Transcriptional inhibitor protein and the encoding DNA

Abstract

A protein having transcription inhibitory activity and lacking at least a part of regions other than a region having DNA binding activity in a transcriptional regulatory factor is provided. This protein can be obtained by isolating cDNA encoding a protein capable of binding to the transcriptional regulatory region of the gene transcription of which is to be inhibited, deleting from the cDNA at least a part of the regions other than the region having DNA-binding activity, inserting the resulting DNA into an appropriate vector, introducing said vector into cells to allow them to express the deleted gene, and isolating and purifying a protein showing the transcription inhibitory activity. For example, the protein can be used in the field of pharmaceuticals as a therapeutic agent. Its use in the field of gene therapy is also expected.

Description

This application is a Continuation-in-Part of U.S. application Ser. No. 09/308,160, filed on Jun. 16, 1999 which is a continuation of PCT/JP97/04127 filed Nov. 12, 1997.

TECHNICAL FIELD

The present invention relates to the field of genetic engineering. For example, the protein of the present invention can be used in the field of pharmaceuticals as a therapeutic agent.

BACKGROUND ART

A gene is transcribed by forming a transcription initiation complex including RNA polymerase bound to the promoter region upstream to the gene. Gene transcription is considered to be regulated mainly by transcriptional regulatory factors binding to the promoter and interactive with the transcription initiation complex. In general, a transcriptional regulatory factor comprises a DNA binding region and a transcriptional activation region. The transcriptional activation region is considered to be involved in the interaction.

The relation between the expression of specific genes and various diseases has been revealed in the field of medical treatment. For example, the expression of cytokine genes, such as TNF (Molecular Medicine 33: 1010-1020 (1996)), IL-1 (Clin. Immunol. 27: 18-28 (1995)), and IL-8 (Clin. Immunol. 27: 80-85 (1995)), are reported to be associated with various diseases, including inflammation. Hyperactivated transcription of IL-2 is involved in the immune diseases such as graft rejection.

Furthermore, diseases for which there is currently no effective treatment, such as virus infections including cancer and AIDS, can be controlled if expression of a responsible cancer gene (such as c-Myc) and virus gene is inhibited.

Such diseases can be treated if the transcriptional regulatory factor involved in the disease is isolated and its function is controlled. Therefore, transcriptional regulatory factors drew much attention as targets for developing new drugs.

An inhibitor of a transcriptional regulatory factor has been screened by a DNA binding inhibitory experiment in a chemical library or natural substances derived from bacteria or plants, or by drug design based on the structure of a gene or a transcriptional factor to be controlled (Peterson, M. G. et al., Trends Biotechnol. 11: 11-18 (1993).

The DNA binding inhibitory experiment requires screening numerous samples. However, there is no effective method of screening at present.

Furthermore, drug design requires that the structure of transcriptional regulatory factors must be known in detail. Therefore, its application is limited.

DISCLOSURE OF THE INVENTION

An objective of the present invention is to provide a transcriptional regulatory factor having transcription-inhibitory activity, more specifically, a transcriptional regulatory factor having transcription-inhibitory activity on a specific promoter.

Normal animal cells contain hypoxanthine-guanine phosphoribosyl-transferase (HGPRT), thus, uptake 6-thioguanine (6-TG) in their nucleic acid synthetic pathway. Those cells die in a 6-TG-containing medium due to its toxicity. In contrast, HGPRT-deficient mutant cells survive and proliferate in the 6-TG-containing medium, unaffected by the toxicity because those cells do not uptake 6-thioguanine (6-TG) in the nucleic acid synthetic pathway. Therefore, in the HGPRT-deficient mutant cells, the survival of the cells in the presence of 6-thioguanine (6-TG) can be determined by controlling the expression of HGPRT (or a protein with a similar function). The present inventors constructed the system to search for a gene involved in intracellular signal transduction, using the above characteristics of the HGPRT-deficient mutant cells.

It is evident that a promoter of the interleukin 8 gene (IL-8) is activated in response to stimulation by a tumor necrosis factor (TNF). The present inventors prepared an expression plasmid carrying a xanthine-guanine phosphoribosyl-transferase (gpt) gene which causes cell death when expressed in the presence of 6-TG similarly to HGPRT, by inserting the gene downstream to the IL-8 promoter sequence in the plasmid vector, and introduced the resultant plasmid into HGPRT-deficient cells. The cells die in the presence of a suitable quantity of 6-TG in response to the TNF stimulation because of the expression of gpt gene. However, when a certain gene capable of inhibiting the signal transduction pathway from the TNF stimulation to the activation of the IL-8 promoter is introduced into the above cells, the expression of gpt can be inhibited and then the cells survive. Therefore, genes capable of inhibiting the intracellular signal transduction can be isolated by introducing various genes in said cells and selecting surviving cells.

The present inventors successfully isolated four genes (S1-15, S1-b2, S2-3, and S20-1) which were suppressive for IL-8 promoter activation from a cDNA library by using the above screening system. The present inventors specifically analyzed “S1-15” which consistently exhibited IL-8 promoter inhibitory activity.

First, the present inventors determined the sequence of “S1-15.” Homology searches based on the determined nucleotide sequence found two homologous genes which were reported as those encoding transcriptional regulatory factors.

The present inventors noticed that the transcriptional regulatory factors, which were supposed to enhance transcription inherently, were in fact inhibitory for IL-8 promoter. Then, the present inventors analyzed the amino acid sequence of S1-15 in more detail. They found that S1-15 comprised a DNA binding region within the above transcriptional regulatory factor but lacked most of the rest, including the regions that interact with other factors involved in transcription.

Finally, the present inventors found that the transcriptional regulatory factors can be modified into transcriptional inhibitory factors by deleting sequences other than regions having DNA binding activity of transcriptional regulatory factors.

Based on the fact that S1-15 inhibits the activation of IL-18 promoter, the present inventors subsequently analyzed whether S1-15 has anti-inflammatory activity. The result demonstrated that S1-15 strongly inhibits the human IL-8 production stimulated with IL-1 &bgr; in MRC-5 cells. It also inhibited the production by IL-1 &bgr;-stimulated MRC cells of a neutrophil chemotactic factor GRO &agr; at the level comparable to the inhibition of IL-8 production. Thus, the present inventors have found that S1-15 is a protein having a potent anti-inflammatory activity.

Specifically, the present invention relates to:

(1) a protein having transcription inhibitory activity and lacking at least a part of regions other than a region having DNA binding activity in a transcriptional regulatory factor,

(2) the protein of (1), wherein said protein lacks at least a part of the region interacting with other factors involved in transcription in the transcriptional regulatory factor,

(3) a protein having inhibitory activity on transcription of interleukin 8 gene and having the amino acid sequence of SEQ ID NO: 1, or said amino acid sequence in which one or more amino acid residues are substituted, deleted, or added,

(4) a protein having the amino acid sequence of SEQ ID NO: 1,

(5) a DNA encoding the protein of (1) to (4),

(6) a vector comprising the DNA of (5),

(7) a cell carrying the vector of (6),

(8) a method of inhibiting transcription of a specific gene, which comprises introducing the protein of (1) or (2) into cells,

(9) a method of inhibiting transcription of the interleukin 8 gene, which comprises introducing the protein of (3) or (4) into cells,

(10) a method of inhibiting transcription of a specific gene, which comprises introducing a vector comprising DNA encoding the protein of (1) or (2) into cells and allowing the protein of (1) or (2) to be expressed in the cells,

(11) a method of inhibiting transcription of the interleukin 8 gene, which comprises introducing a vector comprising DNA encoding the protein of (3) or (4) into cells and allowing the protein of (3) or (4) to be expressed in the cells.

The invention also includes a substantially pure polypeptide comprising (1) an amino acid sequence at least 60% (e.g., 70%, 80%, 90%, 95%, or 99%) identical to SEQ ID NO: 1, (2) an amino acid sequence that is SEQ ID NO: 1 containing at least one conservative amino acid substitution (preferably between 1-30, and more preferably 15 or fewer (e.g., 5 or fewer or even 3 or fewer) substitutions), or (3) encoded by a first nucleic acid consisting of SEQ ID NO: 1. The polypeptide can inhibit transcription of interleukin 8.

The invention also features an isolated nucleic acid encoding a polypeptide of the invention.

The invention further features vectors and transformed host cells, containing a nucleic acid of the invention.

Also features in the invention is a method of inhibiting transcription of the interleukin 8 gene, the method comprising introducing into cells a substantially pure polypeptide comprising (1) an amino acid sequence at least 60% (e.g., 70%, 80%, 90%, 95%, or 99%) identical to SEQ ID NO: 1, (2) an amino acid sequence that is SEQ ID NO: 1 containing at least one conservative amino acid substitution (preferably between 1-30, and more preferably 15 or fewer (e.g., 5 or fewer or even 3 or fewer) substitutions), or (3) encoded by a first nucleic acid that hybridizes under stringent conditions to a second nucleic acid consisting of SEQ ID NO: 1. The polypeptide can inhibit transcription of interleukin 8. Other methods included in the invention include a method of inhibiting transcription of the interleukin 8 gene, the method comprising introducing a vector containing a nucleic acid of the invention into cells and allowing a polypeptide of the invention to be expressed in the cells.

The invention also features a pharmaceutical composition comprising a polypeptide or a nucleic acid of the invention in an anti-inflammatory effective amount and a pharmaceutically acceptable carrier.

The term “a transcriptional regulatory factor” used herein means a protein controlling transcription of a gene, other than basal transcription factors. The term “a basal transcription factor” means a factor which forms a transcription initiation complex with RNA polymerase and DNA.

The term “a factor involved in transcription” used herein means a factor regulating gene transcription, including basal transcription factors.

The term “substantially pure” used herein in reference to a given polypeptide means that the polypeptide is substantially free from other biological compounds, such as those in cellular material, viral material, or culture medium, with which the polypeptide may have been associated (e.g., in the course of production by recombinant DNA techniques or before purification from a natural biological source). The substantially pure polypeptide is at least 75% (e.g., at least 80, 85, 95, or 99%) pure by dry weight. Purity can be measured by any appropriate standard method, for example, by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

An “isolated nucleic acid”: is a nucleic acid which has a non-naturally occurring sequence, or which has the sequence of part or all of a naturally occurring gene but is free of the gene that flank the naturally occurring gene of interest in the genome of the organism in which the gene of interest naturally occurs. The term therefore includes a recombinant DNA incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote. It also includes a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment. It also includes a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Specifically excluded from this definition are mixtures of DNA molecules, vectors, or clones as they occur in a DNA library such as a cDNA or genomic DNA library. Also excluded are RNA molecules that consist of naturally-occurring sequences (e.g., naturally-occurring mRNA) except where the RNA is in a purified state such that it is at least 90% free of other naturally-occurring RNA species. Thus, a naturally-occurring mRNA in a whole mRNA preparation prepared from a cell would not be an “isolated nucleic acid,” but a single mRNA species purified to 90% homogeneity from that whole mRNA preparation would be.

