Materials and methods for FOXP3 tumor suppression
Provided herein are methods of treating a cancer in a subject comprising administering a FOXP3 protein, a nucleic acid encoding a FOXP3 protein, or an inducing compound which induces FOXP3 protein expression. Methods of altering a phenotype of a cancer cell or tumor cell, methods of inhibiting growth of such cells, and methods of inducing apoptosis of these cells are also provided herein. These methods comprise contacting the cell with a FOXP3 protein, a nucleic acid encoding a FOXP3 protein, or an inducing compound which induces FOXP3 protein expression. Further provided herein are diagnostic methods, comprising comparing the expression or structure of a FOXP3 protein or FOXP3 gene in a test sample to that of a normal or prior sample. A method of screening a test compound for anti-cancer activity comprising administering to cells the test compound and measuring FOXP3 protein or FOXP3 gene expression is moreover provided herein.
Latest The Regents of the University of Michigan Patents:
This patent application claims the benefit of U.S. Provisional Patent Application No, 60/917,488, filed on May 11, 2007.
GRANT FUNDINGThis invention was made with government support under Grant Nos. AI52342, CA58033, and CA120901 awarded by the National Institutes of Health and Grant Nos. W81XWH-06-1-0366 and W81XWH-07-1-0169 awared by the Army Medical Research and Material Command (Department of Defense). The government has certain rights in the invention.
INTRODUCTIONIdentification of BRCA1 and BRCA2 genes marks a key advance in understanding the genetic defects responsible for breast cancer (Miki et al., Science 266: 66-71 (1994); and Wooster et al., Nature 378: 789-792 (1995)). Several other genes, such as TP53, PIK3CA and PTEN, have also been implicated in familial and sporadic cancers (Samuels et al., Science 304: 554 (2004); and Wooster, The New England Journal of Medicine 348: 2339-2347 (2003)). However, the genetic defects for breast cancer have yet to be fully elucidated.
There is an important distinction between autosomal and X-linked genes in that many genes in the latter category are subject to X-inactivation, making it easier to fulfill Knudson's two-hit theory (Knudson, Proc Natl Acad Sci USA 68: 820-823 (1971)). As such, X-linked tumor suppressor genes can potentially be more important because loss of heterozygosity (LOH) or mutation of a single allele can in effect functionally silence the gene (Spatz et al., Nat Rev Cancer 4: 617-629 (2004)). Essentially all tumor suppressor genes are autosomal (Spatz et al., Nat Rev Cancer 4: 617-629 (2004)), although tantalizing evidence concerning abnormalities in the X-chromosome, including LOH, skewed inactivation and selective loss, has been reported in breast cancer samples (Kristiansen et al., J. Med Genet 42: 877-880 (2005); Piao and Malkhosyan, Genes Chromosomes Cancer 33: 262-269 (2002); Richardson et al., Cancer Cell 9: 121-132 (2006); and Roncuzzi et al., Cancer Genet Cytogenet 135: 173-176 (2002)).
HER-2/Neu/ErbB2 is one of the first oncogenes to be identified (Schechter et al., Nature 312: 513-516 (1984)) and has been demonstrated to be expressed in a large proportion of cancer cells (Garcia de Palazzo et al., Int J. Biol Markers 8: 233-239 (1993)) and the level of HER-2/NEU is an important prognostic marker (Slamon et al., Science 235: 177-182 (1987)). Consistent with this finding, anti-HER-2/NEU antibody Herceptin has emerged as an important therapeutic for patients with over-expressed HER-2/NEU on cancer tissues (Slamon et al., N. Engl J Med 344: 783-792 (2001)). Given the clinical and therapeutic significance of Her-2/Neu/ErbB2 over-expression, it is important to identify the molecular mechanisms responsible for its over-expression.
A well-established mechanism responsible for HER-2 over-expression in human cancer is gene amplification (Slamon et al., Science 235: 177-182 (1987)). It is unclear, however, whether gene amplification alone is sufficient to cause HER-2 over-expression because a significant proportion of human cancers with moderate over-expression of HER-2 do not show gene amplification (Bofin et al., Am J Clin Pathol 122: 110-119 (2004); Jimenez et al., Mod Pathol 13: 37-45 (2000); and Todorovic-Rakovic et al., Pathol Int 55: 318-323 (2005)). It is therefore of great interest to identify regulators for HER-2 expression in breast cancer. In this context, Xing et al. (Xing et al., Nat Med 6: 189-195 (2000)) reported that DNA-binding protein PEA3 specifically targets a DNA sequence on the HER-2/neu promoter and down-regulates the promoter activity. It is less clear, however, whether genetic lesions of PEA3 can cause HER-2 over-expression.
Thus there exists a need in the art to identify compounds and methods that modulate over-expression of oncogenes and oncogenic proteins involved in cancer for the development of useful therapeutics and prophylactics.
SUMMARY OF THE INVENTIONThe invention provides methods of treating a cancer in a subject. In one embodiment, the method comprises administering to the subject a FOXP3 protein in an amount effective to treat cancer. In another embodiment, the method comprises administering to the subject a nucleic acid comprising a protein coding sequence encoding a FOXP3 protein and a promoter sequence active in a cancer cell of the subject, wherein the promoter is operably linked to the protein coding sequence, in an amount effective to treat cancer. In yet another embodiment, the method comprises administering to the subject an inducing compound that induces expression of a FOXP3 protein in an amount effective to treat cancer.
The invention also provides methods for altering a phenotype of a cancer cell or tumor cell. In one aspect, the method comprises contacting the cell with a FOXP3 protein in an amount effective to alter the phenotype of the cell. In another aspect, the method comprises contacting the cell with a nucleic acid comprising a protein coding sequence encoding a FOXP3 protein and a promoter sequence active in the cell, wherein the promoter sequence is operably linked to the protein coding sequence, in an amount effective to alter the phenotype of the cell. In yet another aspect, the method comprises contacting the cells with an inducing compound that induces expression of a FOXP3 protein in an amount effective to alter the phenotype of the cell.
The invention further provides methods of inhibiting growth of a cancer cell or tumor cell. In one aspect, the method comprises contacting the cell with a FOXP3 protein in an amount effective to inhibit growth of the cell. In another aspect, the method comprises contacting the cell with a nucleic acid comprising a protein coding sequence encoding a FOXP3 protein and a promoter sequence active in the cell, wherein the promoter sequence is operably linked to the protein coding sequence, in an amount effective to inhibit growth of the cell. In yet another aspect, the method comprises contacting the cells with an inducing compound that induces expression of a FOXP3 protein in an amount effective to inhibit growth of the cell.
Further provided by the invention are methods of inducing apoptosis of a cancer cell or tumor cell. In one aspect, the method comprises contacting the cell with a FOXP3 protein in an amount effective to induce apoptosis of the cell. In another aspect, the method comprises contacting the cell with a nucleic acid comprising a protein coding sequence encoding a FOXP3 protein and a promoter sequence active in the cell, wherein the promoter sequence is operably linked to the protein coding sequence, in an amount effective to induce apoptosis of the cell. In yet another aspect, the method comprises contacting the cells with an inducing compound that induces expression of a FOXP3 protein in an amount effective to induce apoptosis of the cell.
A method of diagnosing susceptibility to cancer of a subject is provided herein. The method comprises comparing expression or structure of a FOXP3 protein or a FOXP3 gene in a test tissue sample of the subject to expression or structure of a FOXP3 protein or a FOXP3 gene in a normal tissue sample. Aberrant expression or structure of the FOXP3 protein or a FOXP3 gene in the test tissue sample compared to FOXP3 protein or FOXP3 gene expression or structure in a normal tissue sample indicates susceptibility to cancer of the subject.
Also provided is a method of diagnosing onset of cancer in a subject. The method comprises comparing expression or structure of a FOXP3 protein or a FOXP3 gene in a test tissue sample of the subject to expression or structure of a FOXP3 protein or a FOXP3 gene in a normal tissue sample. Aberrant expression or structure of the FOXP3 protein or a FOXP3 gene in the test tissue sample compared to FOXP3 protein or FOXP3 gene expression or structure in a normal tissue sample indicates the onset of cancer.
A method of monitoring progression of cancer in a subject is provided herein. The method comprises comparing expression or structure of a FOXP3 protein or a FOXP3 gene in a test tissue sample from the subject to expression or structure of the FOXP3 protein or FOXP3 gene in a prior tissue sample from the same subject. Aberrant expression or structure of the FOXP3 protein or FOXP3 gene in the test tissue sample compared to FOXP3 protein or FOXP3 gene expression or structure in the prior tissue sample indicates progression of cancer in the subject.
The invention further provides a method of screening a test compound for anti-cancer activity. The method comprises administering to cells the test compound and measuring expression of a FOXP3 protein or FOXP3 gene in the cells. Increased expression of FOXP3 protein or FOXP3 gene in the cells is indicative of anti-cancer activity of the test compound.
DETAILED DESCRIPTION OF THE INVENTIONThe FOXP3 gene was identified during position cloning of Scurfin, a gene responsible for X-linked autoimmune diseases in mice and humans (Immune dysregulation, polyendopathy, enterophathy, X-linked, IPEX) (Bennett et al., Nat Genet 27: 20-21 (2001); Brunkow et al., Nat Genet 27: 68-73 (2001); Chatila et al., J. Clin Invest 106: R75-81 (2000); and Wildin et al., Nat Genet 27: 18-20 (2001)). In work described herein, systemic analyses demonstrate that the FOXP3 gene is a mammary and prostate tumor suppressor in mice and humans. Moreover, as shown herein, FOXP3 represses transcription of the HER-2/ErbB2 gene via interaction with forkhead DNA binding motifs in the ErbB2 promoter. FOXP3 is also shown herein to repress transcription of the Skp2 and Myc genes, and to induce the expression of the tumor suppressor gene, p21. Furthermore, as shown herein, expression of FOXP3 caused a decrease in in vitro cancer cell growth, a decrease in in vivo tumor cell growth, a decrease in tumorigenicity, an increase in survival time in tumor-burdened mice, and an induction of apoptosis of cancer cells. Furthermore, an inducer of FOXP3 expression increased the killing of cancer cells, as shown herein.
These findings allow for exploitation of the tumor suppression activity as a marker for diagnosing susceptibility, onset and progression of cancer, methods for treating cancer, and methods for identifying compounds with the same or similar tumor suppression activity that provide therapeutic benefit as well as compounds that induce FOXP3 protein expression in cancer cells.
Treatment
The invention provides methods of treating a cancer in a subject. In one embodiment, the method comprises administering to the subject a FOXP3 protein in an amount effective to treat cancer.
FOXP3 Protein
As used herein “FOXP3 protein” refers to a full length protein or a fragment or a variant of a protein which has FOXP3 biological activity (i.e., biological activity of a FOXP3 protein). The term “biological activity of a FOXP3 protein” as used herein includes transcriptional regulation of one or more genes that includes a promoter sequence that binds FOXP3, the binding of which results in regulated transcription of a protein coding sequence operably linked to the FOXP3 binding site. In one embodiment, the promoter sequence is operably linked to an oncogene. In one specific embodiment, the oncogene is HER-2, which is also known in the art as Neu and ErbB2. In another specific embodiment, the oncogene is Skp2 or Myc. Such oncogenes are known in the art. See, for example, Entrez Gene ID Nos: 2064, 6502, 4609; Maguire and Greene, Semin Oncol 16: 148-155 (1989); Zuo et al., J Clin Invest 117: 3765-3773 (2007); Nakayama et al., Nat Rev Cancer 6: 369-381 (2006); Kelly and Siebenlist, J Clin Immunol 5: 65-77 (1985).
The biological activity of a FOXP3 protein can refer to any of the biological activities of a FOXP3 protein as demonstrated herein. In this regard, the biological activity of a FOXP3 protein can be the induction of apoptosis of a cancer cell or tumor cell, the reduction or repression of expression of an oncogene, e.g., ErbB2, Skp2, and Myc, the induction of expression of tumor suppressor genes, e.g., p21, and/or the inhibition or reduction of tumor or cancer cell growth.
In one aspect of the invention, the FOXP3 protein is any of those encoded by any of GenBank Accession Nos: NM—014009; NM—054039; EF419427; DQ387959; NM—001045933; NM—001032918; DQ322170; XM—001143169; AY841945; DQ010327; AY357713; AY357712; AY376065; AF277994; AF277993; AF277992; AF277991; DQ045675; and DQ045674; which are set forth herein as SEQ ID NOs: 1 to 19, respectively, and fragments and variants thereof. Accordingly, the FOXP3 protein can be any of those comprising an amino acid sequence of any of GenBank Accession Nos. NP—054728; NP—473380; ABN79272; ABD52722; NP—001039398; NP—001028090; ABC59848; XP—001143169; AAW28860; AAY27088; AAR11306; AAR11305; AAQ82647; AAG53608; AAG53607; AAG53606; and AAG53605; which are set forth herein as SEQ ID NOs: 20 to 36, and fragments and variants thereof.
The FOXP3 protein can consist essentially of any of the foregoing amino acid sequences described herein, such that other components, e.g., other amino acids, do not materially change the biological activity of the FOXP3 protein. In this regard, the FOXP3 protein can consist essentially of the amino acid sequence of any of SEQ ID NOs: 20 to 36. Alternatively, the FOXP3 protein can consist of any of the specified amino acid sequences described herein, e.g., SEQ ID NOs: 20 to 36.
Variant FOXP3 Protein
In a specific aspect, the FOXP3 protein, which is administered to the subject, is a variant FOXP3 protein. The term “variant” as used herein with respect to a protein, e.g., a FOXP3 protein, includes naturally-occurring proteins that have an amino acid sequence that differs from a previously identified FOXP3 protein and which maintains FOXP3 biological activity, as well as synthetic proteins in which one or more amino acid changes have been introduced into a naturally-occurring protein sequence. Naturally occurring variant proteins can include, for example, an isoform, an alternatively spliced variant, an allelic variant, an ortholog, a paralog, and the like. Synthetic variant proteins include, for example, a genetically engineered mutant.
In one aspect, the variant FOXP3 protein has substantial or significant sequence identity or similarity to a parent FOXP3 protein, which variant FOXP3 protein retains the biological activity of the parent FOXP3 protein. Variants encompass, for example, those variants of a parent FOXP3 protein described herein that retain the ability to specifically bind to a promoter of a gene and regulate the transcription of that gene (e.g., Erb2, Skp2, Myc) to a similar extent, the same extent, or to a higher extent, as the parent FOXP3 protein. In reference to the parent FOXP3 protein, the variant can, for instance, be at least about 30%, 50%, 75%, 80%, 85%, 90%, 93%, 95%, 98% or more identical in amino acid sequence to the parent FOXP3 protein. The biological activity of the variant can be about 30%, 50%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 110%, 125%, 150%, 200%, 500%, 1000% or more of the biological activity of the parent FOXP3 protein.
The amino acid sequence of the variant FOXP3 protein can comprise, for example, the amino acid sequence of the parent FOXP3 protein with at least one conservative amino acid substitution. Conservative amino acid substitutions are known in the art, and include amino acid substitutions in which one amino acid having certain physical and/or chemical properties is exchanged for another amino acid that has the same chemical or physical properties. For instance, the conservative ammo acid substitution can be an acidic amino acid substituted for another acidic amino acid (e.g., Asp or Glu), an amino acid with a nonpolar side chain substituted for another amino acid with a nonpolar side chain (e.g., Ala, Gly, Val, Ile, Leu, Met, Phe, Pro, Trp, Val, etc.), a basic amino acid substituted for another basic amino acid (Lys, Arg, etc.), an amino acid with a polar side chain substituted for another amino acid with a polar side chain (Asn, Cys, Gln, Ser, Thr, Tyr, etc.), etc.
