs, tissue or cells into a human, wherein the symptoms of hyperacute rejection are improved as compared to tissue from a wild-type swine when transplanted into a human. By “symptoms of hyperacute rejection” we mean any symptom known to the field as related to or caused by rejection. By “hyperacute rejection” we mean rejection of the transplanted material or tissue occurring within the first 24 hours post-transplant involving one or more mechanisms of rejection. Hyperacute rejection encompasses but is not limited to “acute humoral rejection” or “antibody mediated rejection”. By “improving” we mean any improvement recognized by one of skill in the art as related to the transplanted material.
III. EXAMPLESThe following Examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and the following examples and fall within the scope of the appended claims.
Example 1 Design of Zinc Finger Nucleases (ZFN)A pair of ZFN were designed to bind and cleave the sequence of porcine CMAH exon 9 (SEQ ID NO: 1-AAACTCCTGAACTACAAGGCTCGGCTGGTGAAGGA) beginning at position 1,341 of Ensemble transcript ENSSSCT00000001195. Another pair of ZFN were designed to bind and cleave the region of GGTA1 exon 8 (SEQ ID NO: 2-GTCATCTTTTACATCATGGTGGATGATATCTCCAGGATGCC) beginning at position 1165 of Ensemble transcript ENSSSCT00000006069. The ZFN activities were validated in yeast (Sigma-Aldrich, St. Louis, Mo.). Additional detail regarding the ZFN of the present invention can be found in Li et al., Journal of Surgical Research, (2012)E1-E7 Epub 2012 Jul. 3, which is incorporated by reference herein for all purposes.
Example 2 Cell Culture and Transfection of Porcine Liver Derived CellsPorcine adult liver derived cells (LDC) were isolated with modifications from the method described in Li et al, 2010 Cell Reprogram. 12:599. Isolated LDC were cultured in a combination stem cell media (SCM) (α-MEM:EGM-MV 3:1) (Invitrogen/Lonza, Switzerland) supplemented with 10% fetal bovine serum (FBS) (Hyclone, Logan, Utah), 10% horse serum (Invitrogen, Carlsbad, Calif.), 12 mM HEPES, and 1% Pen/Strep (Invitrogen) as described in Li et al 2012 JSR Epub 2012 Jul. 3. A commercial porcine strain (Landrace/York/Chester White) was used as the source of the LDC. Neon transfection system was used according to the manufacturer's instruction (Invitrogen).
Briefly, LDC were harvested by trypsin digestion, washed with calcium and magnesium free Dulbecco's phosphate buffered saline (DPBS) (Invitrogen) and centrifuged. 106 cells were suspended in 120 μl of resuspension buffer (Invitrogen) containing 2 μgs of each CMAH ZFN plasmid. pEGFP-N 1 (Clonetech, Mountain View, Calif.) was used as a control to measure transfection efficiency as well as ZFN activity. Cells were electroporated at 1300 V, 30 msec for 1 pulse.
Then cells were transferred in SCM without antibiotics and plated onto collagen I coated plates. Cells were cultured with 5% CO2 and 10% O2 at 30° C. for 3 days and 37° C. for 2 days.
Example 3 Surveyor Mutation Detection Assay (CEL I Assay)ZFN-induced mutation was detected using the Surveyor Mutation Detection kit (Transgenomic, Omaha, Nebr.). At day 5 post-transfection, genomic DNA from ZFN-treated and control plasmid pEGFP-N1 treated cells was extracted and PCR was performed using primers ZFN-CMAH-F (SEQ ID NO: 3-5′ GGACCTGCTTTATCTTGCTCGC 3′), ZFN-CMAH-R (SEQ ID NO: 4-5′ CCATACTTGTCTGCTGGGTGGG 3′). Pwo SuperYield DNA Polymerase, dNTPack (Roche, Indianapolis, Ind.) was used and the PCR conditions were as follows: 94° C., 2 minutes; 94° C., 15 seconds, 55° C., 30 seconds and 68° C., 50 seconds for 15 cycles; 94° C., 15 seconds, 5 5° C., 30 seconds and 68° C., 50 seconds with additional 5 seconds for each cycle, for 25 cycles and a final extension step of 68° C. for 5 minutes.