As used herein, “percent identity” of two amino acid sequences or of two nucleic acids is determined using the algorithm of Karlin and Altschul (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990) modified as in Karlin and Altschul (Proc. Natl. Acad. Sci. USA 90:5873-5877, 1993). Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (J. Mol. Biol. 215:403-410, 1990). BLAST nucleotide searches are performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the invention. BLAST protein searches are performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to a reference polypeptide (e.g., SEQ IS NO: 2). To obtain gapped alignments for comparison purposes, Gapped BLAST is utilized as described in Altschul et al. (Nucleic Acids Res. 25:3389-3402, 1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the retrospective programs (e.g., XBLAST and NBLAST) are used. See http://www.ncbi.nlm.nih.gov.

A “conservative amino acid substitution” is one in which the amino acid residue is replaced with another residue having a chemically similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acid with basic side chains (e.g., lysine, glutamic acid), uncharged polar side chains (e.g., glycine, aspargine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

By “hybridizes under stringent conditions” is meant specific and non-covalent equilibrium binding by base-pairing to an immobilized reference nucleic acid in a hybridization solution containing 0.2×SSC (1.75 g/l NaCl, 0.88 g/l Na3citrate 2H2O;pH 7.0) and 0.1% (w/v) sodium dedecylsulfate at 68° C. Washings, if any are required to achieve equilibrium, are carried out with the hybridization solution.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present application, including definitions, will control. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference. The materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the detailed description, and from the claims.

First, the present invention relates to a protein having transcription inhibitory activity and lacking at least a part of the sequences other than those having DNA binding activity of transcriptional regulatory factors.

The protein of the present invention generally includes the region having DNA binding activity of transcriptional regulatory factors. A region having DNA binding activity of transcriptional regulatory factors varies depending on the transcriptional regulatory factor. For example, the bzip (basic-leucine zipper) region in c-JUN (Sutherland, J. A. et al., Genes Dev., 6: 1810-1819(1992)) and Zn finger region in Sp1 (Kadonaga, J. T. et al., Science 242: 1556-1570 (1988). The region having DNA binding activity of transcriptional regulatory factors can vary depending on the upstream region of the gene to be bound. The region having DNA binding activity of transcriptional regulatory factors can be determined by preparing various deletion mutants of transcriptional regulatory factor genes and detecting the DNA binding activity using gel shift assay.

The protein of the present invention also possesses transcription inhibitory activity and lacks at least a part of regions other than those having DNA binding activity. The sequence other than the region having DNA binding activity is not particularly limited as long as deletion of the sequence imparts transcription inhibitory activity. This region preferably interacts with other factors involved in transcription, more preferably, a transcriptional activation region (a region interacting with basal transcription factors). The transcriptional activation region can be determined by replacing amino acid residues by site-specific mutagenesis and detecting the decreased transcription activity by the replacement (Gill, G. et al., Cell 51: 121-126 (1987)).

The protein of the present invention can include not only an amino acid sequence of a part of natural transcriptional factors but also a sequence in which one or more amino acids are deleted, substituted, or added, as long as the protein has the transcription inhibitory activity. Such deletion, substitution, or addition of amino acids can be performed by site-specific mutagenesis well known in the art at the time this application was filed (Nucleic Acid Res., 10: pp. 6487).

The protein can be prepared by the method described below.

First, if a gene's transcription is to be inhibited but the gene encoding the transcriptional regulatory factor is unknown, the gene encoding the transcriptional regulatory factor should be isolated. cDNA encoding the protein capable of binding to the transcriptional regulatory region can be isolated, for example, by screening a cDNA library inserted in a phage vector using the transcriptional regulatory region of a gene whose transcription is to be inhibited as a probe (Vinson, C. R. et al., Genes Dev. 2: 801-806 (1988)).

Second, at least a part of regions other than those having DNA binding activity in the isolated gene encoding the transcriptional regulatory factor are deleted. This deletion is enabled by creating new restriction sites by introducing point mutation in the DNA sequence and utilizing the restriction sites using recombinant DNA technology (commonly used genetic engineering technology such as methods described in “Molecular cloning (Sambrook, J et al., Molecular Cloning; A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, New York (1989),” “Laboratory Manual of Genetic Engineering, Muramatsu, M. ed., Maruzen (1989)”) or the “Kunkel method” (Methods Enzymol. 85: 2763-2766 (1988)). The deletion also can be made by PCR (Higuch, R. PCR Protocols, Academic press, INC. 177-183 (1990)).

Third, the obtained DNA is ligated with an appropriate vector, and the vector is introduced into cells to detect transcription inhibitory activity of the expressed protein. The vector to be used is not particularly limited. Preferable examples of the vector include “pcDL-SR&agr;296” comprising SR&agr; promoter capable of effectively expressing the gene to be expressed (Takebe, Y. et al., Mol. Cell. Biol. 8: 466-472 (1988)), “pEF-BOS” comprising the promoter of the elongation factor (Mizushima, S. Nucleic Acid Res. 18 (1990)), or “pCAGGS” comprising CAG (cytomegalovirus IE enhancer+chicken &bgr;-globin poly(A) signal) promoter (Niwa, H. et al., GENE 108: 193-200 (1990)).

The cells into which the vector is introduced are not particularly limited. “MRC-5 SV1 TG1 cell” (Riken Cell Bank), “VA-13 cell” (Riken Cell Bank), or “RERF-LC-AI cell” (Riken Cell Bank) is preferable.

The vector can be introduced into the cells by the DEAE-dextran method (Luthman, H. et al., Nucleic Acids Res. 11: 1295-1308 (1983)), the calcium phosphate method (Graham, F. L. et al., Virology 52: 456-457. (1973)), electroporation (Neumann, E. et al., EMBO J. 1: 841-845 (1982), or similar methods.

The transcriptional inhibitory activity can be detected by, for example, reporter assay (Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, N.Y. (1989)).

Fourth, the protein whose transcription inhibitory activity was detected is isolated and purified. The isolation and purification can be performed by inserting a gene encoding the protein whose transcription inhibitory activity was detected into an expression vector, transforming prokaryotic or eukaryotic host cells with said vector, and purifying the expressed protein by chromatography or a similar method. For example, when E. coli is used as a host, the method of Smith et al. (Smith, D. B. et al., Current Protocols in Molecular Biology Vol. 2, John Wiley & Sons, New York, 16.7. (1990)) can be used.

The protein of the-present invention can be prepared by the methods described above.

The present invention also relates to a method of inhibiting transcription of a specific gene using a protein having transcriptional inhibitory activity and lacking at least a part of regions other than those having DNA binding activity of transcriptional regulatory factors.

One embodiment relates to the method of inhibiting transcription of a specific gene and is characterized by introducing said protein into cells.

The cells into which the protein of this invention is to be introduced are not particularly limited. The protein of the present invention can be introduced into cells by microinjection, electroporation, the liposomal method, the erythrocyte ghost method, or some similar method.

Another embodiment relates to a method of inhibiting transcription of a specific gene and is characterized by introducing a vector comprising DNA encoding the protein of the present invention into cells and allowing said protein to be expressed in cells.

Any vector can be used as long as it can express the inserted gene. When animal cells are used, vectors such as “pcDL-SR&agr;296” comprising SRQ promoter capable of effectively expressing a gene to be expressed (Takebe, Y. et al., Mol. Cell. Biol. 8: 466-472 (1988)), “pEF-BOS” comprising the promoter of the elongation factor (Mizushima, S. Nucleic Acid Res. 18: (1990)), and “pCAGGS” comprising CAG (cytomegalovirus IE enhancer+chicken &bgr;-globin poly(A) signal) promoter (Niwa, H. et al., GENE 108: 193-200 (1990)) are preferable.

The vector can be introduced into cells by the DEAE-dextran method (Luthman, H. et al., Nucleic Acids Res. 11: 1295-1308 (1983)), the calcium phosphate method (Graham, F. L. et al., Virology 52: 456-457. (1973)), electroporation (Neumann, E. et al., EMBO J. 1: 841-845 (1982), or a similar method.

When expression of a gene whose transcription is controlled by the protein of the present invention correlates with a disease, the protein is particularly useful as a therapeutic agent for the disease. For example, if a specific gene is revealed to be an oncogene, the transcriptional regulatory factor based on the sequence upstream of the oncogene is isolated. The transcriptional regulatory factor gene is then isolated to prepare the protein of the present invention. In this case, the protein of the present invention can be used as an anticancer agent. The protein of the present invention can be administered to a patient by subcutaneous injection or other suitable method.

Furthermore, the protein of the present invention can be used to inhibit a disease by expressing it in the patient's body. Transcriptional regulatory factors are believed to bind to the upstream portion of a specific gene with high specificity to the gene. Therefore, the protein of the present invention derived from the transcriptional regulatory factor can also have high specificity to the gene and thus be useful in the field of gene therapy. In this case, the gene encoding the protein of the present invention is inserted into an appropriate vector and can be introduced into the body by, for example, a method using a virus vector or a method using membrane-fused liposomes. The virus vector to be used is not particularly limited. Preferable examples thereof include retrovirus vectors, adenovirus vectors, AAV (adeno-associated virus) vectors, herpesvirus vectors, and HIV vectors.

IL-8 is reported to be produced in various inflammatory diseases, such as chronic articular rheumatism, gouty arthritis, psoriasis, contact dermatitis, sepsis, cataplectic pulmonary fibrosis, adult respiratory distress syndrome, inflammatory enteropathy, immune angiitis, glomerulonephritis, urinary tract infection, myocardinal infarction, respiratory tract infection, asthma, perinatal infection, and rejection to transplanted organs (Matushima, K. et al., Chem Immunol 51: 236-265 (1992)). The protein inhibiting transcription of IL-8 and having the sequence of SEQ ID NO: 1 can be used as a therapeutic agent for the above-described diseases.