Alternatively or additionally, the variant FOXP3 protein can comprise the amino acid sequence of the parent FOXP3 protein with one or more non-conservative amino acid substitutions. In one aspect, the non-conservative amino acid substitution does not interfere with or inhibit the biological activity of the variant FOXP3 protein. In a specific aspect, the non-conservative amino acid substitution enhances the biological activity of the variant FOXP3 protein, such that the biological activity of the variant FOXP3 protein is increased as compared to the parent FOXP3 protein.
FOXP3 Protein Fragments
In one aspect, a fragment of a FOXP3 protein, or a variant thereof, is administered to the subject. The term “fragment” as used herein with reference to a FOXP3 protein means a portion comprising contiguous amino acids of the FOXP3 protein of which it is a part (the parent FOXP3 protein), provided that the portion retains substantial biological activity of the parent FOXP3 protein. FOXP3 protein fragments encompass, for example, those parts of a FOXP3 protein that retain the ability to, e.g., specifically bind to a promoter of a gene (e.g., Erb2, Skp2, Myc) to regulate the transcription of the gene, to a similar extent, the same extent, or to a higher extent, as the parent FOXP3 protein. In reference to the parent FOXP3 protein, the FOXP3 protein fragment can comprise, for instance, about 10%, 25%, 30%, 50%, 68%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, of the
FOXP3 protein. The biological activity of the fragment can be about 30%, 50%, 75%, 80%, 85%, 90%, 93%, 95%, 98%, 100%, 110%, 125%, 150%, 200%, 500%, 1000% or more of the biological activity of the parent FOXP3 protein.
In one instance, the variant FOXP3 protein is a variant having substantial sequence identity to any of the FOXP3 proteins described herein (e.g., SEQ ID NOs: 20-36) with one or more amino acid substitutions at positions that are not conserved among the amino acid sequences of the different FOXP3 orthologs, e.g., the FOXP3 proteins of humans, mice, monkeys, chimpanzees, cows, and cats. In a specific aspect, the variant FOXP3 protein is a variant comprising the amino acid sequence of a human FOXP3 protein (SEQ ID NO: 20) with one or more amino acid modifications at any of the following positions of SEQ ID NO: 20: 7, 10, 15, 17, 22, 23, 27-29, 32, 34, 35, 38-41, 43, 44, 52, 54, 56, 60, 64, 71, 74, 84, 89, 103, 111, 114, 121, 124, 125, 132, 135, 136, 140, 158, 165, 173-176, 182, 184-186, 189, 192, 209, 213, 229, 238, 243, 247, 254, 266, 267, 270, 272, 275, 278, 285-292, 296, 297, 299, 304, 305, 321, 326, 334, 336, 356, 373, 404, 411, 422, 423, 428, 430, and 431.
The FOXP3 protein variant or fragment can comprise additional amino acids at the amino or carboxy terminus, or at both termini, which additional amino acids are not found in the amino acid sequence of the parent FOXP3 protein. In one aspect, the additional amino acids do not encode another protein, but enhance the physico-chemical characteristics of the FOXP3 protein variant or fragment. In a specific aspect, the additional amino acids increase the stability and/or solubility of the FOXP3 protein variant or fragment. In another specific aspect, the additional amino acids aid in the isolation and/or purification of the FOXP3 protein variant or fragment. In one aspect, the additional amino acids do not interfere with the biological function of the FOXP3 protein variant or fragment, e.g., the ability to specifically bind to a promoter of a gene and regulate the transcription of that gene (e.g., Erb2, Skp2, Myc). In another aspect, the additional amino acids enhance the biological activity, as compared to the biological activity of the parent FOXP3 protein.
Accordingly, the FOXP3 proteins (including variants and fragments thereof) can be of any length, i.e., can comprise any number of amino acids, provided that the FOXP3 proteins, (or variants or fragments thereof) retain substantial biological activity. For example, the polypeptide can be about 50 to about 5000 amino acids long, such as 50, 70, 75, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more amino acids in length. In this regard, the FOXP3 protein can include FOXP3 oligopeptides. Also, the biological activity of the fragment can be about 30%, 50%, 75%, 80%, 85%, 90%, 93%, 95%, 98%, 100%, 110%, 125%, 150%, 200%, or more of the biological activity of the parent FOXP3 protein.
Modified FOXP3 Proteins
In one aspect of the invention, the FOXP3 protein (including variants and fragments thereof) is modified to comprise one or more synthetic amino acids in place of one or more naturally-occurring amino acids. Such synthetic amino acids are known in the art, and include, for example, aminocyclohexane carboxylic acid, norleucine, α-amino n-decanoic acid, homoserine, S-acetylammomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4- nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, β-phenylserine β-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N′-benzyl-N′-methyl-lysine, N′,N′-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentane carboxylic acid, α-aminocyclohexane carboxylic acid, α-aminocycloheptane carboxylic acid, α-(2-amino-2-norbornane)-carboxylic acid, α,γ-diaminobutyric acid, α,β-diaminopropionic acid, homophenylalanine, and α-tert-butylglycine.
In one aspect, the FOXP3 proteins (including variants and fragments) are glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, cyclized via, e.g., a disulfide bridge, or other intramolecular bridge, converted into an acid addition salt, dimerized, polymerized, fused, and/or conjugated.
Salts
In one aspect, the FOXP3 protein (including variants and fragments) is in the form of a salt, e.g., a pharmaceutically acceptable salt. Such salts can be prepared in situ during the final isolation and purification of the FOXP3 protein, or separately prepared by reacting a free base function with a suitable acid. Examples of acids which can be employed to form pharmaceutically acceptable acid addition salts include, for example, an inorganic acid, e.g., hydrochloric acid, hydrobromic acid, sulphuric acid, and phosphoric acid, and an organic acid, e.g., oxalic acid, maleic acid, succinic acid, and citric acid.
Representative acid addition salts include, but are not limited to acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphor sulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, fumarate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethansulfonate (isothionate), lactate, maleate, methane sulfonate, nicotinate, 2-naphthalene sulfonate, oxalate, palmitoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, phosphate, glutamate, bicarbonate, p-toluenesulfonate, and undecanoate.
Basic addition salts also can be prepared in situ during the final isolation and purification of the FOXP3 protein, or by reacting a carboxylic acid-containing moiety with a suitable base such as the hydroxide, carbonate, or bicarbonate of a pharmaceutically acceptable metal cation or with ammonia or an organic primary, secondary, or tertiary amine. Pharmaceutically acceptable salts include, but are not limited to, cations based on alkali metals or alkaline earth metals such as lithium, sodium, potassium, calcium, magnesium, and aluminum salts, and the like, and nontoxic quaternary ammonia and amine cations including ammonium, tetramethylammonium, tetraethylammonium, methylammonium, dimethylammonium, trimethylammonium, triethylammonium, diethylammonium, and ethylammonium, amongst others. Other representative organic amines useful for the formation of base addition salts include, for example, ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine, and the like.
Conjugates
In one aspect, the FOXP3 protein is conjugated to a second component via covalent or non-covalent means. The second component can be any component, provided that it does not interfere with the function of the FOXP3 protein or nucleic acid. In a specific aspect, the second component is a bead, a nanoparticle, a microparticle, a detectable label, a polymer, etc. The detectable label can be, for example, a radioisotope, a fluorophore, and an element particle, e.g., gold, silver. Conjugates, as well as methods of synthesizing conjugates in general, are known in the art (See, for instance, Hudecz, F., Methods Mol Biol. 298: 209-223 (2005) and Kirin et al., Inorg Chem. 44(15): 5405-5415 (2005)).
The second component can be directly or indirectly linked or conjugated to the FOXP3 protein. In this regard, the conjugate can comprise a linker which links or bridges the FOXP3 protein to the second component.
In one embodiment, the conjugate comprises a polymer. The polymer can comprise one or more of the following polymers: polyamides, polycarbonates, polyalkylenes and derivatives thereof including, polyalkylene glycols, polyalkylene oxides, polyalkylene terepthalates, polymers of acrylic and methacrylic esters, including poly(methyl methacrylate), poly(ethyl methacrylate), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate), polyvinyl polymers including polyvinyl alcohols, polyvinyl ethers, polyvinyl esters, polyvinyl halides, poly(vinyl acetate), and polyvinylpyrrolidone, polyglycolides, polysiloxanes, polyurethanes and co-polymers thereof, celluloses including alkyl cellulose, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitro celluloses, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxy-propyl methyl cellulose, hydroxybutyl methyl cellulose, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, carboxylethyl cellulose, cellulose triacetate, and cellulose sulphate sodium salt, polypropylene, polyethylenes including poly(ethylene glycol), poly(ethylene oxide), and poly(ethylene terephthalate), and polystyrene.
The polymer can be a biodegradable polymer, including a synthetic biodegradable polymer (e.g., polymers of lactic acid and glycolic acid, polyanhydrides, poly(ortho)esters, polyurethanes, poly(butic acid), poly(valeric acid), and poly(lactide-cocaprolactone)), and a natural biodegradable polymer (e.g., alginate and other polysaccharides including dextran and cellulose, collagen, chemical derivatives thereof (substitutions, additions of chemical groups, for example, alkyl, alkylene, hydroxylations, oxidations, and other modifications routinely made by those skilled in the art), albumin and other hydrophilic proteins (e.g., zein and other prolamines and hydrophobic proteins)), as well as any copolymer or mixture thereof. In general, these materials degrade either by enzymatic hydrolysis or exposure to water in vivo, by surface or bulk erosion.
The polymer can be a bioadhesive polymer, such as a bioerodible hydrogel described by H. S. Sawhney, C. P. Pathak and J. A. Hubbell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated herein, polyhyaluronic acids, casein, gelatin, glutin, polyanhydrides, polyacrylic acid, alginate, chitosan, poly(methyl methacrylates), poly(ethyl methacrylates), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate).
In a preferred embodiment, the polymer is a water-soluble polymer. Suitable water-soluble polymers are known in the art and include, for example, polyvinylpyrrolidone, hydroxypropyl cellulose (HPC; Klucel), hydroxypropyl methylcellulose (HPMC; Methocel), nitrocellulose, hydroxypropyl ethylcellulose, hydroxypropyl butylcellulose, hydroxypropyl pentylcellulose, methyl cellulose, ethylcellulose (Ethocel), hydroxyethyl cellulose, various alkyl celluloses and hydroxyalkyl celluloses, various cellulose ethers, cellulose acetate, carboxymethyl cellulose, sodium carboxymethyl cellulose, calcium carboxymethyl cellulose, vinyl acetate/crotonic acid copolymers, poly-hydroxyalkyl methacrylate, hydroxymethyl methacrylate, methacrylic acid copolymers, polymethacrylic acid, polymethylmethacrylate, maleic anhydride/methyl vinyl ether copolymers, poly vinyl alcohol, sodium and calcium polyacrylic acid, polyacrylic acid, acidic carboxy polymers, carboxypolymethylene, carboxyvinyl polymers, polyoxyethylene polyoxypropylene copolymer, polymethylvinylether co-maleic anhydride, carboxymethylamide, potassium methacrylate divinylbenzene co-polymer, polyoxyethyleneglycols, polyethylene oxide, and derivatives, salts, and combinations thereof.
Fusion and Chimeric Proteins
In one aspect of the invention, the FOXP3 protein (including variants and fragments) is part of a fusion protein or chimeric protein comprising two or more polypeptides fused or joined together, at least one of which is a FOXP3 protein (polypeptide). The other polypeptide of the FOXP3 fusion protein can be a second FOXP3 protein or a polypeptide other than a FOXP3 protein (e.g., a non-FOXP3 polypeptide) which can encode any peptidic or proteinaceous molecule, or a portion thereof, other than a FOXP3 protein (or variant or fragment thereof). The other polypeptide can exist as a polypeptide separate from the FOXP3 protein, or can exist as a polypeptide, which is expressed in frame (in tandem) with the FOXP3 protein. The other polypeptide can be, for example, an immunoglobulin, CD3, CD4, CD8, an MHC molecule, or a portion of any of the foregoing, etc. For purposes herein, examples of an immunoglobulin portion include a heavy chain, a light chain, a variable or constant region of a heavy or light chain, a single chain variable fragment (scFv), or an Fc, Fab, or F(ab)2′ fragment of an antibody, etc.
In a specific aspect, the FOXP3 fusion protein or chimeric protein comprises one or more linkers which join the two or more polypeptides together. The linker can be, for instance, a peptide (e.g., a FMDV 2A peptide (see Felipe, Genetic Vaccines and Therapy 2: 13-e-publication Sep. 13, 2004)) which joins together two polypeptides.
The fusion protein or chimeric protein can comprise one or more copies of the polypeptide(s) (e.g., FOXP3 protein or non-FOXP3 polypeptide) of the fusion protein. For instance, the fusion protein can comprise 1, 2, 3, 4, 5, or more, copies of a FOXP3 protein and/or of the other polypeptide. Suitable methods of making fusion proteins are known in the art, and include, for example, recombinant methods. See, for instance, Choi et al., Mol. Biotechnol., 31, 193-202 (2005).
Methods of making FOXP3 Proteins
The FOXP3 proteins (including variants and fragments) described herein can be obtained by methods known in the art. Suitable methods of de novo synthesizing polypeptides and proteins are described in, for example, Chan et al., Fmoc Solid Phase Peptide Synthesis, Oxford University Press, Oxford, United Kingdom, 2005; Peptide and Protein Drug Analysis, ed. Reid, R., Marcel Dekker, Inc., 2000; Epitope Mapping, ed. Westwood et al., Oxford University Press, Oxford, United Kingdom, 2000; and U.S. Pat. No. 5,449,752.
Also, the FOXP3 proteins (including variants and fragments) can be recombinantly produced using the nucleic acids described herein using standard recombinant methods. See, for instance, Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 2001; and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, NY, 1994.
Further, the FOXP3 proteins (including variants and fragments) can be isolated and/or purified, in part, from a source, such as a plant, a bacterium, an insect, a mammal, e.g., a rat, a human, etc. Methods of isolation and purification are well-known in the art.
Alternatively, the FOXP3 proteins (including variants and fragments) can be commercially synthesized by companies, such as Synpep (Dublin, Calif.), Peptide Technologies Corp. (Gaithersburg, Md.), and Multiple Peptide Systems (San Diego, Calif.). In this respect, the FOXP3 proteins (including variants and fragments) can be synthetic, recombinant, isolated, and/or purified.
Isolated or Purified
As used herein, the term “isolated” means having been removed from its natural environment. The term “purified” as used herein means having been increased in purity, wherein “purity” is a relative term, and not to be necessarily construed as absolute purity. For example, the purity can be at least about 50%, can be greater than 60%, 70%, 75, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or can be nearly 100%.
FOXP3 Nucleic Acid
In another embodiment of the method of treating a cancer, the method comprises administering to the subject a nucleic acid comprising a protein coding sequence encoding a FOXP3 protein and a promoter sequence active in a cancer cell of the subject, wherein the promoter is operably linked to the protein coding sequence, in an amount effective to treat cancer.
As used herein “nucleic acid comprising a protein coding sequence encoding a FOXP3 protein” refers to a nucleic acid comprising a nucleotide sequence encoding any of the FOXP3 proteins described herein (including variants, fragments, fusion proteins, and chimeric proteins thereof). By “nucleic acid” as used herein includes “polynucleotide,” “oligonucleotide,” and “nucleic acid molecule,” and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered inter-nucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide.
In one aspect, the nucleic acid comprising a protein coding sequence encoding a FOXP3 protein comprises a nucleotide sequence encoding a FOXP3 protein comprising the amino acid sequence of any of SEQ ID NOs: 20 to 36. In a specific aspect, the nucleic acid comprises, consists essentially of, or consists of the nucleotide sequence of any of SEQ ID NOs: I to 19, or a degenerate thereof. The nucleic acid comprising a protein coding sequence encoding a FOXP3 protein can be a FOXP3 gene or a FOXP3 locus, as described herein. Alternatively, the nucleic acid can be an mRNA or a cDNA encoding a FOXP3 protein.