PCR product was denatured and annealed using the following program on a MyCycler (Bio-Rad): 95° C., 10 minutes; 95° C. to 85° C., −2° C./second; 85° C. to 25° C., −0.1° C./second. 200-400 ng of PCR product was digested with 1 μl of Nuclease S and 1 μl of enhancer (Transgenomic, Omaha, Nebr.) at 42° C. for 40 minutes. The product was separated on a 10% polyacrylamide gel and stained with SYBR Safe to assess ZFN-induced mutations.
Example 4 Screening CMAH Mutant CellsZFN-treated cells were plated at 1 cell/well in ten 96-well plates coated with collagen I (BD, Franklin Lakes N.J.). After 14 days, single cell clones became evident. Cells were expanded to 48-well plate. Some cells were harvested for mutation screening. PCR was performed as described above herein. PCR products were resolved on a 0.8% agarose gel and purified by QIAquick Gel Extraction Kit (Qiagen). Primer CMAH-S1 (SEQ ID NO: 5-5′ CCAAACCCTGTCATTCCAG 3′) was used to sequence the ZFN targeted CMAH region. A clone with an identical mutation in both CMAH gene copies was identified.
Disruption of GGTA 1 gene on CMAH mutant cells and counter selection of α-Gal− cells 106 of CMAH mutant cells were transfected with 2 μgs of each GGTA1 ZFN plasmid as described below herein. αGal− cells were isolated by the counter selection method described below herein.
Example 5 Counter Selection of αGal− CellsCMAH deficient LDC were treated with zinc finger plasmids targeting porcine 1,3 αGal. The cells were harvested, washed and counted. A total of 2.3×106 cells were incubated with 5 μg of biotin-conjugated Griffonia simplicifolia isolectin IB4 (IB4 lectin from Enzo Life Science, Farmingdale N.Y.) in 600 μl of PBS supplemented with 0.1% BSA and 2 mM ethylenediaminetetracetic acid (pH 7.4) on ice for 30 minutes. After 30 minutes, the cells were washed once and incubated with 50 μl Dynabeads Biotin Binder (Invitrogen) at 4° C. with rotation for 30 minutes. A magnet was applied to deplete Dynabeads-bound α-Gal+ cells. The IB4 lectin is specific for the Gal epitope; cells that did not bind the Dynabeads remained in the supernatant. CMAH cells that did not bind IB4 and the Dynabeads were identified as Gal−/− cells.
Example 6 TALEN ConstructsTALEN constructs are designed to bind and cleave the sequence of porcine CMAH at a suitable site. Additional Talen constructs are designed to bind and cleave GGTA1 at a suitable site.
Example 7 Production of Double Knockout (αGal and CMAH) PigsSomatic Cell Nuclear Transfer (SCNT) was performed using in vitro matured oocytes (DeSoto Biosciences Inc., St. Seymour Tenn. and Minitube of America, Mount Horeb, Wis.). Cumulus cells were removed from the oocytes by pipetting in 0.1% hyaluronidase. Oocytes with normal morphology and a visible polar body were selected and incubated in manipulation media (calcium-free NCSU-23 with 5% fetal bovine serum (FBS) containing 5 μg/ml bisbenzimide and 7.5 μg/mL cytochalasin B for 15 minutes. Following this incubation period, oocytes were enucleated by removing the first polar body and metaphase II plate. Single cells of CMAH deficient LDC that survived IB4 counterselection were injected into each enucleated oocyte. Electrical fusion was induced with a BTX cell electroporator (Harvard Apparatus, Holliston, Mass.). Enucleated oocytes injected with a cell (couples) were exposed to two DC pulses of 140 V for 50 is in 280 mM mannitol, 0.001 mM CaCl2 and 0.05 mM MgCl2. After one hour, reconstructed oocytes were activated by two DC pulses of 120 V for 60 is in 280 mM mannitol, 0.1 mM CaCl2 and 0.05 mM MgCl2. After activation, oocytes were placed in NCSU-23 medium with 0.4% bovine serum albumin (BSA) and incubated at 38.5° C., 5% CO2 in a humidified atmosphere for less than one hour. Within an hour after activation, oocytes were transferred into a recipient pig. Recipient pigs were synchronized occidental pigs on their first day of estrus. Pregnancies were verified by ultrasound at day 25 or day 26 after embryo transfer. Results of SCNT using double knockout cells are summarized in Table 1.