In fact, S1-15 protein, which was found by the present inventors, strongly suppresses the production of human IL-8 and Gro-&agr; in MRC-5 cells, indicating that it has anti-inflammatory activity. Thus, S1-15 protein (the protein having the sequence of SEQ ID: 1 or its functionally equivalent derivatives) or DNA encoding the protein can be used for the treatment of the diseases.

When S1-15 protein is used as an anti-inflammatory agent, it can be formulated with a pharmaceutically acceptable carrier of medium (e.g., physiological saline, vegetable oil, suspension, surfactant, stabilizer, and the like) by the known methods and administered to patients. The preparation is administered through a suitable route, such as transcutaneous, intranasal, transbronchial, intramuscular, intravenous, or oral administration, depending on the property of the compound. Although the dosage may be varied depending on the age, weight, and condition of the patent, and the method of administration, one skilled in the art can readily select a suitable dosage. When DNA encoding S1-15 protein is used as an anti-inflammatory agent for gene therapy, the DNA can be incorporated into a vector capable of functioning in vivo, and the vector can be administered to patients by the in vivo or ex vivo method. Alternatively, the DNA can be administered to patients without using such a viral vector.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the structure of vector pREP9-IL8p-gpt-neo.

FIG. 2 shows the DNA sequence of the primers for constructing vector pBlue-SR.

FIG. 3 shows the template DNA sequence of MCS.

FIG. 4 shows the ligation process of four DNA fragments, SRapromoter (fragment A), splice site (fragment B), multicloning site (MCS) (fragment C), and polyadenylation signal (fragment D), for constructing vector pBlue-SR.

FIG. 5 shows the process of introducing the DNA fragment comprising four regions to construct vector pBlue-SR.

FIG. 6 shows the sequence of the synthetic DNA primers for constructing vector pBlue-SR&agr;-Hind.

FIG. 7 shows the sequence of the DNA insertion into vector pBlue-SR&agr;-Hind.

FIG. 8 shows the process of constructing vector pBlue-SR&agr;-Hind.

FIG. 9 shows the process of constructing vector pBlue-SR&agr;-lacO.

FIG. 10 shows the process of constructing vector pBlue-SRO.

FIG. 11 shows the process of constructing vector pBlue-SROL.

FIG. 12 shows the process of constructing vector pSROL-3′SS (NB2).

FIG. 13 shows the structure of vector pSRO-cDNA.

FIG. 14 shows the structure of reporter plasmid vector pIL8p-Luc.

FIG. 15 shows the result of measuring living cells using Alamar Blue.

FIG. 16 shows the effect of extracellular stimulation factor (TNF-&agr;) and dexamethasone treatment on proliferation of cell clone IL8p-gpt-neo#17.

FIG. 17 shows the PCR primers for isolating cDNA derived from the pSRO-cDNA library introduced into the genomic DNA of the cells.

FIG. 18 shows the result of using the reporter gene to detect the inhibitory activity on the IL-8 promoter of cDNA isolated by the method of the present invention.

FIG. 19 compares the amino acid sequence of the transcriptional inhibitory factor S1-15 of the present invention and two transcriptional inhibitory factors (HIP116, 6D3) detected by homology search.

FIG. 20 shows the structure of vector pBlue-SR-S1-15.

FIG. 21 shows the inhibitory activity of S1-15 for the IL-8 promoter detected using the reporter gene.

FIG. 22 shows the process of constructing pBlue-SR-Lic used to construct vector pBlue-SR-S1-15.

FIG. 23 shows the inhibitory activity of S1-15 on the IL-8 promoter detected by expressing the IL-8 gene.

FIG. 24A shows the inhibitory effect of S1-15 expressed through infection with a recombinant adenovirus vector on the production of IL-8 in the cells stimulated with IL-1&bgr;. FIG. 24B shows the inhibitory effect of S1-15 expressed through infection with a recombinant adenovirus vector on the production of human GRO&agr; in the represent a control (an empty adenovirus vector, Adex 1w1) , and solid squares Adex-“S1-15” clone No. 4 expressing S1-15.

FIG. 25 is an electrophoretic image detected by Western blotting showing the expression of S1-15 protein in the cells transfected with recombinant adenovirus vectors expressing S1-15 or a control vector. Lane 1, uninfected and unstimulated; Lane 2, uninfected and stimulated with IL-1&bgr;; Lane 3, control vector Adex 1w1 (MOI 10) and unstimulated; Lane 4, control vector Adex 1w1 (MOI 10) and stimulated with IL-1&bgr;; Lane 5, recombinant vector Adex S1-15 (MOI 10) and unstimulated; Lane 6, recombinant vector Adex S1-15 (MOI 10) and stimulated with IL-1&bgr;; Lane 7, control vector Adex 1w1 (MOI 100) and unstimulated; Lane 8, control vector Adex 1w1 (MOI 100) and stimulated with IL-1&bgr;; Lane 9, recombinant vector Adex S1-15 (MOI 100) and unstimulated; Lane 10, recombinant vector Adex S1-15 (MOI 100) and stimulated with IL-1&bgr;; Lane 11, control vector Adex 1w1 (MOI 200) and unstimulated; Lane 12, control vector Adex 1w1 (MOI 200) and stimulated with IL-1&bgr;; Lane 13, recombinant vector Adex S1-15 (MOI 200) and unstimulated; Lane 14, recombinant vector Adex S1-15 (MOI 200) and stimulated with IL-1&bgr;.

BEST MODE FOR IMPLEMENTING THE INVENTION

EXAMPLE 1

Establishment of the Cloning System of a Gene Relating to Inhibition of Signal Transduction from TNF Stimulation to IL-8 Promoter Activation

1. Construction of Plasmid pREP9-IL8p-gpt-neo (Abbreviated pIL8p-gpt-neo) Having the gpt Gene Downstream of the IL-8 Promoter and the Neomycin Resistance Gene, Neo

(1) Construction of pbluescript SK(+)-gpt

About 600 bp of the gpt gene region was amplified by PCR using Taq polymerase (TAKARA), the following primers, and pSV2-gpt (Mulligan, R. C. and Berg, P. Science 209, 1422-1427 (1980)) as the template.

Primer #1 (SEQ ID NO: 3) ATAAGCTTTTCACATGAGCGAAAAATACA

HindIII

Primer #2 (SEQ ID NO: 4) ATGGATCCCTATTGTAACCCGCCTGAAGT

BamHI

PCR was performed with DNA Thermal Cycler Model PJ2000 (TAKARA, PERKIN ELMER CETUS). The reaction mixture contained a PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin), 0.2 mM each (final concentration) of dNTPs (dATP, dCTP, dGTP, dTTP), 1 &mgr;M DNA primers, and the template DNA to make the total volume 100 &mgr;l. Twenty cycles of incubation at 94° C. for 1 minute, at 50° C. for 1 minute, and at 72° C. for 1 minute were performed. The PCR product was digested with restriction enzymes BamHI and HindIII and purified with the DNA purifying agent preA-gene Matrix (Nippon Bio-Rad Laboratories, BIO-RAD). The fragment was ligated into BamHI- and HindIII-digested pBluescript II SK(+) (TOYOBO, STRATAGENE) with a DNA Ligation Kit (TAKARA) using T4 DNA ligase. Colonies resistant to ampicillin were obtained by introducing the resulting plasmid into the competent cells of XL1-Blue, an E. coli K-12 strain. The plasmids into which the gpt gene was inserted were obtained by collecting plasmids from cultured cells of colonies and examining the restriction pattern. DNA sequencing was performed for the part corresponding to the gpt gene, and the sequence was confirmed to be the desired gpt gene. DNA sequencing was performed with Taq DyeDeoxy ™Termination Cycle Sequencing Kit (APPLIED BIOSYSTEMS) along with its protocol. After the reaction, the reaction product was purified with a spin column Bio-Spin 30 (BIO-RAD) and analyzed with a DNA sequencer (ABI 373A DNA Sequencing System).

(2) Construction of pREP-gpt

The BamHI-HindIII fragment (about 600 bp) of pBluescript SK(+)-gpt containing the gpt gene and the BamHI-HindIII fragment (about 10 kb) of pREP9 (FUNAKOSHI, INVITROGEN) were recovered by low-melting point agarose gel electrophoresis and purified with a tip for isolating and purifying nucleic acid, QIAGEN-tip 5 (FUNAKOSHI, QIAGEN Inc.). The two fragments were ligated to each other with DNA Ligation Kit (TAKARA) then introduced into competent cells of E. coli K-12 strain XL1-Blue to obtain colonies resistant to ampicillin. Plasmid DNAs of the transformants were prepared, and clones with the gpt gene were selected. The plasmid thus obtained was named pREP-gpt.

(3) Construction of pREP-IL8-gpt-neo

The human IL-8 promoter region was introduced into pREP-gpt obtained above so that expression of the gpt gene could be regulated. More specifically, DNA fragments containing the human IL-8 (neutrophil chemotactic cytokine) promoter region (Matsushima, K. et al., J. Imm. 143, 1366-1371 (1989)) were prepared by PCR with synthetic primers IL8P1 (5′-ATGTCTCGAGAATTCAGTAACCCAGGCATTATTTTATC-3′ (SEQ ID NO: 5)) and IL8P2 (5′-TTGTCCTAGAAGCTTGTGTGCTCTGCTGTC-3′ (SEQ ID NO: 6)), and with a genomic DNA of human VA-13 cells (Riken Cell Bank) as the template. After the fragments were digested with HincII and HindIII, the human IL-8 promoter region (IL8p, −546 to +44) was recovered and purified. pREP-gpt was digested with XbaI, blunted with a DNA Blunting Kit (TAKARA), digested with HindIII, and a10 kb DNA fragment was purified. The two fragments were ligated with a DNA Ligation Kit (TAKARA) then introduced into the competent cells of JM109 (TOYOBO) to obtain colonies resistant to ampicillin. The plasmid with the structure shown in FIG. 1 was obtained by collecting plasmids from cultured cells of colonies and examining the restriction pattern. In this plasmid, the E. coli gpt gene was ligated to the downstream end (3′-end) of the human IL-8 promoter region (IL8p, −546 to +44), and xanthine-guanine-phosphoribosyltransferase (XGPRT) was thus produced under the control of the human IL-8 promoter. In addition, this plasmid had the neomycin resistance gene, neo, derived from pREP9, as the selection marker.