FOXP3 Gene
In one aspect, the nucleic acid comprising a protein coding sequence encoding a FOXP3 protein is a FOXP3 gene. “FOXP3 gene” as used herein refers to a region of DNA that encodes a FOXP3 protein including coding and non-coding, regulatory sequences, and introns. In a specific aspect, the FOXP3 gene is the FOXP3 gene of GenBank Accession No: NC—000023.9, and fragments, and variants thereof encoding a FOXP3 protein.
FOXP3 Locus
As used herein, the term “FOXP3 locus” means the region of the chromosome of a species comprising a FOXP3 gene. In humans, it is recognized in the art that the FOXP3 locus is located on the p11.23 region of Chromosome X.
Variant Nucleic Acid
In one aspect, the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, in another aspect, the nucleic acid comprises one or more insertions, deletions, inversions, and/or substitutions. For example, the nucleic acid can comprise a nucleotide sequence of SEQ ID NO: 1 which is codon-optimized for enhanced expression. In this regard, the nucleic acid comprising a protein coding sequence encoding a FOXP3 protein can comprise a nucleotide sequence which is substantially identical to any of the nucleic acids referred to herein.
Variant Gene
The term “variant” as used herein with reference to a gene includes naturally-occurring polynucleotides encoding an amino acid sequence that differs from a previously identified FOXP3 protein which maintains FOXP3 activity, as well as synthetic polynucleotides (e.g., nucleic acids) in which one or more nucleotide changes have been introduced into a naturally-occurring polynucleotide sequence. The naturally-occurring variant FOXP3 gene can be an allele, a polymorphic gene, a gene encoding an isoform, an alternatively spliced variant, an ortholog, a paralog, a homolog, and the like. Synthetic variants encompass, for example, a codon-optimized nucleic acid. The variant gene can be, for example, a nucleic acid comprising a nucleotide sequence encoding any of the variant FOXP3 proteins as described herein (e.g., SEQ ID NOs: 20-36). In one aspect, the variant gene encodes a variant FOXP3 protein comprising the amino acid sequence of a human FOXP3 protein (SEQ ID NO: 20) with one or more amino acid modifications at any of the following positions of SEQ ID NO: 20: 7, 10, 15, 17, 22, 23, 27-29, 32, 34, 35, 38-41, 43, 44, 52, 54, 56, 60, 64, 71, 74, 84, 89, 103, 111, 114, 121, 124, 125, 132, 135, 136, 140, 158, 165, 173-176, 182, 184-186, 189, 192, 209, 213, 229, 238, 243, 247, 254, 266, 267, 270, 272, 275, 278, 285-292, 296, 297, 299, 304, 305, 321, 326, 334, 336, 356, 373, 404, 411, 422, 423, 428, 430, and 431.
In one aspect, the nucleic acid comprising a protein coding sequence encoding a FOXP3 protein is recombinant. As used herein, the term “recombinant” refers to (i) a molecule that is constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) a molecule that results from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication.
The nucleic acid comprising a protein coding sequence encoding a FOXP3 protein also comprises a promoter sequence. The promoter sequence, in one aspect, is active in a cell of the subject to which it is administered or active in the cell with which is contacted. By “active” as used herein in context of a promoter sequence is meant that the transcriptional and/or translational molecular machinery (e.g., transcriptional and/or translational regulatory proteins (e.g., transcription factors, enhancer proteins, repressor proteins, and the like)), which are native to the cell, recognizes and binds to the promoter sequence, such that transcription and/or translation of the nucleic acid occurs in the cell.
The promoter sequence of the nucleic acid is operably linked to the protein coding sequence encoding the FOXP3 protein, such that the transcription and/or translation of the protein coding sequence occurs in a manner which is dependent on activity (e.g., transcription factor binding activity) which occurs at or within the promoter sequence.
The nucleic acids can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al., supra, and Ausubel et al., supra. For example, a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides). Examples of modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chIorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridme, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N-substituted adenine, 7-methylguanine, 5-methylammomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouratil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. Alternatively, one or more of the nucleic acids of the invention can be purchased from companies, such as Macromolecular Resources (Fort Collins, Colo.) and Synthegen (Houston, Tex.).
Recombinant Expression Vector
In one aspect of the invention, the nucleic acids are administered to the subject as part of a recombinant expression vector. For purposes herein, the term “recombinant expression vector” means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell. The vectors are not naturally-occurring as a whole. However, parts of the vectors can be naturally-occurring. The recombinant expression vectors can comprise any type of nucleotides, including, but not limited to DNA and RNA, which can be single- stranded or double-stranded, synthesized or obtained in part from natural sources, and which can contain natural, non-natural or altered nucleotides. The recombinant expression vectors can comprise naturally-occurring or non-naturally-occuring internucleotide linkages, or both types of linkages. In one aspect, the altered nucleotides or non-naturally occurring internucleotide linkages do not hinder the transcription or replication of the vector.
The recombinant expression vector can be any suitable recombinant expression vector, and can be used to transform or transfect any suitable host. Suitable vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses. The vector can be selected from the group consisting of the pUC series (Fermentas Life Sciences), the pBluescript series (Stratagene, LaJolla, Calif.), the pET series (Novagen, Madison, Wis.), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, Calif.). Bacteriophage vectors, such as λGTIO, λGTI 1, λZapII (Stratagene), λEMBL4, and λNMI 149, also can be used. Examples of plant expression vectors include pBIO1, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-CI, pMAM and pMAMneo (Clontech). In one aspect, the recombinant expression vector is a viral vector, e.g., a retroviral vector.
The recombinant expression vectors can be prepared using standard recombinant DNA techniques described in, for example, Sambrook et al., supra, and Ausubel et al., supra. Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from CoIEl, 2μ plasmid, λ, SV40, bovine papilloma virus, and the like.
In one embodiment, the recombinant expression vector comprises one or more regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA-based.
The recombinant expression vector can include one or more marker genes, which allow for selection of transformed or transfected hosts. Marker genes include biocide resistance, e.g., resistance to antibiotics, heavy metals, etc., complementation in an auxotrophic host to provide prototrophy, and the like. Suitable marker genes for the inventive expression vectors include, for instance, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, and ampicillin resistance genes.
In one aspect, the recombinant expression vector comprises a native or non-native promoter sequence operably linked to the protein coding sequence encoding a FOXP3 protein (including variants and fragments thereof), which promoter sequence is active in the cell of the subject to which the nucleic acid is administered. The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental- specific, is within the ordinary skill of the artisan. Similarly, the combining of a nucleotide sequence with a promoter is also within the skill of the artisan. The promoter can be a non-viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, and a promoter found in the long-terminal repeat of the murine stem cell virus.
The recombinant expression vectors can be designed for either transient expression, for stable expression, or for both. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression. Further, the recombinant expression vectors can be made to include a suicide gene.
As used herein, the term “suicide gene” refers to a gene that causes the cell expressing the suicide gene to die. The suicide gene can be a gene that confers sensitivity to an agent, e.g., a drug, upon the cell in which the gene is expressed, and causes the cell to die when the cell is contacted with or exposed to the agent. Suicide genes are known in the art (see, for example, Suicide Gene Therapy: Methods and Reviews. Springer, Caroline J. (Cancer Research UK Centre for Cancer Therapeutics at the Institute of Cancer Research, Sutton, Surrey, UK), Humana Press, 2004) and include, for example, the Herpes Simplex Virus (HSV) thymidine kinase (TK) gene, cytosine daminase, purine nucleoside phosphorylase, and nitroreductase.
Host Cells
In one embodiment of the invention, the nucleic acid is administered to the subject as part of a recombinant expression vector within a host cell, such that the method comprises administering a host cell. As used herein, the term “host cell” refers to any type of cell that can contain the recombinant expression vector. The host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa. The host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human. The host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension. Suitable host cells are known in the art and include, for instance, DH5α E. coli cells, Chinese hamster ovarian cells, monkey VERO cells, COS cells, HEK293 cells, and the like. For purposes of amplifying or replicating the recombinant expression vector, the host cell is preferably a prokaryotic cell, e.g., a DH5α cell. For purposes of producing a recombinant polypeptide the host cell is preferably a mammalian cell. In one aspect, the host cell is a human cell. The host cell can be of any cell type, can originate from any type of tissue, and can be of any developmental stage.
In one aspect, the host cell can be part of a population of cells. The population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell, e.g., a host cell (e.g., a T cell), which does not comprise any of the recombinant expression vectors. Alternatively, the population of cells can be a substantially homogeneous population, in which the population comprises mainly of host cells (e.g., consisting essentially of) comprising the recombinant expression vector. The population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising a recombinant expression vector, such that all cells of the population comprise the recombinant expression vector. In one embodiment of the invention, the population of cells is a clonal population comprising host cells comprising a recombinant expression vector as described herein.
For purposes of the methods of treating cancer, wherein host cells or populations of cells are administered to the subject, the cells can be cells that are allogeneic or autologous to the subject. In a specific aspect, the cells are autologous to the subject.
Inducing Compounds
In another aspect of the method of treating cancer in a subject provided herein, the method comprises administering to a subject an inducing compound that induces expression of FOXP3 protein in an amount effective to treat cancer. Inducing compounds that induce expression of FOXP3 include, for example, transcription factors (e.g., which promote the expression of a FOXP3-encoding nucleic acid), upstream regulators of transcription factors that induce FOXP3 expression, inhibiting compounds that inhibit negative regulator(s) of FOXP3 expression, and the like.
In one aspect, the inducing compound is a transcription factor which promotes the expression of a FOXP3 nucleic acid, or a nucleic acid comprising a protein coding sequence encoding the transcription factor. The transcription factor in one instance is a transcription factor which binds to the promoter sequence of a native or naturally-occurring FOXP3 gene. In a specific instance, the transcription factor is c-Jun (e.g., Entrez Gene ID No; 3725) or ATF2 (e.g., Entrez Gene ID No. 1386), or a combination thereof. In another instance, the transcription factor is one which does not bind to the promoter sequence of a native or naturally-occurring FOXP3 gene, but binds to a promoter sequence of an engineered nucleic acid comprising a FOXP3 protein coding sequence. For example, in the instance that the engineered nucleic acid comprises a promoter sequence which comprises bindings sites for a transcription factor other than c-Jun and ATF2 (e.g., NFKB), then the inducing compound in this instance is the other transcription factor (e.g., NFKB).
With regard to the invention, “upstream regulators of regulators of transcription factors that induce FOXP3 expression” includes any compound or molecule that promotes the activation of the transcription factors that induce FOXP3 expression. In one aspect, the upstream regulator is a compound or molecule that causes the activiation the c-Jun and ATF2 transcription factors. In a specific aspect, the upstream regulator is JNK, which activates c-Jun by phosphoylating this transcription factor. In another specific aspect, the upstream regulator is a kinase which phosphorylates ATF2, which promotes the transcriptional activity of ATF2.
The inducing compound in one aspect is an inhibiting compound that inhibits negative regulator(s) of FOXP3 expression. By “compound that inhibits negative regulator of FOXP3 expression” as used herein is meant any compound or molecule that acts against or inhibits a compound or molecule that causes repression of FOXP3 expression.
In various aspects, the inducing compound activates JNK (e.g., JNK1), P38 and/or ATF2. In a specific aspect, the compound is emetine (CAS 483-18-1) and/or anisomycin (CAS 22862-76-6). Emetine is a drug produced from the ipecac root and is used as an anti-protozoal agent and vomiting-inducing agent. It is known to inhibit the nonsense mediated decay pathway and to induce stress response. Anisomycin is a bacterial antibiotic isolated from Streptomyces griseolus, which inhibits protein synthesis, by binding to 60S ribosomal subunits and blocking peptide bond formation, thereby preventing elongation and causing polysome stabilization. Emetine and anisomycin are commercially available products from, e.g., Sigma-Aldrich (St. Louis, Mo.).
In other aspects, the inducing compound is a methyltransferase inhibitor. The methyltransferase inhibitor can be, for example, 5-aza-2′deoxycytidine, zebularine, AMI-1, which are commercially available from, e.g., Calbiochem (Gibbstown, N.J.). In a specific aspect, the methyltransferase inhibitor is 5-aza-2′deoxycytidine.
Routes of Administration
With regard to the methods of treating cancer provided herein, any method useful in delivery of a protein or a nucleic acid known in the art are contemplated. Formulations appropriate for administering a FOXP3 protein or nucleic acid encoding a FOXP3 protein are understood in the art to depend on route of administration, and can include, for example, U.S. Pat. No. 7,208,577, the disclosure of which is incorporated herein by reference in its entirety. Also, any of the routes and formulations further mentioned herein are contemplated.
Also contemplated with regard to the administration of an inducing compound that induces expression of a FOXP3 protein is any method of administration described herein, in any of the variations associated with route of administration, combination therapy, and dosage frequency.
As further discussed herein, dosage frequency is dependent on route of administration and state of the recipient subject and is generally determined by an attending physician,. The therapeutic protein, nucleic acid, or inducing compound, whether administered alone or in combination with one or more other anti-cancer therapeutics, is administered according to the need and condition of the subject and determination of an appropriate dosage regimen is well within the skill of the attending physician.
Pharmaceutical Compositions
In one aspect of the treatment methods described herein, the FOXP3 protein (including variants, fragments, fusion proteins, chimeric proteins, and conjugates thereof), the nucleic acid comprising a protein coding sequence encoding a FOXP3 protein, recombinant expression vector comprising the FOXP3 nucleic acid, the host cell comprising the recombinant expression vector, the population of cells comprising a host cell, or inducing compound (hereinafter collectively referred to as a FOXP3 material) is formulated into a composition, such as a pharmaceutical composition. The pharmaceutical composition comprising the FOXP3 material additionally comprises a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier can be any of those conventionally used and is limited only by chemico-physical considerations, such as solubility and lack of reactivity with the active compound(s), and by the route of administration. The pharmaceutically acceptable carriers described herein, for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public. It is preferred that the pharmaceutically acceptable carrier be one which is chemically inert to the active agent(s) and one which has no detrimental side effects or toxicity under the conditions of use.
The choice of carrier will be determined in part by the particular FOXP3 material, as well as by the particular method used to administer the FOXP3 material. Accordingly, there are a variety of suitable formulations of the pharmaceutical composition of the invention. The following formulations for oral, aerosol, parenteral, subcutaneous, intravenous, intramuscular, intraarterial, intrathecal, interperitoneal, rectal, and vaginal administration are exemplary and are in no way limiting. More than one route can be used to administer the FOXP3 materials, and in certain instances, a particular route can provide a more immediate and more effective response than another route.
Topical formulations are well-known to those of skill in the art. Such formulations are particularly suitable in the context of the invention for application to the skin. The topical formulation can be a cream, ointment, patch, solution, aerosol spray, paste, film, and the like.
Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the FOXP3 material dissolved in diluents, such as water, saline, or juice; (b) capsules, sachets, tablets, lozenges, and troches, each containing a predetermined amount of the active ingredient, as solids or granules; (c) powders; (d) suspensions in an appropriate liquid; and (e) suitable emulsions. Liquid formulations may include diluents, such as water and alcohols, for example, ethanol, benzyl alcohol, and the polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant. Capsule forms can be of the ordinary hard- or soft-shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and corn starch. Tablet forms can include one or more of lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, disintegrating agents, moistening agents, preservatives, flavoring agents, and other pharmacologically compatible excipients. Lozenge forms can comprise the FOXP3 material in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the FOXP3 material in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to, such excipients as are known in the art.