Double-KO cells (cl22) were used as donor cells in SCNT and transferred into 2 recipients, 01 and 02. Fetal fibroblasts from fetus number 1 of recipient 02 were re-cloned and transferred to animals 03, 04, 05, and 06. Four hundred seventy seven (477) embryos were delivered to four gilts, resulting in one pregnancy and the birth of 5 piglets. The four viable piglets appeared healthy as they were nursing since birth and needed no feeding support.
In at least one experiment, SCNT of the selected cells deficient for CMAH and GGTA1 resulted in a pregnancy that was terminated at day 30 of gestation. Five normal fetuses and one resorbed fetus were harvested, photographed and shown in
Fibroblasts were grown from fetus number one. The fibroblasts were utilized in SCNT to generate 477 embryos which were transferred into four recipient gilts. The SCNT resulted in one pregnancy and the birth of four live piglets and one stillborn piglet. The four viable piglets needed no feeding support and appeared healthy. Three of the αGal/CMAH double knockout pigs are shown in
Somatic Cell Nuclear Transfer. All the animals used in this study were approved by Institutional Biosafety Committee (IBC) and Institutional Animal Care and Use Committee (IACUC).
Example 8 DNA Sequencing Analysis of Targeted CMAH and GGTA1 RegionsGenomic DNA from cloned fetuses and the four viable piglets was extracted using DNeasy Blood & Tissue Kit (Qiagen, Valencia, Calif.). PCR amplification of the CMAH region was performed as described above herein.
Primer CMAH-S1 (SEQ ID NO:5 (5′ CCAAACCCTGTCATTCCAG 3′)) and GGTA1-F primer (SEQ ID NO:6 (5′ CTAGAAATCCCAGAGGTTAC 3′)) were used to sequence the targeted CMAH region and GGTA1 region, respectively.
The GGTA1 region was amplified by PCR using the GGTA1-F primer (SEQ ID NO:6 (5′ CTAGAAATCCCAGAGGTTAC 3′)) and GGTA1-R primer (SEQ ID NO:7 (5′TCCTTGTCCTGGAGGATTCC3′)). Pwo Master (Roche, Indianapolis Ind.) was used and PCR conditions were as follows: 94° C., 2 min; 94° C., 15 s, 57° C., 30 s, and 72° C., 30 s for 40 cycles; and a final extension step of 72° C. for 5 min. A total of 200-400 ng of PCR product was denatured and annealed using the following program on a Mycycler (Bio-Rad): 95° C., 10 min; 95° to 85° C., −2° C./s; 85° C. to 25° C., −0.1° C./s. One microliter of enhancer and 1 μl of Nuclease S (Transgenomic Omaha Nebr.) was added to each reaction and incubated at 42° C. for 40 minutes. The product was separated on a 10% polyacrylamide gel and stained with SYBR Safe (Invitrogen USA Eugene Oreg.).
Results from an exemplary DNA sequence analysis are shown in
Fetal livers were removed from double knockout fetuses and incubated in RPMI1640 for 24 hours at 37° C. RBCs were collected from cells released into the media after incubation of the fetal livers. RBC's were also obtained from adult human donors, six month old wild-type pigs and GGTA-knockout pigs (GGTA-KO pigs (fetal or 6 month old)). Porcine and human peripheral blood monocytes (PBMCs) were prepared using Ficoll-Paque Plus from whole blood collected in anticoagulant citrate dextrose (ACD).
Cells were stained with IB4 lectin Alexa Fluor 647 (Invitrogen, Grand Island, N.Y.) and anti-Neu5Gc antibody (Sialix, Vista Calif.). A negative control antibody for comparison with anti-Neu5Gc antibody was also used (Sialix, Vista Calif.). Cells were incubated with IB4 lectin for 20 minutes at 4° C. The cells were washed with blocking agent (Sialix, Vista, Ca) diluted in HBSS. Gal epitopes bind IB4 lectin. Cells were then stained with anti-Neu5Gc antibody for one hour at 4° C. followed by Donkey anti-chicken DyLight 649 (Jackson ImmunoResearch Laboratories Inc, West Grove Pa.) for 40-60 minutes at 4° C. Cells stained with anti-Neu5Gc antibody were washed before and after secondary antibody with Sialix blocking agent diluted in PBS. In various experiments unstained RBC or PBMC were used as negative controls for IB4 lectin staining. An Accuri C6 flow cytometer and CFlow Software (Accuri, Ann Arbor, Mich.) were used for analysis.