2. Construction of Expression Vector for cDNA Library Construction

(1) Construction of pBlue-SR

A vector that utilizes pcDL-SR&agr;296 (Takebe Y. Mol. Cell. Biol. 8, 466-472 (1988)) as the DNA region necessary for expression in animal cells was constructed. pcDL-SR&agr;296 is known for highly efficient expression in various kinds of cultured cells. The unit for driving transcription was reconstructed by the gene fusion method using PCR (Vallete, F. et al., Nucleic Acids Res. 17, 723-733 (1989)). After the SR&agr; promoter (Fragment A), splicing site (Fragment B), multiple cloning site (MCS) (Fragment C), and polyadenylation signal (Fragment D) were prepared by PCR, these fragments were fused. More specifically, the first PCR was performed using the synthetic DNAs shown in FIG. 2 as primers, the annealing product of the four synthetic DNAs shown in FIG. 3 as the template for the multiple cloning site (MCS), and pcDL-SR&agr;296 as the template for the other regions. FIG. 4 shows the process of linking DNA fragments containing the four regions by PCR. Since the DNA primers used for linking each DNA fragment were designed to have the sequence of the DNA to be amplified at its 3′ end and have the sequence of the adjacent DNA to be connected at its 5′end, four amplified DNA fragments (A, B, C, and D) have overlapping parts (30 to 40 bp) between two adjacent regions. These DNA fragments were separated by low-melting point agarose gel electrophoresis and purified with a tip for isolating and purifying nucleic acid, QIAGEN-tip 5 (FUNAKOSHI, QIAGEN Inc.). After equal volumes of Fragments A and B were mixed, Fragment AB was prepared by PCR with outside primers (Primers SR1 and SR6). Fragment CD was prepared through a similar process with Primers SR3 and SR8. Finally, Fragment ABCD (about 1 kb) was prepared with equal volumes of purified Fragments AB and CD by PCR with outside primers (Primers SR1 and SR8). The resulting Fragment ABCD was digested with SacI and KpnI whose sites were made outermost in said fragments to purify and recover about 1 kb SacI-KpnI Fragment ABCD. The Fragment ABCD was ligated with about 3 kb SacI-KpnI fragment of pBluescript II SK(−) (TOYOBO, STRATAGENE). The ligation product was introduced into E. coli and cloned. FIG. 5 shows the plasmid DNA pBlue-SR thus obtained

(2) Construction of pSROL

To apply the Lac repressor system that was reported to enable inducible expression in animal cells (Mickey, C. -T. Cell 48, 555-566 (1987)), a vector plasmid, pSROL, was constructed by modifying pBlue-SR.

(2-1) Construction of pBlue-SR&agr;-Hind

The position of Lac operator sequence between a promoter and a gene is thought to be important for regulating expression with Lac repressor (Brown, M. Cell 49, 603-612 (1987)). SR&agr; promoter consists of SV40 early promoter fused with the LTR of HTLV-1 (Mol. Cell. Biol. (1988) 466-472). A HindIII site was introduced immediately before the transcription initiation site within the SV40 early promoter region, which exists upstream to the junction between two units of SR&agr; promoter, by mutagenesis using PCR (Higuchi, R. PCR Protocols, Academic Press, Inc. 177-183 (1990)) in order to insert the Lac operator sequence into this HindIII site. An SR&agr; promoter fragment with a HindIII site was prepared using the synthetic DNAs shown in FIG. 6 as the primers and pBlue-SR&agr; as the template. FIG. 7 shows the sequence of the prepared DNA. The detailed process of the construction is described below. The first PCR was performed with the primer pair, SRO-1 and SRO-2 (or SRO-3 and SRO-4) using the pBlue-SR&agr; plasmid DNA as the template. Each PCR product was recovered by low-melting point agarose gel electrophoresis and purified with a tip for isolating and purifying nucleic acid, QIAGEN-tip 5 (FUNAKOSHI, QIAGEN Inc.). The reaction mixture contained a PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin), and 0.2 mM each (final concentration) of dNTPs (dATP, dCTP, dGTP, and dTTP). Twenty cycles of incubation at 94° C. for 1 minute, 55° C. for 1 minute, and 72° .C for 1 minute were performed. In the second PCR, after two cycles were performed for a mixture with equal amounts of the two DNA fragments amplified in the first PCR, additional 18 cycles were performed with Primers SRO-1 and SRO-4 under the same conditions as described above. The resulting PCR product was digested with restriction enzymes SacI and KpnI, purified, and subcloned into pBluescript II SK(−) (FUNAKOSHI) which had been digested with the same restriction enzymes. The thus obtained clone plasmid was named pBlue-SR&agr;-Hind (FIG. 8), and its nucleotide sequence was determined.

(2-2) Construction of pBlue-SR&agr;-lacO

The plasmid obtained in 1) above was digested with HindIII, and a DNA fragment (about 3.5 kb) was recovered. Separately, pOP13 (TOYOBO, STRATAGENE) was also digested with HindIII to recover a DNA fragment (about 500 bp). This DNA fragment contains three Lac operator sequences. These two fragments were ligated, and the competent cells of E. coli K-12 strain, XL1-Blue, were transformed with the ligation product. The thus-obtained colonies were cultivated, and isolated plasmids were analyzed. Thus, pBlue-SR&agr;-lacO, in which the operator was inserted in the same direction as SR&agr; a promoter, has been constructed (FIG. 9).

(3) Construction of pBlue-SRO

pBlue-SR&agr;-lacO was digested with NotI, blunted, and digested with SacI to obtain a DNA fragment (about 1 kb). Separately, pBlue-SR was digested with SacI and XbaI (for blunting) to obtain a DNA fragment (about 3.2 kb). These two fragments were ligated to each other. By analyzing the clones obtained by transformation with the ligated fragments, pBlue-SRO was constructed (FIG. 10).

(4) Construction of pBlue-SROL

(4-1) Construction of pBlue-Luc

pGV-CS (TOYO INK), a cassette vector of the luciferase gene, was digested with Xho I, blunted, and digested with BamHI. Separately, pBluescript II SK(+) (TOYOBO, STRATAGENE) was digested with XbaI (for blunting) and digested with BamHI. By ligating these two DNA fragments, plasmid pBlue-Luc, in which the luciferase gene was subcloned, was constructed.

(4-2) Construction of pBlue-SROL

pBlue-SRO was digested with SmaI and NotI to obtain a DNA fragment (about 4.2 kb). Separately, pBlue-Luc was digested with NotI and SmaI, and a DNA fragment (about 1.8 kb) containing the luciferase gene was purified. These two fragments were ligated, and the competent cells of E. coli K-12 strain, XL1-Blue, were transformed with the ligation product. The obtained colonies were cultivated and isolated plasmids were analyzed. Thus, pBlue-SROL, in which the luciferase gene was inserted downstream to the SR&agr; promoter, was constructed (FIG. 11).

(5) Construction of pSROL-3′SS(NB2)

(5-1) Construction of p3′SS(-Xma I)

p3′SS (TOYOBO, STRATAGENE) was linearized by XmaI digestion, blunted with DNA Ligation Kit (TAKARA), and self-ligated. The competent cells of E. coli K-12 strain, XL1-Blue, were transformed with the resulting plasmid. The obtained colonies were cultivated, and isolated plasmids were analyzed to obtain p3′SS(-Xma I) with no XmaI site. The purpose of this treatment is to disrupt the Xma I site within the DNA derived from p3′SS for constructing the cDNA library later.

(5-2) Construction of pSROL-3′SS(NB2)

A DNA fragment (about 4.3 kb) generated by digesting p3′SS(-Xma I) with BamHI and NsiI was recovered by low-melting point agarose gel electrophoresis and purified with a tip for isolating and purifying nucleic acid, QIAGEN-tip 5 (FUNAKOSHI, QIAGEN Inc.). This fragment comprises units for expressing the hygromycin resistance gene and the Lac repressor. The hygromycin resistance gene is a selective marker used in gene transfer to animal cells, and the Lac repressor acts on Lac operator sequence. Separately, pBlue-SROL was digested with Asp718 and purified in the same manner as described above. These two fragments were blunted with a DNA Blunting Kit (TAKARA) then ligated with a DNA Ligation Kit (TAKARA). The ligation product was introduced into the competent cells of E. coli K-12 strain, XL1-Blue, to thereby obtain colonies resistant to ampicillin. The plasmids from the thus-obtained clones were analyzed, and pSROL-3′SS(NB1) and pSROL-3′SS(NB2) were obtained. In these two plasmids, the BamHI-NsiI fragment derived from p3′SS(-Xma I) was inserted in different directions. pSROL-3′SS(NB2) (FIG. 12), in which the direction of transcription from the three genes (the luciferase gene, the hygromycin gene, and the Lac repressor gene) is the same, was used in the experiments below.

3. Construction of cDNA Library for Cloning

(1) Preparation of Poly(A)+ RNA

About 2×108 MRC-5 SV1 TG1 cells (Riken Cell Bank) were cultivated for 5 hours after addition of 1×10−6 M dexamethasone (DEX). About 5 mg of RNA was extracted from the cells by the Acid Guanidium Thiocyanate Phenol Chloroform (AGPC) method (Chomczynski, P. and Sacchi, N. Anal. Biochem. 162, 156-159 (1987)). About 15 &mgr;g of poly(A)+ RNA was purified from 500 &mgr;g of the RNA using Oligotex-dT30 (TAKARA). This purification procedure was repeated twice.

(2) Preparation of Vector DNA

After being digested with NotI, pSROL-3′SS(NB2) was dephosphorylated at its ends by Bacterial Alkaline Phosphatase (BAP) (TAKARA) treatment then digested with SmaI. A 8.5 kb desired DNA fragment was recovered by low-melting point agarose gel electrophoresis.