The FOXP3 material, alone or in combination with other suitable components, can be made into aerosol formulations to be administered via inhalation. These aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. They also may be formulated as pharmaceuticals for non-pressured preparations, such as in a nebulizer or an atomizer. Such spray formulations also may be used to spray mucosa.
Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The FOXP3 material can be administered in a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol or hexadecyl alcohol, a glycol, such as propylene glycol or polyethylene glycol, dimethylsulfoxide, glycerol, ketals such as 2,2- dimethyl-I53-dioxolane-4-methanol, ethers, poly(ethyleneglycol) 400, oils, fatty acids, fatty acid esters or glycerides, or acetylated fatty acid glycerides with or without the addition of a pharmaceutically acceptable surfactant, such as a soap or a detergent, suspending agent, such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adjuvants.
Oils, which can be used in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts, and suitable detergents include (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-β-aminopropionates, and 2-alkyl -imidazoline quaternary ammonium salts, and (e) mixtures thereof.
The parenteral formulations will typically contain from about 0.5% to about 25% by weight of the FOXP3 material in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol. The parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
Injectable formulations are in accordance with the invention. The requirements for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J. B. Lippincott Company, Philadelphia, Pa., Banker and Chalmers, eds., pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Toissel, 4th ed., pages 622-630 (1986)). Preferably, when administering cells, the cells are administered via injection, e.g., intravenous injection.
Additionally, the FOXP3 materials, or compositions comprising such FOXP3 materials, can be made into suppositories by mixing with a variety of bases, such as emulsifying bases or water-soluble bases. Formulations suitable for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulas containing, in addition to the active ingredient, such carriers as are known in the art to be appropriate.
It will be appreciated by one of skill in the art that, in addition to the above-described pharmaceutical compositions, the FOXP3 materials described herein can be formulated as inclusion complexes, such as cyclodextrin inclusion complexes, or liposomes.
Combinations
The pharmaceutical composition can contain any of the FOXP3 materials described herein and can comprise more than one type of FOXP3 material, e.g., a FOXP3 protein and a nucleic acid comprising a protein coding sequence encoding a FOXP3 protein, or two or more different inducing compounds. Alternatively or additionally, the pharmaceutical composition can comprise a FOXP3 material in combination with another pharmaceutically active agent or drug, such as a chemotherapeutic agent (e.g., a chemotherapeutic agent listed in Table 1, asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc.), a growth factor, cytokine, hematopoietic factor, lymphokine, and chemokine.
The growth factor can include cytokines, lymphokines, growth factors, or other hematopoietic factors such as M-CSF, GM-CSF, TNF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, TNF0, TNF1, TNF2, G-CSF, Meg-CSF, GM-CSF, thrombopoietin, stem cell factor, and erythropoietin. Other are compositions can include known angiopoietins, for example Ang-1, -2,-4,-Y, and/or the human Ang-like polypeptide, and/or vascular endothelial growth factor (VEGF). Growth factors include angiogenin, bone morphogenic protein-1, bone morphogenic protein-2, bone morphogenic protein-3, bone morphogenic protein-4, bone morphogenic protein-5, bone morphogenic protein-6, bone morphogenic protein-7, bone morphogenic protein-8, bone morphogenic protein-9, bone morphogenic protein-10, bone morphogenic protein-11, bone morphogenic protein-12, bone morphogenic protein-13, bone morphogenic protein-14, bone morphogenic protein-15, bone morphogenic protein receptor IA, bone morphogenic protein receptor IB, brain derived neurotrophic factor, ciliary neutrophic factor, ciliary neutrophic factor receptor, cytokine-induced neutrophil chemotactic factor 1, cytokine-induced neutrophil, chemotactic factor 2, cytokine-induced neutrophil chemotactic factor 2, endothelial cell growth factor, endothelin 1, epidermal growth factor, epithelial-derived neutrophil attractant, fibroblast growth factor 4, fibroblast growth factor 5, fibroblast growth factor 6, fibroblast growth factor 7, fibroblast growth factor 8, fibroblast growth factor 8b, fibroblast growth factor 8c, fibroblast growth factor 9, fibroblast growth factor 10, fibroblast growth factor acidic, fibroblast growth factor basic, glial cell line-derived neutrophic factor receptor-1, glial cell line-derived neutrophic factor receptor-2, growth related protein, growth related protein-1, growth related protein-2, growth related protein-3, heparin binding epidermal growth factor, hepatocyte growth factor, hepatocyte growth factor receptor, insulin-like growth factor I, insulin-like growth factor receptor, insulin-like growth factor II, insulin-like growth factor binding protein, keratinocyte growth factor, leukemia inhibitory factor, leukemia inhibitory factor receptor-1, nerve growth factor nerve growth factor receptor, neurotrophin-3, neurotrophin-4, placenta growth factor, placenta growth factor 2, platelet-derived endothelial cell growth factor, platelet derived growth factor, platelet derived growth factor A chain, platelet derived growth factor AA, platelet derived growth factor AB, platelet derived growth factor B chain, platelet derived growth factor BB, platelet derived growth factor receptor-l, platelet derived growth factor receptor-2, pre-B cell growth stimulating factor, stem cell factor, stem cell factor receptor, transforming growth factor-1, transforming growth factor-2, transforming growth factor-1, transforming growth factor-1.2, transforming growth factor-2, transforming growth factor-3, transforming growth factor-5, latent transforming growth factor-1, transforming growth factor-I binding protein I, transforming growth factor-1 binding protein II, transforming growth factor-I binding protein III, tumor necrosis factor receptor type I (TNF-R1), tumor necrosis factor receptor type II (TNF-R2), urokinase-type plasminogen activator receptor, vascular endothelial growth factor, and chimeric proteins and biologically or immunologically active fragments thereof.
When administered in combination, the two or more FOXP3 materials and/or other pharmaceutically active agent can be co-administered. Alternatively, the two or more FOXP3 materials and/or other pharmaceutically active agent can be administered successively.
Dose
For purposes of the invention, the amount or dose of the FOXP3 material administered should be sufficient to effect, e.g., a therapeutic response, in the subject or animal over a reasonable time frame. For example, the dose of the FOXP3 material should be sufficient to inhibit tumor or cancer cell growth, inhibit expression of an oncogene, induce expression of a tumor suppressor gene, induce apoptosis of a cancer cell or tumor cell, or treat cancer in a period of from about 1 to 4 weeks or longer, e.g., 5 to 20 or more weeks, from the time of administration. In certain embodiments, the time period could be even longer. The dose will be determined by the efficacy of the particular FOXP3 material and the condition of the animal (e.g., human), as well as the body weight of the animal (e.g., human) to be treated.
Many assays for determining an administered dose are known in the art. For purposes of the invention, an assay, which comprises comparing the extent to which oncogene expression and/or tumor or cancer cell growth is inhibited in a mammal upon administration of a given dose of a FOXP3 pharmaceutical composition to the mammal among a set of mammals of which is each given a different dose of the pharmaceutical composition, could be used to determine a starting dose to be administered to a mammal. The extent to which oncogene expression, tumor or cancer cell growth, or both is inhibited can be assayed by methods known in the art, including, for instance, the methods described in Zuo et al., Cell 129: 1275-1286 (2007); Hammelmann et al., Am. J. Respiratory & Critical Care Med. 156: 766-775 (1997); Chen and Schuster, Mol. Pharmaceutics 3: 488-495 (2006); and Kim et al., Am. J. PhysioL Lung Cell Mol. Physiol. 284: L503-:509 (2004).
The dose of the FOXP3 material also will be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular FOXP3 material. Typically, the attending physician will decide the dosage of the FOXP3 material with which to treat each individual patient, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, FOXP3 material to be administered, route of administration, and the severity of the condition being treated. By way of example and not intending to limit the invention, the dose of the FOXP3 material can be about 0.0001 to about 1 g/kg body weight of the subject being treated/day, from about 0.0001 to about 0.001 g/kg body weight/day, or about 0.01 mg to about 1 g/kg body weight/day.
Targeted Forms
One of ordinary skill in the art will readily appreciate that the FOXP3 materials described herein can be modified in any number of ways, such that the therapeutic efficacy of the FOXP3 materials is increased through the modification. For instance, the FOXP3 materials can be conjugated either directly or indirectly through a linker to a targeting moiety. The practice of conjugating compounds, e.g., FOXP3 materials, to targeting moieties is known in the art. See, for instance, Wadhwa et al., J Drug Targeting, 3, 111-127 (1995) and U.S. Pat. No. 5,087,616. The term “targeting moiety” as used herein, refers to any molecule or agent that aids in localizing an agent to the appropriate sub-cellular location, cell, tissue, organ of a subject. Targeting moieties include, but are not limited to, antibodies, or fragments thereof, peptides, hormones, growth factors, cytokines, and any other natural or non-natural ligands, which bind to cell surface receptors (e.g., Epithelial Growth Factor Receptor (EGFR), T-cell receptor (TCR), B-cell receptor (BCR), CD28, Platelet-derived Growth Factor Receptor (PDGF), nicotinic acetylcholine receptor (nAChR), etc.). The term “linker” as used in context of a targeting moiety, refers to any agent or molecule that bridges the FOXP3 material to the targeting moiety. One of ordinary skill in the art recognizes that sites on the FOXP3 material, which are not necessary for the function of the FOXP3 material, are ideal sites for attaching a linker and/or a targeting moiety, provided that the linker and/or targeting moiety, once attached to the FOXP3 material, do(es) not interfere with the function of the FOXP3 material.
In one instance, the targeted form of the FOXP3 material can comprise a TAT peptide. The use of a TAT peptide as a targeting moiety is known in the art. See, for example, Becker Hapak et al., Methods 24(3):247-256 (2001); and Wadia and Dowdy, Adv Drug Deliv Rev. 57(4):579-596 (2005).
Depot
Alternatively, the FOXP3 material can be modified into a depot form, such that the manner in which the FOXP3 material is released into the body to which it is administered is controlled with respect to time and location within the body (see, for example, U.S. Pat. No. 4,450,150). Depot forms of FOXP3 materials can be, for example, an implantable composition comprising the FOXP3 material and a porous or non-porous material, such as a polymer, wherein the FOXP3 material is encapsulated by or diffused throughout the material and/or degradation of the non-porous material. The depot is then implanted into the desired location within the body and the FOXP3 material are released from the implant at a predetermined rate.
Subjects
The subject referred to herein can be any subject. In one embodiment, the subject is a mammal. As used herein, the term “mammal” refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits. In a specific aspect, the mammals are from the order Carnivora, including Felines (cats) and Canines (dogs). In another specific aspect, the mammals are from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). In yet another specific aspect, the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). In one aspect, the mammal is a human.
Types of Cancer
Methods described herein are applicable to any or all forms of cancer in which FOXP3 tumor suppression activity regulates neoplastic transformation. The cancer can be any cancer, including any of acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bone cancer, brain cancer, breast cancer, cancer of the anus, anal canal, or anorectum, cancer of the eye, cancer of the intrahepatic bile duct, cancer of the joints, cancer of the neck, gallbladder, or pleura, cancer of the nose, nasal cavity, or middle ear, cancer of the oral cavity, cancer of the vulva, chronic lymphocytic leukemia, chronic myeloid cancer, colon cancer, esophageal cancer, cervical cancer, gastrointestinal carcinoid tumor. Hodgkin lymphoma, hypopharynx cancer, kidney cancer, larynx cancer, liver cancer, lung cancer, malignant mesothelioma, melanoma, multiple myeloma, nasopharynx cancer, non-Hodgkin lymphoma, ovarian cancer, pancreatic cancer, peritoneum, omentum, and mesentery cancer, pharynx cancer, prostate cancer, rectal cancer, renal cancer (e.g., renal cell carcinoma (RCC)), small intestine cancer, soft tissue cancer, stomach cancer, testicular cancer, thyroid cancer, ureter cancer, and urinary bladder cancer. In various aspects, the cancer is breast cancer, lymphoma, liver cancer, sarcoma, adenocarcinoma, prostate cancer, thymic epithelial cancer, lung cancer, and/or pancreatic cancer.
The term “treat” as well as words stemming therefrom, as used herein, does not necessarily imply 100% or complete treatment. Rather, there are varying degrees of treatment of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the methods of treating cancer can provide any amount or any level of treatment of cancer in a mammal. Furthermore, the treatment provided by the method can include treatment of one or more conditions or symptoms of the disease being treated. For instance, the treatment can include one or more of reduction of tumor growth, reduction in metastasis, increase in survival, increase in apoptosis of cancer or tumor cells, increase in the killing of cancer or tumor cells.
The invention also provides a method for altering the phenotype of a cancer cell or tumor cell. In one aspect, the method comprises contacting the cell with a FOXP3 protein in an amount effective to alter the phenotype of the cell.
In another aspect, the method comprises contacting the cell with a nucleic acid comprising a protein coding sequence encoding a FOXP3 protein and a promoter sequence active in the cell, wherein the promoter sequence is operably linked to the protein coding sequence, in an amount effective to alter the phenotype of the cell.
In yet another aspect, the method comprises contacting the cell with an inducing compound that induces the expression of a FOXP3 protein in an amount effective to alter the phenotype of the cell.
Phenotypes
Gene Expression
The phenotype that is altered by the method can be any phenotype (e.g., any observable and/or measurable character of a cell) which is effected or caused by the expression of a FOXP3 protein. In one aspect, the phenotype is the expression level of a gene or gene product thereof. In a specific aspect, the gene is an oncogene, such as, for example, ErbB2, Skp2, or Myc, and the expression level of the oncogene is reduced upon contacting the cell with the FOXP3 protein, nucleic acid, or inducing compound. In another specific aspect, the gene is a tumor suppressor gene, e.g., p21, and the expression level of the tumor suppressor gene is increased upon contacting the cell with the FOXP3 protein, nucleic acid, or inducing compound.
Methods of determining expression levels in a cell are well-known in the art. Suitable methods include, for example, Western blotting, radioimmunoassay, ELISAs, immunofluorescence microscopy, quantitative phosphorimaging, in the case of determining the expression level of a protein; Southern blotting, Northern blotting, and quantitative RT-PCR, in the case of determining the expression level of a nucleic acid. Such methods are taught in Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, 2001; and Zuo et al., Cell 129: 1275-1286 (2007).
Growth Inhibition
In another aspect, the phenotype is growth rate of the cell (e.g., cancer cell or tumor cell) and the growth rate is reduced upon contacting the cell with the FOXP3 protein, nucleic acid, or inducing compound. In this regard, the invention provides a method of inhibiting growth of a cancer cell or tumor cell. In one aspect, the method comprises contacting the cell with a FOXP3 protein in an amount effective to inhibit growth of the cell.
In another aspect, the method comprises contacting the cell with a nucleic acid comprising a protein coding sequence encoding a FOXP3 protein and a promoter sequence active in the cell, wherein the promoter sequence is operably linked to the protein coding sequence, in an amount effective to inhibit growth of the cell.
In yet another aspect, the method comprises contacting the cell with an inducing compound that induces the expression of a FOXP3 protein in an amount effective to growth of the cell.
Methods of determining growth inhibition are known in the art and include, for example, thymidine kinase assays, [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (MTT) assays, gel microdrop (GMD) assays, calorimetric cell growth assays, and the like. Such methods are described in, for example, Zhu and Lin, Acta Pharmacol Sin 26: 1130-1137 (2005); Akselband et al., J Microbiol Methods 62: 181-197 (2005). Alternatively, a kit for measuring cell growth, e.g., a colorimetric growth assay, is commercially available from Sigma-Aldrich (St. Louis, Mo.).