FACS analysis validated the absence of functional GGTA1 and CMAH genes eliminated the α-Gal and Neu5Gc modifications on the RBCs isolated from the cloned fetuses. Results obtained from one such experiment are shown in
One of the four double knockout (Double-KO, DKO, CMAH−/αGAL−) piglets was euthanized. Liver, heart and kidney tissues were obtained from the double-ko pig. Liver, heart and kidney tissues were also obtained from wild-type (WT) and GGTA1 knockout (GGTA-ko) pigs. Frozen sections of each tissue were prepared. Mounted tissues were blocked in Odyssey blocking buffer (LI-Cor Biosciences, Lincoln Nebr.) in HBSS for one hour. The slides were then fixed in 4% paraformaldehyde for 10 minutes. Tissues were stained with IB4 lectin Alexa Fluor 647 (Invitrogen, Grand Island N.Y.) to visualize the presence of the Gal epitope. To visualize the Neu5Gc epitope, tissues were stained with a chicken anti-Neu5Gc antibody or with a control antibody (Sialix, Vista, Calif.) for one hour. Tissues were washed three times with HBSS. Donkey anti-chicken DyLight 649 (Jackson ImmunoResearch Laboratories Inc., West Grove Pa.) secondary antibody was incubated with the tissue for approximately one hour. Tissues were washed three times with 0.1% HBSS Tween. To stain the nucleus, DAPI stain (Invitrogen, Grand Island N.Y.) was added to all the slides for 1 minute followed by two 0.1% HBSS Tween washes. Tissues were mounted in ProLong Gold (Invitrogen, Grand Island N.Y.). Confocal microscopy was performed using an Olympus FV1000.
Confocal microscopy indicated the presence of α-Gal and Neu5Gc in liver, heart and kidney tissues obtained from a wild-type pig. GGTA1-KO pigs displayed only Neu5Gc in liver, heart and kidney tissues. Confocal microscopy indicated the absence of α-Gal and Neu5Gc in liver, heart and kidney in tissues obtained from a double knockout piglet (exemplary fields are shown in
Porcine whole blood from GGTA1-KO and double-KO pigs was collected in ACD. Porcine PBMC's were prepared from the whole blood using Ficoll-Paque Plus. Cell viability was assessed microscopically with Trypan Blue. Sera were obtained from ten healthy human volunteers. Twenty-five percent heat-inactivated serum was prepared. Approximately 2×106/ml GGTA-KO and double-KO PBMCs were incubated with each human serum sample for 2 hours at 4° C. After incubation of the serum and PBMCs, the PBMCs were washed three times in 0.5% PBS Sialix Blocking agent. PBMCs were stained with DyLight 649-conjugated Donkey anti-human IgM or DyLight 488 Donkey anti-human IgG (Jackson Immunoresearch Laboratories Inc, West Grove Pa.) for 1 hour at 4° C. PBMCs were washed three times using 0.5% PBS Sialix blocking agent. Analyses were performed using an Accuri C6 flow cytometer and BD CFlow Plus Software (Accuri, Ann Arbor Mich.). Overlays were produced using Kaluza version 1.2 software from Beckman Coulter (Brea, Calif.). A representative histogram is shown in
Lower Mean fluorescent Intensities (MFI) of double-KO PBMCs indicate less IgM bound to double-KO cells than to GGTA1-KO cells in 9 of 10 samples. In an experiment, the median MFI observed for human IgM binding to double-KO and GGTA-KO PBMCs were 4,411 and 15,059 respectively (n=10, p=0.0039). Lower MFI of double-KO PBMCs indicate less IgG bound to double-KO cells than to GGTA1-KO cells in 10 of 10 samples. In an experiment, the median MFI observed for human IgG binding to double-KO and GGTA-KO PBMC were 714 and 2306 respectively (n=10, p=0.002). (
Antibody-mediated complement dependent cytotoxicity assays are known in the art. A modified method of Diaz et al (Diaz et al, 2004, Transplant Immunology 13(4):313-317) was performed. Human serum was obtained from ten healthy volunteers (
The percentage of dead cells (PI+/FDA−), damaged cells (PI+/FDA+) and live cells (PI−/FDA+) was determined. Double negative events (PI−/FDA−) were excluded from calculations. The percentage of cytotoxicity in cells not exposed to serum was considered spontaneous killing (% CTXspont). Values for cytotoxicity (% CTX) are shown after correction for spontaneous cytotoxicity (% CTXspont), using the following formula:
% CTX=(% CTXexp−% CTXspont)/(100−% CTXspont)×100, where % CTXexp is the percentage of dead cells under the experimental condition.