(3) Synthesis of cDNA and Construction of Library

The process from the first-strand cDNA synthesis to ligation with a vector was performed in accordance with the “Method for Gene Library Construction” (Experimental Medicine: SUPPLEMENT, BIOMANUAL SERIES 2, YODOSHA, 79-94) using a ZAP-cDNA SYNTHESIS KIT (TOYOBO, STRATAGENE) as reagents as follows. M-MuLV Reverse Transcriptase synthesized 2.6 &mgr;g of first-strand cDNA using 10 &mgr;g of the poly(A)+ RNA described above as the template. The second-strand cDNA was then synthesized using E. coli RNase H and E. coli DNA polymerase. The resulting DNA was blunted with T4 DNA polymerase and digested with NotI. Low molecular weight DNAs were purified on a CHROMASPIN-400 column (TOYOBO, Clontech). Finally, 0.6 &mgr;g of double-stranded DNA was obtained. The thus-obtained cDNA was ligated using T4 DNA ligase into pSROL-3′SS(NB2) digested with SmaI and Not I ((2) described above). The reaction mixture was mixed with E. coli DH10B strain (ELECTRO MAX DH10B cell, GIBCO BRL) to introduce the cDNA into the cells using the CELL-PORATOR system (GIBCO BRL). It has been revealed that the library comprises 1.6×106 colonies as a whole. Moreover, 90% of the clones contained the cDNA insert.

FIG. 13 shows the structure of the plasmid with cDNA constructed as described above. The plasmid can be used to incorporate cDNA of an antiinflammatory protein and transfected into animal cells to express the protein in the cells.

This vector can be used not only for transient expression of proteins coded by the cDNAs but also for obtaining stable (permanent) transfectants because it has the hygromycin resistence gene as a selective marker. When luciferase cDNA was used as an example of cDNA, a sufficient amount of protein (luciferase) was produced (expressed).

4. Construction of the Luciferase Expression Vector, pIL8p-Luc

DNA comprising the human IL-8 (neutrophil chemotactic cytokine) promoter region (Matsushima, K. et al., J. Imm. 143, 1366-1371 (1989)) prepared by PCR using a genomic DNA of human VA-13 cells (Riken Cell Bank) was digested with HincII and HindIII to obtain a DNA fragment of −546 to +44 (IL8p). This fragment (IL8p) was inserted into pGL2-Promoter Vector (Promega) whose SV40 early promoter was removed with SmaI and HindIII, producing pIL8p-Luc. FIG. 14 shows the structure of this plasmid.

5. Cell Cultivation

MRC-5 SV1 TG1 cells (Riken Cell Bank), known as HGPRT-deficient cells, were cultivated in RITC 80-7 medium supplemented with 10% FCS. Dexamethasone dissolved in 100% ethanol was diluted with the same medium and added to the culture. Ethanol alone was added to the control group in the same concentration as ethanol added to the dexamethasone-treated group.

6. Quantitative Measurement of the Survival Rate of Cells

Cell survival was judged by quantitatively measuring the amount of the reduced product of Alamar Blue (KANTO KAGAKU), which was taken into cultured cells, in terms of fluorescence intensity or absorbance. This compound is reduced in the living cells and linked with the NADPH production system. The reduction product emits a characteristic color or fluorescence to be measured. After cells were cultivated in a 96-well plate, the medium was renewed, Alamar Blue was added, and the cells were incubated for 3 hours. The luminescence (fluorescence) at 590 nm was then measured by exciting the culture supernatants at 530 nm with a CytoFluor 2350 (MILLIPORE).

7. Establishment of HGPRT-deficient Cell Clone that Stably Maintains the gpt Gene with the IL-8 Promoter

pREP9-IL8p-gpt-neo (FIG. 1), which had the gpt gene fused with the human IL-8 promoter and the neomycin resistance gene neo, was digested with ClaI and SphI to remove ori and EBNA-1 regions derived from the EB virus vector (pREP9) and to open the circular structure. MRC-5 SV1 TG1 cells deficient in HGPRT were transfected with the thus-obtained linearized DNA (IL8p-gpt-neo), which was made easy to integrate into the chromosome, and screened with 400 &mgr;g/ml G418. Twenty-one clones were isolated using cloning syringes. These clones were cultivated on a 12-well plate at a concentration of about 5×104 cells/ml, treated with 1 &mgr;M dexamethasone for 3 hours, then cultivated with 1000 ng/ml 6-TG under stimulation by 20 to 100 U/ml (1 to 5 ng/ml) TNF-&agr;.

In two of these clones (#17 and #21), cell death was induced by TNF-&agr; stimulation in the presence of 6-TG and inhibited by treatment with dexamethasone.

Based upon the results above, a method quantitatively superior to the method for judging the effect of dexamethasone by observing cell survival under a microscope (e.g., a method for judging survival of cells by quantitatively measuring the amount of the reduction product of Alamar Blue (KANTO KAGAKU) which has been taken into cultured cells in terms of fluorescence intensity or absorbance) was tested. This compound is reduced in cells, linked with the NADPH production system, and emits characteristic color or fluorescence. The test was performed as follows.

After 106 MRC-5 SV1 TG1 cells, deficient in HGPRT, were cultivated in a 96-well plate, the medium was exchanged, Alamar Blue was added, and the cells were incubated for 3 hours. The luminescence (fluorescence) at 590 nm was then measured by exciting the culture supernatants at 530 nm with a CytoFluor 2350 (MILLIPORE) (FIG. 15).

Based upon the results, 5×103 cells of Clone #17 (IL8p-gpt-neo #17), which stably maintained IL8p-gpt-neo, were cultivated in a 96-well plate, and living cells were quantitatively measured using Alamar Blue by adding 1000 U/ml TNF-&agr; in the presence of 1 &mgr;M dexamethasone and 1 &mgr;g/ml 6-TG. The results are shown in FIG. 16 and reveal that the cells of Clone #17 (IL8p-gpt-neo #17), which stably maintains IL8p-gpt-neo, all died when 6-TG was added and TNF-&agr; stimulation applied, and that dexamethasone inhibited cell death and kept cells growing. Thus, the cell clone IL8p-gpt-neo #17, which dies if IL-8 promoter is activated by TNF stimulation but which is rescued from the cell death by treatment with antiinflammatory steroid, has been developed by stably introducing the gpt gene with the IL-8 promoter into HGPRT-deficient cells. This cell clone can be used as a system for assessing cDNA encoding an antiinflammatory protein that inhibits the activation of the IL-8 promoter. Clone #17 (IL8p-gpt-neo #17), which stably maintains IL8p-gpt-neo, was deposited with the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry (accession number FERM BP-5706).

8. First Screening of cDNA Library (pSRO-cDNA Library) Using HGPRT-deficient Cell Clone IP8p-gpt-neo #17 which Stably Maintains IL8p-gpt-neo

The first screening was performed by introducing the pSRO-cDNA library into IL8p-gpt-neo #17 cells (FIG. 16). Since the plasmids have the hygromycin resistance gene as the marker, only cells into which the plasmids are introduced survive by hygromycin selection. In contrast, the cells die if TNF-&agr; and 6-TG are added to the culture medium. However, if the pSRO-cDNA library has a cDNA encoding protein that inhibits the activation of the IL-8 promoter (antiinflammatory protein), cells in which the cDNA is expressed must survive. The experiment was performed as follows.

250 &mgr;g of pSRO-cDNA library (size 1.6×106) was introduced into IL8p-gpt-neo #17 cells (2.5×107 cells; five 500 cm2 trays) using Transfectam. Two days later, 100 &mgr;g/ml hygromycin was added. Five days thereafter, 20 mM IPTG was added, and the next day, 200 U/ml TNF and 1 &mgr;g/ml 6-TG were added to conduct screening. Consequently, several colonies per tray survived. Twenty-two clones were isolated on the twelfth day after addition of TNF and 6-TG and cultivated in the presence of hygromycin. Finally, cells of 16 strains were obtained.

9. Isolation of cDNAs Obtained in the First Screening.

Genomic DNA was isolated from the 16 strains obtained in the first screening, and the pSRO-cDNA-library-derived cDNA insert introduced into the genomic DNA was extracted by PCR as described below.

1) Genomic DNA was prepared with a QIAamp Blood kit (QIAGEN).

2) PCR was performed using the Ex Taq (TaKaRa) and Gene Amp PCR system 9600 (Perkin Elmer) for 30 cycles of incubation at 96° C. for 60 seconds, at 60° C. for 30 seconds, and at 72° C. for 30 seconds, followed by incubation at 72° C. for 6 minutes. Sequences immediately before the cDNA (a part of LacO sequence) and immediately after the NotI site (a part of SVpA sequence) in pSRO-cDNA (FIG. 13) were used as PCR primers (FIG. 17).

Agarose gel electrophoresis revealed that nine kinds of PCR products were obtained from genomic DNAs isolated from 5 out of the 16 strains described above.

Next, these PCR products were digested with Nru I and Not I, and ligated with the purified fragments generated by digesting pSROL-3′SS(NB2) with SmaI and NotI. The ligation product was introduced into competent cells of E. coli JM109 to obtain colonies resistant to ampicillin. The plasmids from the colonies were analyzed. Expression vector pSRO-cDNA (FIG. 13), which corresponds to nine kinds of cDNAs collected by PCR, was thus selected.

The nucleotide sequences of the nine kinds of pSRO-cDNA were analyzed. The second screening was performed as shown below.

10. Second Screening by Reporter Gene Method

The second screening was performed for cDNAs obtained in the first screening to confirm the inhibitory effect on the IL-8 promoter. The second screening was performed by the reporter gene method in which pIL8p-Luc (FIG. 14) was used as a luciferase expression vector having the IL-8 promoter.

If pSRO-cDNA, the expression vector of the cDNA obtained in the first screening (FIG. 13), and pIL8p-Luc are co-transfected at a ratio of 10:1, cells taking pIL8p-Luc also take the target cDNA expression vector into themselves (Analytical Biochemistry 188, 245-254 (1990)) Therefore, in this system, whether or not introducing the expression vector of the cDNA to be tested can inhibit the activation of the IL-8 promoter by TNF-&agr; stimulation was examined. Furthermore, pSV&bgr; (CLONTECH, 6178-1), the expression vector of &bgr;-galactosidase, was used as the internal reference for compensating the transfection efficiency of the expression vectors.

On the first day, 2×105 cells of IL8p-gpt-neo #17 were cultivated on a six-well plate. On the second day, transfection was performed using Transfectam by adding 1 &mgr;g of cDNA to be tested (pSRO-cDNA, FIG. 13), 0.1 &mgr;g of IL8p-Luc (FIG. 14), and 0.2 &mgr;g of pSV&bgr; (internal reference) per well. Three to four wells were used for every cDNA. On the third day, IPTG was added to 20 mM (final concentration). On the fourth day, 1 &mgr;M dexamethasone (final concentration) was added. After three hours, TNF was added to 100 U/ml (final concentration). After five hours, cells were collected with a cell lysis agent LC&bgr; (TOYO INK), and cell lysate was prepared. The luciferase activity in the lysate was then measured with PicaGene (TOYO INK). &bgr;-galactocidase activity was also measured with Galacto-Ligt (TROPIX) after endogenous galactocidase activity was eliminated by heating the cell lysate at 48° C. for 50 minutes. pSRO without cDNA was used as the control of pSRO-cDNA. The data were shown in terms of luciferase activity compensated by &bgr;-galactocidase activity (internal reference).