Inducing Apoptosis
In one aspect, the phenotype of the cell is altered to an apoptotic phenotype upon contacting the cell with the FOXP3 protein, nucleic acid, or inducing compound. By “apoptostic phenotype” as used herein, is meant any observable and/or measurable character of a cell undergoing apoptosis (programmed cell death). The apoptotic phenotype can be, for example, a translocation of Cytochrome C from the mitochondria to the cytosol of a cell, a change in glutathione levels in a cell, a disruption of mitochondria transmembrane potential, a change in the nitrate/nitrite concentrations, and the level of BCL2 proteins.
In this regard, the invention provides a method of inducing apoptosis of a cancer cell or tumor cell. In one aspect, the method comprises contacting the cell with a FOXP3 protein in an amount effective to induce apoptosis of the cell.
In another aspect, the method comprises contacting the cell with a nucleic acid comprising a protein coding sequence encoding a FOXP3 protein and a promoter sequence active in the cell, wherein the promoter sequence is operably linked to the protein coding sequence, in an amount effective to induce apoptosis of the cell.
In yet another aspect, the method comprises contacting the cell with an inducing compound that induces the expression of a FOXP3 protein in an amount effective to induce apoptosis of the cell.
Methods of determining whether a cell has become apoptotic are known in the art. Suitable methods include, radioactive and non-radioactive assays that measure increases in plama membrane permeability, colorimetric assays that measure the reduction in the metabolic activity of mitochondria, DNA fragmentation assays, Cytochrome C and AIF release assays, annexin V detection assays, and the like. See, for example, Wang et al., Eur J Pharmacol, e-publication on Apr.8, 2008; Bu et al., BMC Cancer 7: 208 (2007).
With regard to the methods of altering a phenotype, inhibiting growth, and inducing apoptosis described herein, the FOXP3 protein, nucleic acid comprising a protein coding sequence encoding a FOXP3 protein, and inducing compound can be any of those described herein. In carrying out the method, the cancer cell or tumor cell is contacted with the protein, nucleic acid, or inducing compound using any method that permits uptake by the cell including, but not limited to, any of the methods described herein, e.g., a method using purified and isolated protein or nucleic acid, or use of a protein or nucleic acid with an appropriate carrier. Carriers include pharmaceutical solutions, delivery vehicles such as particles, lipids, one or more fusion protein moieties, antibodies including multispecific antibodies and other carriers effective for specific deliver to a target cell.
Also, with regard to the methods described herein, the cancer cell or tumor cell can be any of those described herein. In one aspect, the cell over-expresses a HER-2/ErbB2 gene. In another aspect, the cell over-expresses a Skp2 gene. Further, the cell can be an in vitro cell or an in vivo cell. In this regard, the cell can be a cell in a subject, e.g., a human.
Diagnosis
Susceptibility to Cancer
The invention further provides methods relating to cancer diagnosis. In one aspect, methods of diagnosing susceptibility to cancer of a subject, comprising comparing the expression or structure of a FOXP3 protein or FOXP3 gene in a test tissue sample to that of a normal tissue sample, are provided herein. Aberrant expression or structure of the FOXP3 protein or FOXP3 gene in the test tissue sample compared to that of the normal tissue sample indicates susceptibility to cancer of the subject.
Onset of Cancer
In another aspect, methods of diagnosing onset of cancer in a subject, comprising comparing expression or structure of a FOXP3 protein or FOXP3 gene in a test tissue sample to expression or structure of FOXP3 protein in a normal tissue sample, are provided. Aberrant expression or structure of a FOXP3 protein or FOXP3 gene in a test tissue sample compared to the expression or structure of a FOXP3 protein or FOXP3 gene in a normal tissue sample indicates onset of cancer in the subject.
Monitoring Progression
In yet another aspect, methods of monitoring the progression of cancer in a subject, comprising comparing the expression or structure of a FOXP3 protein or FOXP3 gene in a test tissue sample to expression or structure of FOXP3 protein in a prior tissue sample, are provided. Aberrant expression or structure of a FOXP3 protein or FOXP3 gene in the test tissue sample compared to the expression or structure of a FOXP3 protein or FOXP3 gene in a prior tissue sample indicates progression of cancer in the subject.
As used herein “aberrant structure” of a FOXP3 protein or a FOXP3 gene refers to a measurable or observable change in the structure of the protein or gene, which is associated with cancer, e.g., with susceptibility, onset, or progression of cancer. In one instance, the aberrant structure of a FOXP3 protein or a FOXP3 gene is a protein mutation or gene mutation that gives rise to a change in FOXP3 biological activity compared to biological activity of a FOXP3 protein of a FOXP3 gene that does not have an identified mutation. In one instance, the aberrant structure of the FOXP3 protein comprises an amino acid modification. The amino acid modification can be a substitution, insertion, or deletion of an amino acid of the wild-type, native FOXP3 amino acid sequence. The amino acid modification can occur in any part of the amino acid sequence of FOXP3. For example, the amino acid modification can occur in any of the exons of the FOXP3 protein (e.g., Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, Exon 7, Exon 8, Exon 9, Exon 10, Exon 11, Exon 12) or functional domains of the FOXP3 protein (e.g., repressor domain, zinc finger domain, leucine zipper domain, forkhead domain). In one instance, the amino acid modification occurs or is located in a zinc finger domain of the FOXP3 protein, a forkhead domain of the FOXP3 protein, a repressor domain of the FOXP3 protein, or in a combination of two or more of the foregoing. The amino acid modification in a specific instance is an amino acid substitution of a human FOXP3 protein (SEQ ID NO: 20) selected from the group consisting of: A38S, G42R, G87D, V97A, V117M, P177S, N196I, P202L, G203R, C204R, E205K, K227R, V239I, S296T, P338L, A353T, F373S, F395L, and G403R.
The aberrant structure of a FOXP3 gene of the test tissue sample can be an insertion, deletion, or substitution of a nucleotide of the wild-type, native FOXP3 gene. In one instance, the aberrant structure of the FOXP3 gene comprises a mutation in reference to a human FOXP3 mRNA (SEQ ID NO: 1) selected from the group consisting of: G300T, G312A, T424C, G448A, T556A, G557A,C717T, C793T, A775T, G785A, C798T, G801A, G822A, A868G, G917A, G920A, G993A, T1074A, C1201T, G1245A, T1306C, T1373A, and G1395A.
In one instance, the aberrant structure of a FOXP3 protein or FOXP3 gene of the test tissue sample comprises a deletion of an entire copy of the gene or a part thereof, e.g., an exon, intron, promoter sequence, untranslated region, of the gene. In a specific instance, the aberrant struction comprises a deletion of any of Exons 3, 4, 6, 7, and 8, or any combination thereof. In another instance, the aberrant structure of the test tissue sample comprises a deletion of one or more copies of the entire FOXP3 gene. In yet another specific instance, the aberrant structure of the FOXP3 gene comprises a mutation in an intron of a FOXP3 gene, e.g., the one of GenBank Accession No. NC000023.9, such as G→A at 31 basepairs downstream from Exon 6; C→T at 51 basepairs upstream of Exon 3; G→A at 30 basepairs downstream of Exon 11, C→G at 44 basepairs downstream of Exon 11; G→A at 63 basepairs downstream of Exon 11; A→G at 50 basepairs upstream of Exon 3; and G→A at 3 basepairs downstream of Exon 6.
Furthermore, in one instance, the aberrant structure of a FOXP3 gene comprises an increase in CpG methylation of the sequence which is 5′ to the promoter of the FOXP3 gene, e.g., the gene of GenBank Accession No. NC000023.9.
As used herein “aberrant expression” of a FOXP3 protein or a FOXP3 gene refers to a measurable or observable change in the amount or concentration of the gene, or gene product thereof, which is associated with cancer, e.g., with susceptibility, onset, or progression of cancer. In one instance, aberrant expression means a level of transcription, translation, and/or post-translational modification that results in a change in FOXP3 biological activity compared to the level of activity observed in cells that are not cancer cells or cells that are not susceptible to becoming cancer cells. In a specific instance, the aberrant expression of the FOXP3 protein or FOXP3 gene is at least 2-fold less than that of the normal tissue sample or prior tissue sample. In another specific instance, the aberrant expression is a 5-fold, 10-fold, 20-fold or more reduction in expression as compared to that of the normal or prior tissue sample.
Ways to Assess Structure and Expression
Methods of assessing the structure of a protein or gene are well-known in the art and include, for example, any of the methods described herein and any sequencing or PCR-based methods described in Sambrook et al., supra. Likewise, methods of assessing the expression level of a gene are well-known in the art and include any of the methods described herein.
Tissue Samples
As used herein, “test tissue sample” refers to the sample being analyzed, assessed, compared, evaluated in the diagnostic methods described herein. As used herein, “normal tissue sample” refers to the reference sample and is a tissue sample which is known to not be diseased, e.g., cancerous or tumorous. In certain methods, the test tissue sample and the normal tissue sample can be from the same subject. In other methods, the test tissue sample and the normal tissue sample are from different subjects.
As used herein, “prior tissue sample” refers to a tissue sample that optionally is from the same tissue of the test tissue sample, but is obtained at an earlier time point than the time point at which the test tissue sample was obtained from the subject.
The test tissue sample, normal tissue sample, and prior tissue sample can comprise any type of tissue from any organ of the subject. The tissue can be tissue of a lung, heart, liver, brain, pancreas, kidney, skin (epithelium), endothelium, uterus, ovary, prostate, breast, stomach, small intestine, large intestine, lymph node, spleen, thymus, thyroid, etc.
Screening
The invention provides screening methods. In one instance, the screening method is a method for screening a test compound for anti-cancer activity. The method comprises administering to cells the test compound and measuring expression of FOXP3 protein or FOXP3 gene in the cells. Increased expression of a FOXP3 protein or FOXP3 gene in the cells is indicative of anti-cancer activity of the test compound.
The test compound can be any molecule, synthetic or naturally-occuring. In one aspect, the test compound is a peptide, protein, or a small molecule. The cells of the screening method can be any type of cells, such as any of those described herein with reference to host cells.
Additionally, methods are provided for identifying compounds that possess FOXP3 activity, wherein compounds having FOXP3 activity are identified as candidate compounds that are useful for treating or preventing cancer. In one embodiment, methods of identifying a compound having FOXP3 activity are provided comprising the step of comparing expression of a protein encoded by a protein coding region operably linked to a HER-2/ErbB2 promoter sequence that binds FOXP3 and regulates HER-2/ErbB2 protein expression in the presence of a test compound to expression of the protein encoded by the protein coding region operably linked to the HER-2/ErbB2 promoter sequence in the presence of FOXP3, where protein expression in the presence of the test compound equal to protein expression in the presence of FOXP3 indicates of the test compound has FOXP3 activity. In one aspect, the FOXP3 activity is transcriptional regulation. In another aspect, methods are provided to identify a compound having FOXP3 binding activity comprising the step of comparing binding of a test compound with a HER-2/ErbB2 promoter sequence that binds FOXP3 to binding of FOXP3 with the HER-2/ErbB2 promoter sequence, wherein comparable binding of the test compound to the promoter sequence and FOXP3 binding to the promoter sequence indicates comparable binding activity. In still another aspect, method to identify a compound having FOXP3 binding activity are provided comprising the step of measuring binding of a test compound to a HER-2/ErbB2 promoter sequence that binds FOXP3 in the presence of FOXP3, wherein binding of the test compound to the promoter sequence indicates displacement of FOXP3 binding to the promoter sequence and indicates binding strength of the test compound compared to FOXP3 binding strength. Compounds amenable to being assessed in methods to identify those with FOXP3 activity include, but are not limited to, small molecules, proteins, peptides, and the like. Test compounds include those that are commercially available or synthesized, as well as those which are individual, purified compounds or those present in libraries comprising a multiplicity of different compounds.
EXAMPLES Example 1 Spontaneous and Carcinogen-Induced Mammary Cancer in FOXP3sf/+Female MiceMutant BALB/c mice used for the initial study carried mutations in two closely linked X-chromosome genes, FOXP3sf and Otcspf. During the course of the study, a spontaneous segregation of Otcspf produced a BALB/c Otcspf/+strain. Meanwhile, an independent line of Scurfy mice was obtained, a line that had never been crossed to the Spf mutant mice and which was backcrossed with the Scurfy mutant allele (FOXP3sf) for more than 12 generations into the BALB/c background (Chang et al., J. Exp Med 202: 1141-1151 (2005)). Female mice with only one copy of the FOXP3 gene survived to adulthood and appeared normal within the first year of life (Godfrey et al., Proc Natl Acad Sci U.S.A. 88: 5528-5532 (1991)) with normal T cell function (Fontenot et al., Nat Immunol 4 330-336 (2003); Fontenot et al., Immunity 22 329-341 (2005); Godfrey et al., AM J Pathol 145: 281-286 (1994)). Extended observations of the retired breeders for up to two years revealed that close to 90% of the FOXP3sf/+ Otcspf/+ and FOXP3sf/+ mice spontaneously developed malignant tumors.
Cancer incidences in the littermate controls and a line of congenic mice with a mutation in Otc, but not FOXP3, were comparable with each other. About 60% of the tumors were mammary carcinomas, although other tumors, such as lymphoma, hepatoma, and sarcoma were observed. Histological analyses revealed lung metastasis, based on expression of ER and/or PR, in about 40% of the mice with mammary cancer. More than a third of the tumor-bearing mice had multiple lesions in the mammary glands. Most, although not all, mammary carcinomas expressed the estrogen receptor (ER+, 14/18) and progesterone receptor (PR+, 12/18).
In order to focus on mammary cancer, the mice were treated with a carcinogen, 7,12-dimethylbenz [a] anthracene (DMBA), in conjunction with progesterone. Mice heterozygous for FOXP3sf, but not those heterozygous for Otcspf, showed substantially increased susceptibility to mammary cancer, as revealed by earlier onset, increased incidence and multiplicity of the breast tumors. These data demonstrated that a mutation of FOXP3, but not Otc, results in a major increase in susceptibility to mammary carcinoma.
Since two independently maintained lines sharing the FOXP3 mutation have a comparably higher incidence of mammary cancer, the FOXP3 mutation is likely responsible for the increased rate of breast cancer.
Example 2 FOXP3 Expression in Normal and Cancerous Mammary TissuesSince expression of FOXP3 has not been reported in mammary tissue, normal and cancerous cells were isolated by laser-capture microdissection and expression of FOXP3 and Otc was compared by real-time RT-PCR and histochemistry.
Quantitative real-time PCR was carried out as follows. Relative quantities of mRNA expression were analyzed using real-time PCR (Applied Biosystems ABI Prism 7700 Sequence Detection System, Applied Biosystems). The SYBR (Qiagen) green fluorescence dye was used in this study. The primer sequences (5′-3′) are listed in Table 2 below.
The complete absence of the cd3 transcripts indicated that the micro-dissected samples were devoid of T cells, the main cell types known to express FOXP3 (Fontenot et al., Immunity 22 329-341 (2005)). FOXP3 mRNA was detected in normal mammary epithelium from both the WT and FOXP3sf/+ Otcspf/+ mice, but not in mammary cancer cells from the same FOXP3sf/+ Otcspf/+ mice. Immunohistochemical staining confirmed the loss of expression of FOXP3 in the mammary carcinoma generated from the FOXP3sf+ Otcspf/+ mice.
In view of the fact that FOXP3 is an X-linked gene that is subject to X-chromosomal inactivation (Fontenot et al., Immunity 22 329-341 (2005)), anchored RT-PCR was carried out to clone the low levels of FOXP3 mRNA in the breast tissues. The cDNA clones from pooled samples were sequenced after ruling out potential T cell contamination (based on a lack of T-cell specific cd3 transcripts). It was observed that 100% of the FOXP3 transcripts in the cancerous tissues were from the mutant alleles, which indicates that the wild-type allele was silenced in the tumor cells. In contrast, the transcripts from the mutant allele constituted 15% of the transcripts in the normal mammary samples from the same mice. Thus, the expression pattern of FOXP3 fulfills another criterion for a tumor suppressor gene.