Data from a series of antibody-mediated complement dependent cytotoxicity assays are shown in
Flow cytometric crossmatch results were reported as medians of the MFI values for each human serum crossmatched with GGTA1-KO and double-KO PBMCs for both IgM and IgG. The Wilcoxon matched pairs signed rank test was used to analyze the data using Prism 5 for Windows (GraphPad Software Inc, La Jolla Calif.).
Antibody-mediated, complement dependent cytotoxicity data was also analyzed as above. The log of each serum dilution was plotted against the % CTX for each sample and the sigmoid curve was analyzed by non-linear regression to estimate the serum LD50. The % CTX of GGTA1-KO and double-KO PBMCs at each serum dilution for each sample was analyzed using the Wilcoxon matched pairs signed rank test.
Example 14 Ex Vivo Perfusion of Human Platelet Through a Double KO LiverA double knockout CMAH/αGal pig is anesthetized and intubated. A midline abdominal incision is made. The liver is removed and placed in a perfusion device under normothermic conditions. Humidity, temperature and air flow are maintained in the perfusion device. Human platelets obtained from healthy volunteer subjects are circulated through the double knockout liver. Platelet levels in the pre-perfusion and post-perfusion samples are evaluated. Pre and post-perfusion evaluation of the pig liver is performed.
Example 15 Evaluation of Response to a Double Knockout (αGal and CMAH) XenograftA porcine liver obtained from double knockout (αGal−/CMAH−) pigs is surgically transplanted into a recently deceased human cadaver using the piggyback method. After the surgery, biological samples are obtained from the human cadaver. Clinical indicia of graft rejection are monitored.
Example 16 Evaluation of a Response to a Double Knockout (αGal and CMAH) XenograftPorcine kidneys are obtained from double knockout (GGTA1/CMAH double-KO) pigs. A highly sensitized human subject is administered compounds to manage preexisting and de novo donor-specific antibodies. Porcine double-KO kidneys are surgically transplanted into the subject. Clinical indicia of graft rejection are monitored.
The invention is not limited to the embodiments set forth herein for illustration, but includes everything that is within the scope of the claims. Furthermore, all references cited herein are hereby incorporated by reference in their entirety and for all purposes as if fully set forth herein.
Claims
1. A knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein expression of functional α(1,3)-galactosyltransferase and CMAH in the knockout pig is decreased as compared to a wild-type pig and when tissue from said pig is transplanted into a human, hyperacute rejection is decreased as compared to when tissue from a wild-type pig is transplanted into a human.
2. Porcine organs, tissue or cells for transplantation into a human having reduced expression of αGal and Neu5Gc on the porcine organs, tissue or cells.
3. A method for modifying a porcine organs, tissue or cells for transplantation into a human, the method comprising removing or reducing expression of αGal and Neu5Gc on the porcine organs, tissue or cells.
4. The method of claim 3 wherein the porcine organs, tissue, or cells are selected from the group consisting of skin, heart, liver, kidneys, lung, pancreas, thyroid, small bowel, and components thereof.
5. A method for making porcine organs, tissue or cells for transplantation into a human, the method comprising reducing expression of αGal and CMAH on the porcine organs, tissue or cells.
6. The method of claim 5 wherein said porcine organs, tissue, or cells are selected from the group consisting of skin, heart, liver, kidneys, lung, pancreas, small bowel, and components thereof.