Consequently, TNF induced strong luciferase activity in the cells into which pSRO without cDNA was introduced, whereas treatment with dexamethasone inhibited the activity (FIG. 18). In the test cDNAs, S1-15, S1-b2, S2-3, and S20-1 showed inhibitory activity on the IL8 promoter, but S9-b4 and S15-4 showed no inhibitory activity (FIG. 18).

EXAMPLE 2

Analysis of “S1-15” Clone

S1-15 was selected by the second screening using the reporter gene and found to show inhibitory activity on the IL-8 promoter reproducibly. S1-15 was analyzed as follows.

1. Analysis of the Structure of S1-15

Sequencing of S1-15 revealed that it was a 637 bp DNA fragment. The sequence is described in SEQ ID NO: 2, and the amino acid sequence deduced therefrom is described in SEQ ID NO: 1. A homology search by algorithms of “Smith-Waterman” ((GENE BRIGHT), Hitachi Soft-Engineering) in the database of GenBank, based on the sequence of the DNA fragment, detected two genes (HIP116 and 6D3). HIP116 encodes the transcriptional regulatory factor that binds to the transcription initiation site of human. immunodeficiency virus (HIV)-1 and the SPH motif of the SV40 enhancer. This transcriptional regulatory factor was found to consist of 1009 amino acid residues and to have an estimated molecular weight of 114 kDa (Philip L. et al., The Journal of Biological Chemistry, Vol. 270, 4575-4587 (1995)). 6D3 encodes the transcriptional regulatory factor isolated as the factor binding to the 5′ upstream site of the plasminogen activator inhibitor-1 (PAI-1) gene.

Comparing the deduced amino acid sequence of S1-15 and the amino acid sequence of HIP116 revealed that S1-15 has the same sequence as the 1st to 152nd amino acids of 1009 amino acid residues of HIP116 except that the 102nd amino acid, asparagine, was replaced by serine (FIG. 19). Therefore, S1-15 encodes the transcriptional regulatory factor lacking most of the C-terminus. The 38th to 152nd amino acid residues of HIP116 were considered to be the region binding to DNA upon transcription (Philip L. et al., The Journal of Biological Chemistry Vol. 270, 4575-4587 (1995)) (FIG. 19) S1-15 encodes the region corresponding to the DNA binding region of HIP116 except for the 37 amino acid residues at the N-terminus. Though 6D3 does not comprise the whole DNA binding region (the 38th to 152nd amino acid residues) described in the above reference, it reportedly binds to the 5′ upstream site of the PAI-1 gene (Verhandlingen-Koninklijke, Academie Voor Genees Kunde Van Belgie, 55, 225-264 (1993)). Therefore, the DNA binding region of these transcriptional regulatory factors presumably varies depending on the DNA sequence to which the transcriptional regulatory factors are bound. S1-15, which also does not comprise the whole DNA binding region of HIP116, is thought to possess activity binding to the upstream site of the IL-8 gene.

The regions homologous to SNF2/SWI2 in HIP116 and Ring Finger are thought to interact with other transcriptional factors. “S1-15” completely lacks this region (FIG. 19).

Analysis of the S1-15 sequence revealed that the sequence derived from the vector was added to the 3′ end of S1-15. The expression vector without the vector-derived sequence, pBlue-SR-S1-15 (FIG. 20), was constructed and analyzed by the reporter gene method described above. The IL-8 promoter-inhibitory activity was also detected in pSR&agr;/S1-15, which lacked the vector-derived amino acid sequence (FIG. 21).

FIG. 22 shows the method of constructing pBlue-SR-S1-15. pBlue SR plasmid digested with SmaI and NotI was ligated with a synthetic DNA (LIC linker) depicted in FIG. 22 to construct plasmid pBlue-SR-LIC. S1-15 was inserted into the vector by the ligation independent cloning (LIC) method (Aslanidis, C. Nucleic Acids Res. 18: 6069-6074 (1990)). Specifically, pBlue-SR-LIC was digested with SmaI; recovered by low melting point agarose gel electrophoresis; purified by a nucleic acid separation/purification tip, “QIAGEN-tip 5” (Funakoshi, QIAGEN Inc.); and treated with T4 DNA polymerase in the presence of dATP. Separately, PCR was performed using the S1-15 gene-containing plasmid as the template, the primer (SEQ ID NO: 7) (5′-CTCGCTCGCCCACGCTCCTCTTGTCATCCCAC-3′), and the primer (SEQ ID NO: 8) (5′-CTGGTTCGGCCCATTATCCCCAAAAAGTCATCTGCAGA-3′). The PCR product was recovered by low melting point agarose gel electrophoresis, purified by nucleic acid separation/purification tip “QIAGEN-tip 5” (Funakoshi, QIAGEN Inc.), and treated with T4DNA polymerase in the presence of dTTP. Two DNA fragments treated with T4 DNA polymerase were annealed, and the annealing product was introduced into competent cells of E. coli strain K-12 XL1-Blue to obtain ampicillin resistant colonies. The desired sequence was confirmed to be inserted into the clones, thereby obtaining vector pBlue-SR-S1-15 capable of expressing S1-15 (FIG. 20).

2. Confirmation of IL-8 Production Inhibitory Activity of “S1-15” Obtained by the Second Screening

The inventors examined whether or not introducing the S1-15 expression vector inhibited IL-8 production of MRC-5 SV1 TG1 cells when stimulated by TNF-&agr;.

pBLUE-SR-S1-15 and pHook-1 (Invitrogen) were cotransfected to MRC-5 SV1 TG1 cells, and the transfectants were collected by a magnet with Capture-Tec Kit (Invitrogen). pBlue-SR-LIC, which is the control, was cotransfected with pHook-1 (Invitrogen). After 24 hours, IL-8 produced in the culture supernatants was measured by ELISA. The S1-15 transfectants produced less IL-8 than the control (FIG. 23).

3. Purification of S1-15 Protein

(1) Preparation of Expression Vector pGEX/S1-15

PCR was performed using “pSRO/S1-15” as the template, the primer (5′-ATGTCGACTCAGCGCCATGTCCTGGATGTTC-3′) (SEQ ID NO: 9), and the primer (5′-GTCACGATGCGGCCGCCCAAAAAGTCATATGCAGAGGCATG-3′) (SEQ ID NO: 10). The PCR product was digested with SalI and NotI and inserted into vector pGEX-5X-1 (Pharmacia), which was digested with SalI and NotI, to obtain expression vector pGEX/S1-15. E. coli JM109 was transformed with pGEX/S1-15.

(2) Purification of S1-15 Protein

E. coli carrying pGEX/S1-15 was cultured at 28° C. for one day. After 0.1 mM IPTG was added to the medium, culturing was performed for an additional 4 hours. The cells were collected and lysed in 6M urea. The supernatant obtained by centrifugation was diluted to a urea concentration of 2M, and the dilution was allowed to be absorbed by glutathione sepharose 4B. After the absorbent was washed, GST/S1-15 was eluted with glutathione. The eluate was dialyzed against 200 mM urea/100 mM NaCl/20mM Tris pH 8.0 then against 100 mM NaCl/20 mM Tris pH8.0/2mM CaCl2.

(3) Peptide Mapping by LC-MS

GST/S1-15 was digested with trypsin and analyzed by LC-MS to confirm that GST/S1-15 protein was constructed as designed.

EXAMPLE 3

Analysis of Anti-inflammatory Activity of S1-15

1. Generation of Antibody (Polyclonal Antibody) Specific for S1-15 Protein

The coding sequence of S1-15 was inserted into plasmid pGEX-5X-1 (Pharmacia) to produce a fused protein (GST/S1-15) of S1-15 and GST (glutathione S-transferase) in E. coli cells. The GST/S1-15 protein was purified using a glutathione-bound column, and then used as an antigen to immunize a rabbit. IgG was prepared from the antiserum and loaded onto a column to which a partial peptide fragment of S1-15, LQRDPNNPYDKNAIKV (SEQ ID: 11) is bound as a ligand. The antibody bound to LQRDPNNPYDKNAIKV (SEQ ID: 11) was eluted from the column to prepare polyclonal antibody specific for S1-15 (Anti-“S1-15” (c) rabbit IgG No.2).

2. Construction of Recombinant S1-15 Adenovirus Vector

A recombinant adenovirus vector was constructed as described below in accordance with the method of Izumi Saito et al. (Cell Technology 13(8): 757-763 (1994)).

(1) Construction of S1-15 Cassette Cosmid Vector (pAdex1CA “S1-15”)

First, an expression unit of S1-15 was inserted into an expression cassette pAdex1CAwt (see Izumi Saito et al., Cell Technology 13(8): 757-763 (1994)). Specifically, plasmid DNA pBlue-SR “S1-15” (FIG. 20) was digested with restriction endonucleases XhoI (Boehringer) and NotI (Boehringer), and the digested product was blunted at its both ends with Klenow enzyme (Takara Shuzo). The blunted fragment was purified by agarose electrophoresis, and a DNA fragment (approximately 540 bp) containing the entire coding region of S1-15 protein was isolated and purified using prepA-gene Matrix (Japan Bio-Rad Laboratories), a reagent for DNA purification.

Separately, a cosmid vector pAdex1CAwt (Izumi Saito et al., Cell Technology 13(8): 757-763 (1994)) containing CAG promoter (Miyazaki, J. et al., Gene 108: 193 (1991)) was digested with SwaI (Boehringer) and dephosphorylated at its both ends with alkaline phosphatase, and subsequently subjected to phenol extraction, centrifugation, and ethanol precipitation to prepare cosmid vector DNA with SwaI blunt ends.