Thus, unlike essentially all cancer suppressor genes identified to date, FOXP3 is X-linked and inactive in cells in which the WT allele was silenced by X-inactivation. This is indeed the case as the low levels of FOXP3 transcripts in the cancer cells were derived exclusively from the mutant alleles.
Example 3 FOXP3 is a Repressor of Erbb2 TranscriptionCharacterization of the mammary tumors in the mutant mice revealed wide-spread up-regulation of ErbB2, in contrast to those rare tumors from WT mice. Using real-time RT-PCR, 8-12-fold more ErbB2 mRNA was found in the cancer cells than in normal epithelium. There was also more ErbB2 mRNA in the FOXP3sf/+spf/+ epithelium than in that of the WT female mice, which indicates a potential gene dosage effect of FOXP3 on the regulation of ErbB2 expression in vivo. Transfection of the TSA cell line with FOXP3 cDNA repressed ErbB2 levels on the TSA cell line.
Analysis of the 5′ sequence of the ErbB2 gene revealed multiple binding motifs for the forkhead domain. To test whether FOXP3 interacts with the ErbB2 promoter, anti-V5 antibody was used to precipitate sonicated chromatin from the TSA cells transfected with the FOXP3-V5 cDNA and real-time PCR was used to quantitate the amounts of the specific ErbB2 promoter region precipitated by the anti-V5 antibodies in comparison to those that bound to mouse IgG control.
Chromatin immunoprecipitation (ChIP) was carried out according to published procedure (Im et al., Methods Mol Biol 284: 129-146 (2004)). Briefly, the FOXP3-V5-transfected TSA cells were sonicated and fixed with 1% paraformaldehyde. The anti-V5 antibodies or control mouse IgG were used to pull down chromatin associated with FOXP3-V5. The amounts of the specific DNA fragment were quantitated by real-time PCR and normalized against the genomic DNA preparation from the same cells.
Results showed that the anti-V5 antibodies precipitated significantly higher amounts of ErbB2 promoter DNA than the IgG control, with the highest signal around 1.6 kb 5′ of the transcription starting site.
To test whether the binding correlated with the suppression by FOXP3, luciferase reporter was produced using the 1.8, 1.2 and 0.8 Kb upstream of the ErbB2 TSS and the ability of FOXP3 to repress ErbB2 promoter activity was tested. In three separate cell lines, it was observed that the region with the strongest ChIP signal was required for optimal repression by FOXP3. Furthermore, two potential FOXP3-binding sites, identified based on (i) intensity of ChIP signal, (ii) abundance of consensus binding sites and (iii) conservation between mouse and human, were deleted using site-directed mutagenesis and the effect on FOXP3-mediated repression was measured.
Deletion of either binding site substantially increased the ErbB2 promoter activity in the presence of FOXP3 and thus alleviated FOXP3-mediated repression.
Since the region deleted in mut B is 100% conserved between mouse and man and since this deletion completely wiped out repression, an electrophoretic mobility shift assay (EMSA) was carried out as follows to determine whether the forkhead DNA-binding motifs in region B bound FOXP3. Nuclear extracts were prepared as described previously (Wang et al., Nat Med 5: 412-417 (1999)). The sequence for the WT probe (W) was AGTTCAATTTGAATTTCAGATAAACG (SEQ ID NO: 107). Mutant probe (M) (AGTTCAGCGCGAGCGCCAGAGCGCCG; SEQ ID NO: 108) with mutations of all three potential forkhead binding sites was used as specificity control.
Results showed that the nuclear extracts from the FOXP3-expressing cells specifically retarded migration of the WT but not mutant 32P-labeled probes compared with control cells. While mutant cold probes did not affect FOXP3 binding activities, WT cold probes significantly diminished them, establishing that the binding of these complexes is specific to forkhead DNA-binding motifs. Site-directed mutagenesis was therefore carried out to replace the 12 nucleotides (mut C) within the ErbB2 promoter and promoter activity and FOXP3-repression was compared by luciferase assays. While the wild-type promoter was repressed by FOXP3, no repression by FOXP3 was observed when the mutant promoter was used. Moreover, in contrast to the deletion Mut B, the mutations had no impact on the basal activity of the ErbB2 promoter. Taken together, these data make a compelling case that FOXP3 represses the ErbB2 promoter via specific forkhead binding motifs.
Example 4 FOXP3 Defects in Human Breast CancerThe levels and isoforms of the FOXP3 transcripts were analyzed in a panel of normal human mammary epithelial cells (HMEC), an immortalized but non-malignant cell line (MCF-10A), and 10 malignant breast cancer cell lines differing in ER/PR and HER-2 status. Early passage of HMEC with no methylation in the CpG island of the P16 promoter was used to avoid effects associated with P16 inactivation in post-senescence HMEC cultures (Romanov et al., 2001).
Results showed that similar levels of FOXP3 transcripts were observed in two independent isolates of HMEC and in the immortalized cell line MCF-10A. Each of the 10 tumor cell lines had a different degree of reduction in FOXP3 mRNA in comparison to HMEC and MCF-10A. Among them, two were completely devoid of FOXP3 mRNA, while the others had a 1.5-20 fold reduction. In view of this result, PCR was carried out using anchored primers spanning exons 1-12 to amplify the FOXP3 transcripts, and the PCR products were sequenced.
None of the tumor cell lines expressed full-length FOXP3 transcripts. HMEC expressed the same two isoforms as observed in the T cells, while MCF-1OA expressed an isoform lacking exon 3. The same isoform was also found in four tumor cell lines at much lower levels. In addition, three tumor cell lines expressed an isoform lacking both exons 3 and 4. The alternative splicing resulted in a frame-shift beginning at codon 70 and an early termination at codon 172. Furthermore, two tumor cell lines expressed a FOXP3 isoform lacking exons 3 and/or 8. Exon 8 encodes the leucine-zipper domain that is frequently mutated in IPEX patients (Ziegler, Annu Rev Immunol 24: 209-226 (2006)). Thus, FOXP3 is abnormal in breast cancer cell lines.
Consistent with a role for FOXP3 in repressing HER-2 expression, the majority of the breast cancer cell lines had higher levels of HER-2 in comparison to normal HMEC. However, additional changes are also likely required for HER-2 over-expression, as three cell lines did not over-express HER-2 even though the FOXP3 transcripts were greatly reduced.
Three approaches were taken to determine whether the findings in the mutant mice and human breast cancer cell lines are relevant to the pathogenesis of human breast cancer.
First, immunohistochemistry was used to determine expression of FOXP3 in normal and cancerous tissue. HER-2 expression was performed using Pathway™ HER-2 (Clone CB11) (Ventana Medical Systems, Inc., Tucson, Ariz.) on the BenchMark® XT automated system per the manufacturer's recommended protocol. The HER-2 levels were scored by commonly used criteria (Yaziji et al., JAMA 291: 1972-1977 (2004)).
Results showed that while more than 80% of the normal breast samples expressed FOXP3 in the nuclei of the epithelial cells, less than 20% of the cancerous tissue showed nuclear staining.
Second, fluorescence in situ hybridization (FISH) was used to determine whether the FOXP3 gene was deleted in the breast cancer samples. FISH for FOXP3 deletion was done using BAC clone RP11-344014 (ntLocus X: 48,817,975-48,968,223), which was verified by PCR to contain the FOXP3 gene. The minimal common region of deletion was done using flanking p-telomeric and centromeric clones, RP11-573N21 (ntLocus X: 43,910,391-44,078,600) and RP11-353K22 (ntLocus X: 54,416,890-54,545,788), respectively. Locus specific BAC clones were labeled with spectrum orange using commercially available reagents per the manufacturer's recommendations (Vysis, Downers Grove, Ill.). Chromosome X enumeration was done by FISH using a commercially available spectrum green CEPX probe (Vysis, Downers Grove, Ill.). Cutoff values for the determination of deletion of each probe were established by scoring 200 nuclei from forty 0.6 millimeter cores representing normal tissue from 10 different organs. Cutoff values were then established by calculation of the mean plus three times the standard deviation of the number of normal cells with a false-positive signal. For BAC clones RP11-344014, RP11-573N21, and RP11-353K22 these numbers were 7.1%, 8.1%, and 8.0%, respectively, meaning only cases of breast cancer with greater than this percentage of cells with one or two CEPX signals and none or a single locus specific signal, respectively, were counted as abnormal. For all FISH done in this study a total of at least 200 nuclei were scored for every case. For virtually all cases with FOXP3 deletion, the percentage of cells with a reduced number of FOXP3 greatly exceeded the cut-off value. These were thus considered clear-cut cases of gene deletion.
All FISH were done using standard protocols optimized for breast cancer specimens. Briefly, formalin fixed, paraffin-embedded tissue microarray blocks were cut into 3 to 4 μm thick sections, incubated over night at 56° C., deparaffinized, washed, digested with protease, formalin fixed, denatured, and hybridized at 37° C. for 16 hours. The slides were then washed in a post-hybridization wash, counter stained with 4′-6-diamidino-2-phenylindole (DAPI), and covered with a coverslip. Specimens were evaluated with an Olympus BX51 microscope (Olympus Optical Company, LTD., Japan) under oil immersion at ×150 magnification using the recommended filters.
The minimal common region of deletion was identified using flanking p-telomeric and centromeric clones. Out of 223 informative samples, 28 cases were observed (12.6%) with deletions in any of the three loci. Interestingly, deletion of the FOXP3 locus was found in all of the 28 cases. These data suggested that FOXP3 is likely within the minimal region of deletion in the Xp11 region studied. Although all deletions were heterozygous, the FOXP3 protein was undetectable in 26/28 cases. Thus, it appears that for the majority of the breast cancer samples, LOH alone was sufficient to inactivate the locus, perhaps due to X-chromosomal inactivation. The two cases with both deletion and FOXP3 expression had X-polysomy with 3 and 4 X-chromosomes respectively.
Thirdly, DNA was isolated from matched normal and cancerous tissues (50 cases with formalin fixed samples and 15 cases of frozen samples) from patients with invasive ductal carcinoma and amplified all 11 coding exons and intron-exon boundary regions by PCR. Two independent PCR products were sequenced in order to confirm the mutations. Unless the bulk sequencing data were unambiguous, the PCR products were cloned and 5-10 independent clones from each reaction were sequenced. Among the formalin fixed samples, only cases were used in which the normal tissue samples gave unambiguous sequencing data that matched the wild-type FOXP3 sequence.
When the cancerous tissues were compared with normal tissues from the same patient, 36% (18/50 formalin-fixed samples and 5/15 frozen samples) showed somatic mutations. Loss of the wild-type allele was found in 6/23 cases (38%) of cancer samples with somatic FOXP3 mutations, while the other cases had heterozygous mutations. Eighteen mutations resulted in the replacement of amino acids all or most of which are likely to be critical for FOXP3 function, as judged from the pattern of mutation in IPEX patients (Ziegler, Annu Rev Immunol 24: 209-226 (2006)) or in the conserved zinc finger domain that has so far not been implicated.
Although most samples had a single mutation of the FOXP3 gene, two cases were observed with multiple mutations. In the first sample, the two mutations occurred in consecutive codons, resulting in two nonconservative replacements of amino acid residues. Clonal analysis revealed that both mutations occurred in the same clone. In the second sample, three mutations occurred in intron 11. Since this mutant lacked a WT allele, it is likely that all of the mutations occurred in the same allele. The possibility of a mismatch in the cancer and normal samples was ruled out by comparing the normal and cancer samples for polymorphism of two unrelated genes.
To directly test whether FOXP3 mutations affect the repressor activity for the HER-2 gene, two representative somatic FOXP3 mutants isolated in the cancer cells were chosen and their repressor activity for the HER-2 promoter was tested. One mutation (338P→L) was found in the signature forkhead domain which is often mutated in the IPEX patient, while the other double mutation (204C→R,205E→K) was from the zinc finger domain that has not been implicated in IPEX patients. Both mutations significantly reduced the repressor activity of FOXP3. The reduced repression of the HER-2 promoter correlates with a significantly reduced inhibition of HER-2 mRNA.
In four instances, mutations were identified in introns that may potentially affect RNA splicing. Thus, laser-guided micro-dissection was used to isolate normal and cancerous epithelial cells from one case with a mutation in intron 6. RNA was isolated and tested for the potential effects of the mutation on RNA splicing (using primers on exons 5 and 8) and total FOXP3 transcript, as quantitated by real time PCR using primers spanning exons 10-12. Tissues from another patient with a mutation in exon 7 were used as control.
Results showed that primers spanning exons 5 and 8 failed to detect FOXP3 mRNA from the cancerous tissue of case No. 23. Furthermore, primers spanning exons 10-12 also failed to detect any FOXP3 transcripts. Substantial levels were detected in the normal epithelial cells of the same patients as well as in normal and cancerous tissues from case No. 22. Since the wild-type allele had been lost in the cancer cells of case No. 23, it is likely that the mutation in intron 6 inactivated FOXP3. With an intron of 944 nucleotides, a mutation that prevented splicing of intron 6 would cause premature-termination codon-mediated RNA decay, which is operative in the FOXP3 gene (Chatila et al., J. Clin Invest 106: R75-81 (2000)).
Example 5 FOXP3 Defects and HER-2 Over-ExpressionTo demonstrate a role for FOXP3 defect in HER-2 over-expression, the FOXP3 gene was first silenced in early passage of primary HMEC (Supplemental FIG. S3) using a lentiviral vector expressing FOXP3 siRNA. In brief, lentivirus-based siRNA expressing vectors were created by introducing the murine U6 RNA polymerase III promoter and a murine phosphoglycerate kinase promoter (pGK)-driven EGFP expression cassette into a vector of pLenti6/V5-D-TOPO back bone without CMV promoter. A hairpin siRNA sequence of FOXP3 (target sequence at the region of 1256 to 1274 nucleotides; 5′-GCAGCGGACACTCAATGAG-3′) (SEQ ID NO: 109) was cloned into the lentiviral siRNA expressing vectors by restriction sites of ApaI and EcoRI.
Results showed that FOXP3 siRNA reduced FOXP3 expression by more than 100-fold while increasing HER-2 mRNA by 7-fold. A corresponding increase in cell surface HER-2 was also observed. These results implicate FOXP3 as a repressor of HER-2 in human breast epithelial cells.
Since a major mechanism for HER-2 up-regulation in breast cancer is gene amplification (Kallioniemi et al., Proc Natl Acad Sci U.S.A. 89: 5321-5325 (1992)), an intriguing issue was whether FOXP3 is capable of repressing HER-2 in cancer cells with an amplified HER-2 gene. A Tet-off line of BT474, a breast cancer cell line known to have HER-2 gene amplification (Kallioniemi et al., Proc Natl Acad Sci U.S.A. 89: 5321-5325 (1992)) was produced and transiently transfected it with a pBI-EGFP-FOXP3− vector. After drug selection, the cells were cultured either in the presence or absence of doxycycline.
While the cells cultured with doxycycline did not express FOXP3, removal of doxycycline resulted in induction of FOXP3 in a significant fraction of the cancer cells, which allowed comparison of HER-2 levels in the FOXP3+ and FOXP3− cells in the same culture by flow cytometry. Results showed that FOXP3− cells had about a 5-10-fold higher level of the HER-2 protein on the cell surface in comparison to the FOXP3+ cells.
The expression of FOXP3 was then compared with HER-2 expression in breast cancer tissues. Down-regulation of FOXP3 was strongly associated with the over-expression of HER-2, which supports a role for FOXP3 inactivation in HER-2 over-expression in breast cancer. Nevertheless, since many of the FOXP3-cells remained HER-2-, it is likely that dis-regulation of FOXP3 is insufficient for HER-2 up-regulation. On the other hand, since only 3/82 FOXP3+ cancer cells expressed high levels of HER-2, FOXP3 inactivation is likely important for HER-2 up-regulation under most circumstances.