7. A knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein expression of functional α(1,3)-galactosyltransferase and CMAH in the knockout pig is decreased as compared to a wild-type pig and wherein when tissue from said knockout pig is transplanted into a human, thrombocytopenia is decreased as compared to when tissue from a wild-type pig is transplanted into a human.
8. A knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein expression of functional α(1,3)-galactosyltransferase and CMAH in the knockout pig is decreased as compared to a wild-type pig and wherein a liver from said pig exhibits reduced uptake of human platelets when said liver is exposed to said human platelets.
9. A method of increasing the duration of the period between when a human subject is identified as a subject in need of human liver transplant and when said human liver transplant occurs, said method comprising providing a liver from a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein expression of functional α(1,3)-galactosyltransferase and CMAH in the knockout pig is decreased as compared to a wild-type pig, and surgically attaching said liver from said knockout pig to said human subject in a therapeutically effective manner.
10. The method of claim 9, wherein said liver from said knockout pig is internal to said human subject.
11. The method of claim 9, wherein said liver from said knockout pig is external to said human subject.
12. The method of claim 9, wherein said liver is directly or indirectly attached to said subject.
13. A method of preparing organs, tissues, or cells for xenotransplantation into human patients with reduced rejection, the method comprising providing a transgenic pig as a source of transplant material wherein the transplant material is selected from the group consisting of organs, tissues, or cells, and wherein the pig masks or reduces the expression of at least two xenoreactive antigens on the transplant material.
14. The method of claim 13, wherein the at least two xenoreactive antigens are αGal and Neu5Gc.
15. A knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein the disruption of said α(1,3)-galactosyltransferase gene is a 3 base pair deletion adjacent to a G to A substitution, wherein the disruption of said CMAH gene is a four base pair insertion and wherein expression of functional α(1,3)-galactosyltransferase and CMAH in said knockout pig is decreased as compared to a wild-type pig and when tissue from said knockout pig is transplanted into a human, hyperacute rejection is decreased as compared to when tissue from a wild-type pig is transplanted into a human.
16. A method of improving symptoms of hyperacute rejection in a patient comprising transplanting porcine organs, tissue or cells having reduced expression of αGal and CMAH into a human, wherein the symptoms of hyperacute rejection are improved as compared to when tissue from a wild-type swine is transplanted into a human.
17. A cell culture reagent derived from a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein the disruption of said α(1,3)-galactosyltransferase gene is a 3 base pair deletion adjacent to a G to A substitution, wherein the disruption of said CMAH gene is a four base pair insertion and wherein expression of functional α(1,3)-galactosyltransferase and CMAH in said knockout pig is decreased as compared to a wild-type pig, wherein said cell culture reagent is selected from the group comprising cell culture media, cell culture serum, cell culture additive and an isolated cell capable of proliferation.
18. A method of producing a glycoprotein of interest, said method comprising the step of incubating an isolated cell capable of expressing said glycoprotein of interest with a cell culture reagent derived from a knockout pig comprising disrupted α(1,3)-galactosyltransferase and CMAH genes, wherein the amount of Neu5Gc or alphaGal epitopes on said glycoprotein of interest is lower than the amount of Neu5Gc or alphaGal epitopes on said glycoprotein of interest when said isolated cell capable of expressing said glycoprotein of interest is incubated with a cell culture reagent derived from a wild-type pig.
19. The method of claim 18 wherein said glycoprotein of interest is a glycoprotein selected from the group comprising an antibody, growth factor, cytokine, hormone and clotting factor.
20. The method of claim 18, wherein the disruption of said α(1,3)-galactosyltransferase gene is a 3 base pair deletion adjacent to a G to A substitution, wherein the disruption of said CMAH gene is a four base pair insertion and wherein expression of functional α(1,3)-galactosyltransferase and CMAH in said knockout pig is decreased as compared to a wild-type pig.
Type: Application
Filed: Mar 14, 2013
Publication Date: Apr 24, 2014
Inventor: A. Joseph Tector (Carmel, IN)
Application Number: 13/804,365
International Classification: C12N 9/10 (20060101); C12N 9/02 (20060101); C12N 15/85 (20060101); A01K 67/027 (20060101); A61K 35/407 (20060101);