After these two DNA fragments were ligated in the ligase reaction buffer supplemented with ATP and T4 DNA ligase, the ligation product was packaged in vitro into Lamda, using Giga Pack III Gold Packaging Extract (Stratagene), and transfected into E. coli DH5&agr;, a part of which was plated on the agar medium supplemented with ampicillin. Ampicillin resistant colonies thus obtained were cultured overnight in 2 ml of LB broth containing ampicillin to prepare cosmid DNA. The fragments of these cosmid DNAs were digested with restriction enzymes to select a clone into which a cDNA fragment of S1-15 was incorporated. The selected clone was designated pAdex1CA “S1-15”. This pAdex1CA “S1-15” DNA was digested with NruI and self-ligated with ligase to prepare a plasmid Pex1CA “S1-15,” which contained substantially no adenovirus genes. The plasmid DNA of Pex1CA “S1-15” was sequenced and confirmed that it had the correct coding sequence for “S1-15.” This plasmid DNA was transfected into COS cells and allowed to be expressed. The expression of S1-15 protein was confirmed by Western blot analysis using an antibody specific for S1-15 protein (Anti-“S1-15” (c) rabbit IgG No.2 described above). Based on this fact, the cosmid pAdex1CA “S1-15” was used for construction of a recombinant adenovirus.

(2) Preparation of Adenovirus DNA-Terminal Protein Complex (Ad5d1XDNA-TPC)

Adenovirus DNA-Terminal protein complex (Ad5d1XDNA-TPC), which was to be used for preparation of a recombinant adenovirus vector expressing S1-15 protein (Adex1CA “S1-15”) from the S1-15 cassette cosmid (pAdex1CA“S1-15”) described in (2)-1), was prepared according to the method described in “Methods for Gene Transfer, Expression and Analysis” in Bio-manual Series 4, Supplement of Jikken Igaku (Experimental Medicine), pp. 43-58 (1993) (Yodo-sha). In brief, HeLa cells were infected with adenovirus DNA, Ad5d1X (I. Saito et al., J. Virol. 54: 711-719 (1985)), and the virus particles were recovered, treated with guanidine-HCl, and subjected to ultra-centrifugation to isolate Ad5d1XDNA-TPC, which was treated with a restriction enzyme EcoT22I, purified by gel filtration, dispensed into vials, and stored at −80° C.

(3) Construction of Recombinant S1-15 Adenovirus Vector

Recombinant S1-15 adenovirus vector was constructed according to the method described in “Methods for Gene Transfer, Expression and Analysis” in Bio-manual Series 4, Supplement of Jikken Igaku (Experimental Medicine), pp. 51-53 (1993) (Yodo-sha).

S1-15 cassette cosmid vector (pAdex1CA “S1-15”) described in (2)-1) and EcoT22I-digested adenovirus DNA-Terminal protein complex (Ad5d1XDNA-TPC) described in (2)-2) were cotransfected, using Cellphect Transfection Kit (Pharmacia Biotech), into human embryonic kidney 293 cells (hereafter abbreviated to 293 cells), which had been cultured to confluence in the collagen-coated dish with diameter of 60 mm. On the next day, the cells were scraped and plated again on the 96-well collagen-coated plate.

Each virus-infected plaque of the 293 cells was recovered during the monitoring period of 15 days and frozen and thawed to yield a primary virus preparation. Each of the nine primary virus preparations was competent to kill the 293 cells grown to confluence in the 24-well collagen-coated plate. The contents of each well of the cultured plate were frozen and thawed to make secondary virus preparations.

Western blot analysis was performed on the nine secondary virus preparations using an antibody specific for S1-15 (Anti-“S1-15” (c) rabbit IgG No.2 described above), and all the samples but one were confirmed to express S1-15 protein.

Viral genomic DNA was prepared from each of the eight secondary virus samples that were confirmed to express S1-15 protein, and subjected to PCR to detect wild-type adenovirus in the preparations. The amplified fragment of E1A derived from wild-type adenovirus was detected in five but not detected in three out of the eight secondary virus preparations.

The three secondary virus preparations that were able to express S1-15 protein and did not contain detectable wild-type adenovirus were transfected into 293 cells cultured to confluence in the 100-mm collagen-coated dish. All the three virus preparations were competent to kill the 293 cells and thus stored as a tertiary virus preparation after freezing/thawing. No wild-type adenovirus was detected by PCR in these three tertiary virus preparations. In addition, a distinct band with the length corresponding to that of S1-15 sequence was detected by PCR.

The titer was determined for two of the three tertiary virus preparations (Adex-“S1-15” clone No.3 and clone No.4). Adex-“S1-15” clone No.4 was transfected into MRC-5 SV1 TG1 (Riken Cell Bank 207; fibroblast-like cells derived from human fetal lung), and the expression of S1-15 protein in the cell lysate was identified by Western blot analysis. The viral genomic DNA was recovered from the transfected cells to examine the contamination of wild-type adenovirus. No wild-type virus was detected. (4) Determination of viability of the cells transfected with recombinant adenovirus (E. M. Larson, et al., Invest. Ophthalmol. Vis. Sci. 38(10): 1929-33, 1997; M. J. White et al., J. Neurosci. Methods. 70(2): 195-200, 1996).

The culture supernatant was removed from the cultured cells transfected with virus for 24 hours, and DMEM (+10% FCS) medium and 1/10 volume of Almar Blue reagent (Biosource: cat No. DAL1025) were added to the cells, which were then incubated in a CO2 incubator for 3 hours. A part of the supernatant (10 &mgr;l) was transferred to a 96-well plate and the absorbance at 570 nm was measured. The absorbance value was regarded as an index of viability.

(5) Preparation of Cell Lysate from the Cells Transfected with Recombinant Adenovirus

Fifty microliters of 1×SDS gel-loading buffer (50 mM Tris-HCl (pH 6.8), 100 mM DTT, 2% SDS, 0.1% BPB, 10% glycerol) were added to the cultured cells transfected with virus. The mixture was stirred well, recovered in an Eppendorf tube, and heated at 100° C. for 5 minutes. This mixture was centrifuged at 15,000 rpm for 20 minutes at 4° C., and the supernatant was provided as cell lysate.

(6) Identification of S1-15 Protein by Western Blot Analysis

Thirty microliters of cell lysate prepared from the transfected cells were loaded on 12% polyacrylamide gel and electrophoresed.

The gel was soaked into Transfer Buffer (20% methanol, 25 mM Tris-borate buffer (pH 9.5)) for 5 minutes, and then transferred onto PVDF membrane (ImmobilonPSQ) by NovaBlot transfer unit (Amersham).

The transferred membrane was blocked in 10% skim milk/TBS-T (10 mM Tris-HCl (pH 7.9), 150 mM NaCl, 0.1% Tween 20) for a day and night at 4° C., and then incubated in 10% skim milk/TBS-T containing anti-“S1-15” antibody (Anti-“S1-15” (c) rabbit IgG No.2 described above) at the dilution of 1:500 for a day and night at 4° C.

After the membrane was washed in TBS-T for 5 minutes at room temperature, it was incubated in 10% skim milk/TBS-T containing anti-rabbit-IgG antibody (Amersham: NA934) at the dilution of 1:1000 for 1 hour at room temperature.

The membrane was washed in TBS-T four times for 15 minutes for each wash, soaked in ECL Western blotting detection reagents (Amersham: RPN2106) for 1 minute, put in hybribags, and exposed to X-ray film to obtain the detection data.

(7) Preparation of Viral Genomic DNA

(7-1) Preparation of Viral Genomic DNA from the Virus Preparations

An equal volume of 0.1% Triton X-100 in PBS(−) was added to an aliquot of a virus sample and the mixture was allowed to stand at 100° C. for 10 minutes. It was then centrifuged at 15,000 rpm for 20 minutes at 4° C. to obtain the supernatant as a genomic DNA sample.

(7-2) Preparation of Viral Genomic DNA from Cells Infected with Virus

The viral genomic DNA was prepared according to “Methods for Gene Transfer, Expression and Analysis of Gene” in Bio-manual Series 4, Supplement of Jikken Igaku (Experimental Medicine), p. 52 (1993) (Yodo-sha).

Four hundred microliters of TNE (50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM EDTA (pH 8.0)), 4 &mgr;l of Proteinase K (10 mg/ml) and 4 &mgr;l of 10% SDS were added to transfected cells. The mixture was stirred well and allowed to react for 1 hour at 50° C.

TE-saturated phenol was added to the resulting reaction mixture and vortexed. The mixture was centrifuged to harvest the supernatant, and phenol/chloroform (1:1) was added thereto. The mixture was centrifuged to recover the supernatant, to which chloroform was added. The mixture was vortexed to obtain the protein-free DNA solution. The resulting solution was treated with ethanol, and the precipitate obtained was dissolved in TE solution containing 1 mg/ml RNaseA to serve as a DNA sample of cellular virus.

(8) Detection of Wild-type Adenovirus by PCR

PCR was performed using 1 &mgr;l of the viral genomic DNA sample obtained in 7-1) or 7-2) as a template and adenovirus detection primers (1) and (2) described below at the final concentration of 20 nM. The mixture was first treated at 97° C. for 1 minute, and then subjected to 35 cycles of the reaction; each cycle consists of 97° C. for 30 sec., 58° C. for 30 sec., and 72° C. for 1 minute. This procedure amplifies wild-type E1A from RCA (Replication Competent Adenovirus) if the sample contains RCA. One sixth volume of 6×DNA dye (0.25% Bromphenol blue, 0.25% xylenecyanol, 30% glycerol) was added to the amplified sample and mixed well. Agarose gel electrophoresis was then performed to separate the DNA fragments, which were stained with ethidium bromide to detect the amplified E1A fragment (340 bp) under UV irradiation.

The sequences of the adenovirus E1A detection primers are as follows:

E1A detection primer (1): 5′-GAGACATATTATCTGCCACGGAGG-3′ (SEQ ID: 12)

E1A detection primer (2): 5′-TTGGCATAGAAACCGGACCCAAGG-3′ (SEQ ID: 13)

(9) Detection of the S-15 Insert in Viral Genomic DNA by PCR

The amplified fragment (429 bp) was detected and identified using the same condition and method as used above for detecting contamination of the wild-type adenovirus.

The sequences of the S1-15 detection primers are as follows:

“S1-15” detection primer (1): 5′-CGCCCACGCTCCTCTTGTCATCCCACT-3′ (SEQ ID: 14)

“S1-15” detection primer (2): 5′-CCCTTCAATTTGTGCCAATTTGTTGTC-3′ (SEQ ID: 15)

(10) Determination of the Titer of the Virus Samples

The titer of the virus samples was determined according to “Methods for Gene Transfer, Expression and Analysis” in Bio-manual Series 4, Supplement of Jikken Igaku (Experimental Medicine), pp. 54-56 (1993) (Yodo-sha).