Next, breast cancer samples were divided based on their HER-2 gene copy numbers and compared the FOXP3+ and FOXP3− cancer samples for the relative amounts of cell surface HER-2 expression. Results showed that in each of the gene dose categories, FOXP3+ samples had reduced HER-2 scores in comparison to the FOXP3− samples. These results strongly suggest a critical role for FOXP3 in repressing HER-2 expression even in the cases of HER-2 gene amplification.
Of the 223 informative samples among the 238 that were screened for Xp11.2 deletions, those with deletions encompassing the FOXP3 locus had significantly higher HER-2 scores compared to those without deletions (P=0.03). Likewise, the relative HER-2 scores were compared among the 50 samples in which we had sequenced all FOXP3 exons. Results showed that the mutations in the FOXP3 gene correlated with higher levels of HER-2 (P=0.0083).
Example 6 FOXP3/FOXP3 Inhibits Tumorigenicity of Cancer CellsTo test whether the FOXP3 gene can suppress the growth of breast cancer cells, the empty vector or the vectors carrying either FOXP3 (mouse or human origin) or Otc cDNA were transfected into three breast cancer cell lines, including mouse mammary tumor cell line TSA or human breast cancer cell lines MCF7 (ER+HER-2low, no HER-2 amplification) and SKBr3 (ER-HER-2high with HER-2 amplification). The untransfected cells were removed by a selection with G418.
While the vector-transfected cells grew rapidly, the FOXP3-transfected cell lines seldom grew into large colonies. The FOXP3-transfected culture had a drastic reduction in both the size and the number of the drug-resistant colonies. No effect was observed when the Otc cDNA was used.
To test whether the somatic mutations uncovered from cancerous tissues ablated their growth inhibition, WT and two mutant FOXP3 cDNA were transfected into SKBr3 and MCF7 cell lines. In both cell lines, the mutants had a greatly reduced ability to suppress tumor growth.
To test whether repression of ErbB2 is related to the tumor suppressor activity of the FOXP3 gene in the ErbB2+ cancer cell line, TSA cells were transfected with mouse CMV promoter-driven ErbB2 cDNA cloned into the pcDNA6 vector and evaluated their susceptibility to FOXP3-mediated growth suppression. In this setting, the expression of ErbB2 was resistant to FOXP3-mediated repression. If repression of endogenous ErbB2 is critical for FOXP3-mediated tumor suppression, ectopic expression of ErbB2 should alleviate the growth inhibition by FOXP3.
While the pcDNA6-vector-transfected TSA cells remained susceptible to FOXP3-mediated repression, the ErbB2-transfected TSA cells were completely resistant. In contrast, transfection of c-Myc barely alleviated the growth inhibition by FOXP3. These results suggested that FOXP3 suppresses TSA growth by repressing transcription of ErbB2.
TSA cells were transfected with either empty vector or V5-tagged FOXP3 cDNA. The stable transfectant cell lines were selected by G-418. The vector and FOXP3-V5-transfected cell lines were injected into syngeneic BALB/c mice, which were then observed for tumor growth and mouse survival.
Results showed that FOXP3-transfectants showed reduced growth in vivo. The mice that received TSA-vector cells became moribund earlier with higher incidence, while about 50% of the mice that received the FOXP3-V5-transfected cells survived more than 7 weeks. Similarly, FOXP3-transfected 4T1, a mouse mammary cancer cell line also showed reduced tumorigenicity in vivo.
These results demonstrated that, for TSA cell line which has ErbB2 over-expression, repressing the ErbB2 locus is responsible for FOXP3's tumor suppressor activity. The requirement for continuous expression of ErbB2 is best explained by the concept of oncogene addiction (Weinstein, Science 297: 63-64 (2002)). However, FOXP3 can also suppress the growth of tumor cell lines that do not grossly over-express HER-2/ErbB2, such as MCF-7.
In addition to mammary cancer cell lines, it was demonstrated that FOXP3 expression suppressed growth of thymoma cell line EL4. Thus, FOXP3 can suppress growth of multiple lineage of tumors.
In an effort to identify other potential FOXP3 targets, a FOXP3-Tet-off MCF-7 cell line was produced that expresses FOXP3 upon removal of tetracycline. Using the most current version of Entrez Gene-based CDFs for a more accurate GeneChip analysis (Dai et al., Nucleic Acids Res 33: e175 (2005)), it was found that wide-spread changes in the expression of genes that are involved in several pathways critical for cancer cell growth. The genes with >2.0 fold changes that occurred on day 2 and >4.0 changes on day 4 of FOXP3 induction were analyzed by Ingenuity Pathway.
Ingenuity Pathway analysis indicated that FOXP3-regulated genes belong to multiple cellular pathways related to the process of cancer development. Interestingly, when we used the GeneGo MetaCore knowledgebase to analyze genes that related to the ErbB2 signaling pathway, we found that FOXP3 down-regulated 10 genes in this pathway. With the notable exception of b-Myb and c-Myb, the down-regulation was not likely related to FOXP3-mediated ErbB2 repression, as the majority of the genes are not known transcriptional targets of ErbB2. Thus, FOXP3 can suppress ErbB2 signaling and tumor growth by mechanisms in addition to ErbB2 repression. These data provide a plausible explanation for the tumor suppressor activity of FOXP3 in breast cancer cell lines that do not substantially overexpress HER-2.
Example 7 Identification of Compounds that Induce FOXP3 Expression in Cancer Cells and their Therapeutic EffectA method was developed to induce FOXP3 expression in cancer cells by activating JNK, P38 and ATF2. Briefly, breast cancer and thymoma cell lines were treated with activators of JNK, P38 and ATF2, such a emetine and anisomycin for 14 hr to 2 days. The cells were analyzed for expression of FOXP3-encoding mRNA by RT-PCR.
Results showed strong induction of FOXP3-encoding mRNA in various cancer cell lines, including thymoma cell line BW5147, transformed thymic epithelial cell 61.7, and breast cancer cell lines TSA by anisomycin and emetine.
Given the impact of FOXP3 activity on tumor growth and cell death, these compounds were also tested for their ability to kill cancer cells. Data demonstrated that within 48 hours, anisomycin treatment killed a substantial percentage of cancer cells in all three breast cancer cell lines tested, including MCF-7, BT474, and TSA. The IC50 ranges between 30-100 ng/ml.
These data provide a method to screen compounds that induce FOXP3 expression and are cytocidal for cancer cells. In order to carry out large scale screening, it is possible to obtain cells from mice in which the FOXP3 gene is modified to also express a detectable reporter protein, such as for example, green fluorescence protein (GFP) or luciferase. In this way, a library of test compounds are incubated with the cells for a given period of time and the level of FOXP3 transcription is monitored by the amounts of reporter protein. By comparing the structure features of the compounds identified, additional compounds are designed based on the relative activity of the active compounds.
Example 8 Identification of the Mechanism by which Anisomycin Induces FOXP3To identify the mechanism by which anisomycin induced FoxP3, the activation of ATF2, p38, and JNK upon treatment with either anisomycin or PMA was compared. 4T1 cells were treated with either vehicle control, anisomycin (1 μg/ml) or PMA (0.5 μg/ml). Western blots of the cell lysates were obtained using antibodies specific for phospho-ATF2, phospho-p38, ATF2, phospho-JNK1/2, phospho-c-Jun. Levels of beta-actin were used as loading controls.
While both PMA and anisomycin activated p38 and ATF2, PMA failed to activate JNK and its down-stream substrate c-Jun. These data raised the possibility that JNK signal pathway may contribute to FoxP3 induction.
Cells of a mammary tumor cell line were treated with anisomycin in conjunction with inhibitors of overlapping specificity. Specifically, 4T1 cells were treated with vehicle control, anisomycin (1 μg/ml) or PMA (0.5 μg/ml) in the presence or absence of inhibitors (2 μg/ml): SP10096 (SP), SB203580 (SB), and PD9786 (PD). Western blots of the cell lysates were obtained using antibodies specific for phosphor-ATF2, phospho-p38, ATF2, phospho-JNK1/2, phospho-c-Jun. Levels of beta-actin were used as loading controls.
SP efficiently inhibited the activation of ATF2, JNK, and c-Jun by anisomycin and prevented the induction of FoxP3. On the other hand, SB inhibited p38α completely but inhitibed ATF2 and JNK only partially. Also, SB reduced, but did not eliminate, FoxP3 induction. PD, which had no effect on any of the three substrates, also failed to inhibit FoxP3 induction.
Example 9 Involvement of ATF2 and JNK but not P38 in FoxP3 InductionLentiviral vectors were generated expressing shRNA for JNK1, JNK2, ATF2 or p38α to test the function of the three components. The lentivirus-based shRNA expressing vectors were created by introducing the murine U6 RNA polymerase III promoter and a murine phosphoglycerate kinase promoter (pGK)-driven EGFP expression cassette into a vector of pLenti6/V5-D-TOPO back bone without CMV promoter. Hairpin shRNA sequence of FoxP3, JNK1, JNK2, p38, and Atf2 (FoxP3: 5′-aagccatggcaatagttcctt-3′ (SEQ ID NO: 168); FOXP3, 5′-gcagcggacactcaatgag-3′ (SEQ ID NO: 169), JNK1,2: 5′-agaaggtaggacattcctt-3′ (SEQ ID NO: 170); p38: 5′-aataccgagagttgcgtctgc-3′ (SEQ ID NO: 171); Atf2: 5′-cttctgttgtagaaacaac-3′ (SEQ ID NO: 172)) were cloned into the lentiviral shRNA expressing vectors by restriction sites of ApaI and EcoRI.
The lentiviral vectors with or without the shRNA were introduced into 4T1 cells. The efficacy of shRNA silencing was assayed by Western blotting using antibodies specific for JNK1/2, ATF2, or p38-alpha. Levels of beta-actin were used as loading controls. 4T1 cells were treated with a vehicle control or anisomycin (0.1 μg/ml) for 16 hours. The FoxP3 expression levels were determined by real time (RT)-PCR using primers spanning from start codon to stop codon.
While the inhibition of p38α expression had only a slight effect on FoxP3 induction, silencing either JNK or ATF2 resulted in a significant reduction of the FoxP3 transcripts. These data provide important genetic evidence for the involvement of JNK and ATF2 in anisomycin-induced FoxP3 expression.
Example 10 ATF2 is Responsible for Expression of FOXP3 in Mammary Epithelial CellsATF2± mice were obtained from the frozen embryo bank of the Jackson Laboratories and were crossed to produce ATF2+/+ and the ATF2−/− mice. A previous report indicated that the only a small fraction of the ATF2−/− mice survive to adulthood (Reimold et al., Nature 379: 262-265 (1996)). Two independent primary cultures were obtained from two ATF2−/− females. Specifically, mouse mammary fat pads were removed from 6 to 8-week-old virgin female mice and minced into small pieces. After collagenase digestion at 37° C. in a shaking incubator in DMEM medium supplemented with 5% fetal calf serum (FBS), cells were sieved through a 70-μm cell strainer (BD Falcon) to obtain a single cell suspension. The cells were cultured in DMEM medium supplemented with 10% FBS and 10 ng/ml epithelial growth factor (EGF). At day 3 of culture, fibroblast cells were removed by a short digestion with 0.05% trypsin-EDTA as less adherent cells.
The cultures were observed for morphology and a higher cellular density of the ATF2−/− culture was noted. Also, the epithelial origin of the cultures was demonstrated by the expression of CK19, as shown by Western blotting with antibodies specific for CK19. Since T cells are the major source of FoxP3 transcripts in vivo, the primary culture was tested for CD3 transcripts by Western blotting with antibodies specific for CD3 and was confirmed to have an absence of T cell contamination.
The primary cultures were then assayed for expressioin of FOXP3 protein by Western blotting cell lysates of the cultures with antibodies specific for FOXP3. The primary transcripts also were assayed for expression of FOXP3 by real-time PCR.
ATF2+/+ epithelial cultures expressed significant amounts of FOXP3 transcripts, which were further induced by the treatment of anisomycin. ATF2−/− cells, on the other hand, had no detectable FoxP3 transcripts and were completely refractory to anisomycin. These data revealed an essential role for ATF2 in both constitutive and inducible expressions of FoxP3.
Example 11 Identification of the FoxP3 Enhancer Associated with ATF2 and c-JunIn order to study the mechanism of ATF2/c-Jun-mediated induction of FoxP3, chromatin immunoprecipitation (ChIP) was carried out as described in (Im et al., Nat Med 5: 412-417 (1999)) to identify an anisomycin-inducible binding site of the FoxP3 locus. Briefly, 4TI cells were treated with vehicle or anisomycin for 2 hours. The cells were sonicated and the chromatin was fixed with 1% paraformaldehyde. Anti-phospho-c-Jun or anti-phosphor-ATF2 antibodies or control rabbit IgG were used to precipitate chromatin associated with these proteins. The amounts of the specific DNA fragments were quantitated by real-time PCR and normalized against the genomic DNA preparation from the same cells. Immunoprecipitation with either phospho-ATF2 antibodies or phospho-c-Jun antibodies followed by Western blotting with the immunoprecipitating antibodies demonstrated that anisomycin-induced phospho-ATF2 and phospho-c-Jun were efficiently precipitated by antibodies. Untreated 4T1 cells barely had detectable amounts of phospho-ATF2 and phospho-c-Jun in the nuclei. Following treatment with anisomycin, a major increase of phospho-ATF2 and phospho-c-Jun were detected in the nuclear fraction.
In order to identify the FoxP3 sequence associated with p-ATF2 and p-c-Jun, the 5′ sequence of the FoxP3 gene was analyzed and 14 potential AP1 and CREB sites were identified. PCR primers were designed across the 10.4 kb regions, and the amount of each PCR product was normalized against that amplified from the input DNA under different conditions: untreated/precipitated with anti-phospho-ATF2 antibodies, anisomycin treated/precipitated with anti-phospho-ATF2 antibodies, untreated/precipitated with anti-phospho-c-Jun antibodies, anisomycin treated/precipitated with anti-phospho-c-Jun antibodies, and pooled/precipitated with IgG antibodies.
Two potential sites for ATF2/cJun interaction as demonstrated by the increase in % input upon anisomycin treatment were revealed from this experiment. The first is hereinafter referred to as P2, which is 4.8 kb 5′ of exon 1. The second and stronger binding site referred to hereinafter as P10 is 4.2 kb 3′ of exon 1. Importantly, while the P2 ATF2/cJun association is not inducible by anisomycin, the P10 binding is enhanced by more than 2-fold by anisomycin. Moreover, comparison of mouse and human FoxP3 sequence revealed that the P10, but not the P2 site is highly conserved. Therefore, P10 became the focus as a potential site for p-ATF2 and p-cjun interaction.
Sequencing comparison identified a typical AP1 site within the P10. In order to directly demonstrate interactions of ATF2 and c-Jun to the FoxP3 promoter, an oligonucleotide probe containing conserved AP1 site, as well as two control oligos with mutations in the AP1 site, were radio-labeled and tested for binding to nuclear extracts. The sequence of nonmutated probe (P10) is agatggacgtcacctaccacatcacgg (bold letters for core AP1 sequence; SEQ ID NO: 173), that for P10-Mt1 is agatggacgtctgcgcccacatcacgg (bold letter indicate mutations; SEQ ID NO: 174), while that for P10-Mt2 is agatggacgtcgacgcccacatcacgg (SEQ ID NO: 175).