The virus samples whose titer were to be determined were diluted 10,000 folds with DMEM-5% FCS (fetal calf serum) by repeating the 10-fold dilution four times. A 25&mgr;l portion of the virus solution diluted 10,000 folds was added to wells in the first row of the 96-well plate; in each well of the plate was previously added 50 &mgr;l of DMEM-5% FCS. From each well in the first row of the plate, 25&mgr;l of the solution was removed to the wells in the second row using a multi-channeled pipette, and this manipulation was repeated until it reached to the 11th row. The final 25 &mgr;l was discarded.

One third volume of 293 cells cultured to confluence in 10 mm dish was added to 10 ml of DMEM-5% FCS. A 25 &mgr;l portion of the resulting cell suspension was added to each well of the 96-well plate described above, and started the determination of the titer.

On the day 3, 6 and 10, 50 &mgr;l of DMEM-10% FCS was added to each well, and on day 13, cytopathogenicity was observed for each well under a microscope. The titer was calculated according to the formula described in “Methods for Gene Transfer, Expression and Analysis” in Bio-manual Series 4, Supplement of Jikken Igaku (Experimental Medicine), pp. 54-56 (1993) (Yodo-sha).

3. Analysis of Anti-inflammatory Activity of S1-15 Expressed by the Recombinant S1-15 Adenovirus Vector

MRC-5 SV1 TG1 (Riken Cell Bank 207; fibroblast-like cells derived from human fetal lung) was used as cultured cells capable of producing proinflammatory chemokines IL-8 and GRO&agr; in response to the stimulation with IL-1&bgr;, and two viruses, Adex-1w1 (control virus expressing no protein: 2.5×108PFU/ml) and Adex-“S1-15” clone No.4 (expressing S1-15: 1.5×108PFU/ml), were used to infect these cells.

The amount of each virus infected to the cells were M.O.I.=10, 100 or 200. IL-1&bgr; (100 U/ml medium) was added to the culture 24 hours after the infection. After 5 hours, the supernatant was harvested. Immediately thereafter, fresh medium containing Alamar Blue was added to the cells and cultured for 3 hours, and the medium and the cells were then recovered. For each run, measurement was replicated on three cultured wells.

IL-8 production (ng/ml) in the harvested supernatant was determined using Interleukine 8 (IL-8) human ELISA system (Amersham: RPN 2176). The absorbance (OD570) of the recovered medium containing Alamar Blue was also determined as the viability value of the cell. The IL-8 production value (IL-8 ng/ml/Alamar Blue OD570) was calculated by dividing the IL-8 production by the viability value of the cell (FIG. 24A).

GRO&agr; production (ng/ml) in the harvested supernatant was determined using (h)GRO&agr;LELISA system (Amersham: RPN 2173). The absorbance (OD570) of the recovered medium containing Alamar Blue was also determined as the viability value of the cell. The GRO&agr; production value (GRO&agr; ng/ml/Alamar Blue OD570) was calculated by dividing the GROC&agr; production (ng/ml) by the viability value of the cell (FIG. 24B).

The cell lysate was prepared from the infected cells to identify the expression of S1-15 protein by Western blot analysis (FIG. 25).

INDUSTRIAL APPLICABILITY

The present invention provides a protein having the transcriptional inhibitory activity and lacking at least a part of regions other than those having DNA binding activity of transcriptional regulatory factors.

If expression of a specific gene correlates with a disease, the protein of the present invention can be used to treat the disease. In particular, the protein of the present invention is expected to be applied to gene therapy considering its high gene specificity. The S1-15 protein and a gene encoding it can be used as an anti-inflammatory agent.

15 1 153 PRT Homo sapiens 1 Met Ser Trp Met Phe Lys Arg Asp Pro Val Trp Lys Tyr Leu Gln Thr 1 5 10 15 Val Gln Tyr Gly Val His Gly Asn Phe Pro Arg Leu Ser Tyr Pro Thr 20 25 30 Phe Phe Pro Arg Phe Glu Phe Gln Asp Val Ile Pro Pro Asp Asp Phe 35 40 45 Leu Thr Ser Asp Glu Glu Val Asp Ser Val Leu Phe Gly Ser Leu Arg 50 55 60 Gly His Val Val Gly Leu Arg Tyr Tyr Thr Gly Val Val Asn Asn Asn 65 70 75 80 Glu Met Val Ala Leu Gln Arg Asp Pro Asn Asn Pro Tyr Asp Lys Asn 85 90 95 Ala Ile Lys Val Asn Ser Val Asn Gly Asn Gln Val Gly His Leu Lys 100 105 110 Lys Glu Leu Ala Gly Ala Leu Ala Tyr Ile Met Asp Asn Lys Leu Ala 115 120 125 Gln Ile Glu Gly Val Val Pro Phe Gly Ala Asn Asn Ala Phe Thr Met 130 135 140 Pro Leu His Met Thr Phe Trp Gly Lys 145 150 2 637 DNA Homo sapiens CDS (179)..(637) 2 cggcgtcgac gtctgactgg actcgcggcg acttaccttt cagtcgtgcg ctcctgatcc 60 ggcgctcgga atttgtcccc ggcttcaggg ctgcggggcc tggaaggagg cgtatcgagg 120 cggctcgaaa acgatccagg ggagccgagg cgctcctctt gtcatcccac tcagcgcc 178 atg tcc tgg atg ttc aag agg gat cca gtt tgg aag tac ttg cag act 226 Met Ser Trp Met Phe Lys Arg Asp Pro Val Trp Lys Tyr Leu Gln Thr 1 5 10 15 gtc cag tat gga gtt cat gga aat ttt cca cgc ctc tca tat cca act 274 Val Gln Tyr Gly Val His Gly Asn Phe Pro Arg Leu Ser Tyr Pro Thr 20 25 30 ttc ttt cca cgt ttt gaa ttc caa gat gtt atc cct cca gat gac ttt 322 Phe Phe Pro Arg Phe Glu Phe Gln Asp Val Ile Pro Pro Asp Asp Phe 35 40 45 cta act agt gat gaa gaa gta gat tcc gtt tta ttt gga agt ttg aga 370 Leu Thr Ser Asp Glu Glu Val Asp Ser Val Leu Phe Gly Ser Leu Arg 50 55 60 ggt cat gtg gtt gga cta cgc tat tac acg gga gta gtt aat aat aat 418 Gly His Val Val Gly Leu Arg Tyr Tyr Thr Gly Val Val Asn Asn Asn 65 70 75 80 gaa atg gtt gca tta caa cga gat cct aat aac cct tat gat aag aat 466 Glu Met Val Ala Leu Gln Arg Asp Pro Asn Asn Pro Tyr Asp Lys Asn 85 90 95 gca att aaa gta aac agt gtg aat gga aat caa gtt ggc cat tta aag 514 Ala Ile Lys Val Asn Ser Val Asn Gly Asn Gln Val Gly His Leu Lys 100 105 110 aaa gag ctt gca ggt gct ttg gcc tat atc atg gac aac aaa ttg gca 562 Lys Glu Leu Ala Gly Ala Leu Ala Tyr Ile Met Asp Asn Lys Leu Ala 115 120 125 caa att gaa ggg gta gtt cct ttt ggt gca aac aat gct ttt acc atg 610 Gln Ile Glu Gly Val Val Pro Phe Gly Ala Asn Asn Ala Phe Thr Met 130 135 140 cct ctg cat atg act ttt tgg gga aaa 637 Pro Leu His Met Thr Phe Trp Gly Lys 145 150 3 29 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 3 ataagctttt cacatgagcg aaaaataca 29 4 29 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 4 atggatccct attgtaaccc gcctgaagt 29 5 38 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 5 atgtctcgag aattcagtaa cccaggcatt attttatc 38 6 30 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 6 ttgtcctaga agcttgtgtg ctctgctgtc 30 7 32 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 7 ctcgctcgcc cacgctcctc ttgtcatccc ac 32 8 38 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 8 ctggttcggc ccattatccc caaaaagtca tctgcaga 38 9 31 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 9 atgtcgactc agcgccatgt cctggatgtt c 31 10 41 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized sequence 10 gtcacgatgc ggccgcccaa aaagtcatat gcagaggcat g 41 11 16 PRT Artificial Sequence Description of Artificial Sequencean artificially synthesized partial peptide sequence of S1-15 11 Leu Gln Arg Asp Pro Asn Asn Pro Tyr Asp Lys Asn Ala Ile Lys Val 1 5 10 15 12 24 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 12 gagacatatt atctgccacg gagg 24 13 24 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 13 ttggcataga aaccggaccc aagg 24 14 27 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 14 cgcccacgct cctcttgtca tcccact 27 15 27 DNA Artificial Sequence Description of Artificial Sequencean artificially synthesized primer sequence 15 cccttcaatt tgtgccaatt tgttgtc 27

Claims

1. An isolated nucleic acid encoding the that inhibity the activity of the interleukin 8 promoter polypeptide, said nucleic acid being selected from the group consisting of:

(a) a nucleic acid encoding a polypeptide having SEQ ID NO:1; and

(b) a nucleic acid having the sequence set out in SEQ ID NO:2.

2. The isolated nucleic acid of claim 1 wherein the nucleic acid encodes a polypeptide which is at least 60% identical to SEQ ID NO:1, and wherein the polypeptide inhibits the activity of the interleukin 8 promotes.

3. The isolated nucleic acid of claim 1 wherein the nucleic acid encodes a polypeptide which is at least 90% identical to SEQ ID NO:1, and wherein the polypeptide inhibits the activity of the interleukin 8 promoter.

4. The isolated nucleic acid of claim 1 wherein the polypeptide comprises up to 30 conservative amino acid substitutions, and wherein the polypeptide inhibits the activity of the interleukin 8 promoter.

5. A vector comprising the nucleic acid of claim 1.

6. A vector comprising the nucleic acid of claim 2.

7. A vector comprising the nucleic acid of claim 3.

8. A vector comprising the nucleic acid of claim 4.

9. A host cell comprising the nucleic acid of claim 1.

10. A host cell comprising the nucleic acid of claim 2.

11. A host cell comprising the nucleic acid of claim 3.

12. A host cell comprising the nucleic acid of claim 4.