The nuclear extracts from anisomycin-treated, but not those from the untreated 4T1 cells, showed strong interaction with the nonmutated P10 probe. The specificity was confirmed by the fact that mutations in the AP1 site significantly reduced the binding. Furthermore, the involvement of ATF2 and c-Jun was demonstrated by the fact that antibodies specific for ATF2 or c-Jun abolished the binding of nuclear extracts to the nonmutated probe. Furthermore, the role of ATF2 and c-Jun activation is consistent with observed inhibition by SP. Thus, both ChIP and electrophoresis mobility-shift assay identify a specific AP-1 site with 4.2 kb 3′ of the TSS, which binds to both p-ATF2 and p-cjun by anisomycin-inducible fashion.
To test whether the P10 sequence was a functional FoxP3 enhancer, a series of constructs consisting of the basal promoter and putative enhancer elements were generated. A 265 bp sequence 5′ of the transcriptional start site (TSS) of the FoxP3 locus plus 50 bp down-stream of TSS is sufficient to convey significant basal promoter activity. This fragment was therefore chosen to measure the enhancer activity. An addition of three copies of P2 fragment increased the promoter activity by about 2-fold, which suggests that P2 is at best a weak enhancer. Inclusion of three copies of P10 sequences, however, increased the FOXP3 promoter activity by 10-fold. This appears uni-directional as the inversion of the P10 fragment eliminated its enhancer activity. Moreover, the involvement of AP1 site in P10 was confirmed as a mutation of the AP1 site significantly reduced the enhance activity. Moreover, addition of P2 to P10 failed to further enhance the promoter activity. Taken together, our data demonstrated that anisomycin induced ATF2/c-Jun interaction with a specific enhancer within the intron 1 of the FoxP3 gene.
Example 12 A critical Role for ATF2-FoxP3 Pathway in Anisomycin-induced Apoptosis and the Therapy of Breast CancerRecent studies have demonstrated that induced expression of FoxP3 caused apoptosis of breast cancer cell lines (Zuo et al., Cell 129: 1275-1286 (2007); Zuo et al., J Clin Invest 117: 3765-3773 (2007); and Reimold et al., 1996, supra). To determine whether anisomycin treatment causes apoptosis of breast cancer cells, the cytotoxic effect of anisomycin on several of breast cancer cell lines was measured by MTT assay. 104 cells/well of mouse cell line (TSA) or human breast cancer cell lines (TB474 or MCF7) were cultured in the presence of 25, 50, 100, 200, 400, or 800 ng/ml anisomycin for 48 hours. The amounts of viable cells were determined by MTT assay, with viability of the untreated cells defined as 100%. Both mouse (TSA) and human breast cancer cell lines (BT474, MCF-7) were highly susceptible to anisomycin, with an IC50 between 50-100 nM.
Cells were stained for activated Capsase 3 and also tested for DNA contents. The % of gated cells was apoptotic based on their sub-2C DNA contents. The reduced viability was due to apoptosis as revealed by the increased expression of active caspase 3 in TSA cells with less than 2C DNA contents.
Given the critical role for ATF2 in FoxP3 induction, the contribution of ATF2 to anisomycin-induced cell death was tested by comparing the dose response to anisomycin in cells transfected with vector alone or those with ATF2 shRNA. TSA cells were transduced with lentiviral vector encoding either scrambled shRNA of shRNA specific for ATF2 or FoxP3. The transfected cells were enriched by short-term treatment of blastcidin at a dose of 6.5 μg/ml and subject to treatment of a different dose of anisomycin (0, 20, 40, or 80 ng/ml). The viability was measured by MTT assay. ATF2 shRNA increased resistance to anisomycin by 4-fold. Likewise, the FoxP3 shRNA also increased drug resistance by a similar extent. These data demonstrate a critical role for the ATF2-FoxP3 pathway in anisomycin induced cell-death of breast cancer cells.
To test whether induction of FoxP3 by ATF2-FoxP3 pathway can be explored for breast cancer therapy, cells (5×105) of the TSA cell line were injected into the mammary fat pads of BALb/c mice. Five days later, when the cancer cells established locally, the mice were intraperitoneally treated with vehicle control or anisomycin every 3 days for 8 times at a dose of I mg/mouse. The dose did not give obvious side effects and is about 1/10 of the IC50 in mice. The growth of the TSA tumor cells in syngeneic mammary pad was nearly completely abrogated by anisomycin. These data demonstrate the potential of ATF2-FoxP3 pathway in the therapeutic development for breast cancer.
Example 13 Induced Expression of FOXP3 is Sufficient to cause Apoptosis of Breast Cancer Cell LinesIt was demonstrated that transfection of FoxP3 can repress tumor cell growth (Zuo et al., Cell 129: 1275-1286 (2007)). To confirm that FoxP3 expression actively causes tumor cell death, a Tet-off system, in which the expression of FOXP3 was induced when the cells were placed in doxycyclin-free medium, was generated. Cells cultured in the doxycyclin-free medium expressed FOXP3 and essentially all of the cells underwent programmed cell death. These data demonstrate that FOXP3 expression can potentially kill tumor cells.
Example 14 Large Scale Screen for Compounds that Specifically Induce FOXP3 ExpressionPrimary epithelial cells from FoxP3-GFP knockin mice are isolated and used as the primary read out for screening. Compounds from the National Cancer Institute are provided in 96-well plates as a first library. In brief, 104 cells/well of breast epithelial cells are added to the 96-well plates containing the compounds. After 48 hours of culture, the plates are scored for fluorescence intensity. Those that exhibit 2-fold increase in fluorescence are selected for further testing. Once the effects are confirmed, the compounds are tested for ATF-2-dependent FOXP3 induction using primary epithelial cells that are ATF-2−/− FoxP3gfp/gfp.
Once lead compounds are identified, the compounds are tested for in vitro cytotoxicity for TSA cells by MTT assay. The TSA that are transfected with siRNA for either ATF-2 or FoxP3 are used as a control. By this series of screening, 2-3 lead compounds that inhibit growth of breast cancer cell lines by inducing FoxP3 through an ATF-2-dependent mechanism are expected.
Example 15 FOXP3 is a Transcriptional Repressor of MYC OncogeneCell lines containing the vector of FOXP3-tetoff (Zuo et al., 2007, supra) were cultured in the presence or absence of doxycyclin for 0-96 hours. Specifically, MCF-7 cell lines with Tet-off induction of either GFP or GFP+FOXP3 cDNAs were cultured in the absence of doxycyclin for the time periods 0, 24, 30, 48, 72, or 96 hours. The total RNA from the cells was isolated for quantitation of FOXP3 transcripts by real-time PCR (Applied Biosystems ABI Prism 7500 Sequence Detection System, Applied Biosystems, Foster City, Calif.). The SYBR (Applied Biosystems, Foster City, Calif.) green fluorescence dye was used in this study. The average relative expression was determined using the comparative method (2−ΔΔCt) or was calculated by plotting the Ct (cycle number) against the standard curve and comparing this to an endogenous control. The primer sequences (5′-3′) are listed in Table 3.
Induction of FOXP3 expression resulted in a rapid down regulation of MYC mRNA.
To understand the mechanism by which FOXP3 represses MYC, ChIP was used to identify the site of FOXP3 binding in the MYC promoter. ChIP was carried out according to a published procedure (Im et al., Methods Mol Biol 284: 129-146 (2004)). Briefly, the FOXP3-transfected Tet-off MCF cells were cultured in the absence of doxycyclin for 48 hours and used as a source of chromatin for ChIP. The cells were sonicated and fixed with 1% paraformaldehyde. The anti-FOXP3 and anti-IgG antibodies were used to pull down chromatin associated with FOXP3. The amounts of the specific DNA fragment were quantitated by real-time PCR and normalized against the genomic DNA preparation from the same cells. The ChIP real-time PCR primers are listed in Table 3.
Quantitative PCR analysis indicated that, despite the abundance of forkhead binding sites, a strong binding of FOXP3 centered around 0.2 kb downstream from the transcription starting site (TSS). To test the significance of this site for the repression, deletional analysis was carried out to map the region that conveys susceptibility to FOXP3 repression.
Little, if any repression by FOXP3 was observed when the reporter was truncated before the forkead binding site at the 0.2 kb region (Fragment 1 (F1): 0 to +401; F2: −184 to +401). Strong inhibition was observed when the binding motif is included (F3: −346 to +401; F4: −698 to +401; and F5: −1059 to +401). Additional sequence did not increase the efficiency of repression. In addition, when the forkhead site at −0.2 kb was either deleted or mutated, the repression is completely abrogated. These data demonstrated that FOXP3 repression MYC promoter activity by interacting with the forkhead motif at the −0.2 kb of the MYC promoter.
FoxP3 is expressed at high levels in mouse prostate epithelial cells (Chen et al., J. Immunol. 180: 5163-5166 (2008)). To test if this is also the case for human prostate tissue, a tissue microarray sample (University of Michigan and Biomax (US Biomax, Inc., Rockville, Md.) was stained with normal prostate samples. Briefly, ABC detection system was used for immunostaining according to the manufacturer's protocol (Vectastain Elite ABC, Burlingame, Calif.). The incubation time for primary antibody FOXP3 (1:20), cMyc (1:200) and Ki67 (1:100) was overnight at room temperature. After incubation with primary antibody, staining was followed by ABC detection system using biotinylated anti-mouse immunoglobulin for FOXP3, cMyc and Ki67 at a dilution of 1:200 and avidin-biotin peroxidase macromolecular complex at 1:100, with an incubation time of 30 min for each step. A wash of 10 min using PBS was added in between each step. AEC was used as chromogen. Finally, the slides were counterstained with hematoxylin and mounted in xylene mounting medium for examination. The FOXP3 mAb stained human prostate epithelium. Consistent with a repressor function of FOXP3 for MYC, a lack of MYC was observed in the normal prostate human prostate epithelial cells (HPEC).
To determine whether the endogenous FOXP3 in prostate epithelial cell lines is responsible for MYC repression, the FOXP3 locus was silenced with a lentiviral vector encoding shRNA for FOXP3. Human Prostate Epithelial Cells (HPEC) were purchased from Lonza Group Ltd (Switzerland) and were cultured with medium. An early passage of the HPEC were infected with lentivirus expressing either control shRNA or FOXP3 shRNA vector as described in Zuo et al., 2007, supra. Uninfected cells were removed by drug selection. At one week after infection, the levels of FOXP3 or MYC mRNA were quantitated by RT-PCR. Western blotting was also carried out using anti-FOXP3 or -MYC antibodies. Beta actin was used as a loading control. FOXP3 shRNA caused a major reduction in the expression of FOXP3 mRNA. Correspondingly, the level of MYC transcript was significantly elevated by FOXP3 ShRNA.
To determine whether FOXP3 inhibits expression of MYC in prostate cancer cell lines, FOXP3 cDNA was transfected into prostate cancer cell lines Du 145 and PC3 (obtained from American Type Culture Collection (ATCC)) and the lysates of the transfected cells were measured for levels of MYC protein by Western blot. Beta actin was used as a loading control. FOXP3 transfection almost completely eliminated MYC in the two cell lines.
The expression of FOXP3 and MYC in tissue microarray samples consisting of 214 cases of prostate cancer was compared in order to determine whether lack of FOXP3 expression correlated with MYC elevation. TMA of prostate cancer tissues were stained by immunohistochemistry with antibodies against FOXP3 or MYC. FOXP3+ and FOXP3-tumor samples were analyzed for MYC expression and compared using a Chi-square test. While 27.6% of FOXP3+ cancer expressed elevated levels of MYC, nearly 72.4% of the FOXP3− tumors over-expressed MYC. Thus, FOXP3 down regulation is suggested to be an important factor leading to elevation of MYC in prostate cancer.
Example 16 FOXP3 Inhibits Growth of Prostate Cancer Cell LinesGiven the significant role for MYC in cancer cell proliferation, the consequences of FOXP3 expression on the colony-forming capapcity of prostate cancer cells were tested.
DU145 and PC3 cells were transfected with either control vector or FOXP3 cDNA. After drug selection for 2 weeks, the drug-resistant colonies were counted under a microscope. When the FOXP3 cDNA was ectopically expressed in PC3 and Du145, a significant reduction of colonies formed from 104 cells was observed.
In order to determine whether the growth inhibiton was mediated by repression of MYC, FOXP3 with MYC cDNA was co-transfected into Du145 cells. The cells were transfected with either pcDNA6-blasticidin vector or MYC cDNA and either the pEF1-G418 vector or FOXP3 cDNA and selected with blasticidin and G418 for 3 weeks. The viable colonies were visualized after staining with the crystal violet dye. The representative plate showed that abrogation of FOXP3-mediated suppression by MYC.
Example 17 Somatic Deletion and Epigenetic Silencing of the FOXP3 Locus Down-regulate FOXP3 ExpressionThe strong growth inhibition of prostate cancer cell lines in combination with the potent MYC repressor activity of FOXP3 make FOXP3 a prime candidate of tumor suppressor for prostate cancer. As a first test for the hypothesis, the expression of FOXP3 in normal and prostate tissue was evaluated by both immunohistochemistry of tissue microarray. Immunohistochemistry with anti-FOXP3 mAb (Abcam, ab20034, Clone 236A/E7) can detect nuclear FOXP3 staining in more than 70% of the benign prostate tissues tested. In contrast, only 34% of prostate cancer samples show nuclear FOXP3 staining.
To substantiate this observation, microdissection was used to obtain benign prostate tissue and cancer tissues from the same patients and compared the FOXP3 mRNA. Since inflammatory T cells are a major sources of FOXP3 expression, areas of inflammation were carefully avoided for dissection. Briefly, tissue sections from frozen mouse or human prostate samples (obtained from the Prostate Cancer Tissue Bank of Ohio State University) were cut (8 μm thicknesses) and transferred to non-polylysine-coated glass slides. The slides were stained with Harris hematoxylin for 50 seconds and Eosin for 30 seconds and then dried in a laminar flow hood for 5 to 10 min prior to microdissection. Five thousand target cells will be Laser-capture micro-dissection (LCM) from target tissues using Arcturus PixCell II system (Arcturus, Santa Clara, Calif.) with an Olympus IX-50 microscope. The LCM cell procurement time for RNA was always less than 15 minutes. RNA was extracted using the Picopure RNA extraction kit (Molecular Devices, Sunnyvale, Calif.) and amplified by RT-PCR. Genomic DNA was extracted from microdissected cells using PicoPure DNA Isolation kit (Molecular Devices, Sunnyvale, Calif.). After normalizing against a house-keeping gene (GAPDH), 15/20 cases show 2-10 fold reduction of FOXP3 mRNA in comparison to the benign tissues. Thus, reduced FOXP3 expression is wide-spread among prostate cancer samples.
Recent studies suggested that DNA methylation is involved in limiting FOXP3 expression (Floess et al., PLOS Biol 5, e38 (2007); Kim and Leonard, JEM 204: 1543-1551 (2007)). DNA comprising the FOXP3 gene was purified from microdissected samples were tested for % methylation by pyrosequencing. Specifically, amplification and sequencing primers for the FoxP3 promoter and intronic CpG islands were designed using MethPrimer software. FoxP3 Promoter: Forward (and sequencing primer): 5′ AGTAAAGGGTAGTTGGAAGGTAAAG (SEQ ID NO: 176); Reverse primer: 5′ Biotinylated-AAAAACAAAAAATCCCATCCTAAAT (SEQ ID NO: 177). FoxP3 intron: Forward (and sequencing primer): 5′ TTGGGTTAAGTTTGTTGTAGGATAG (SEQ ID NO: 178) Reverse primer: 5′ Biotinylated—ATCTAAACCCTATTATCACAACCCC (SEQ ID NO: 179). Each 25 ul PCR reaction (containing 2 ul bisulfite modified DNA, 0.2 uM forward primer, 0.4 uM biotinylated reverse primer, and 15 ul Qiagen Master Mix) was subjected to the following cycling conditions: 1 cycle of 95° C. for 15 min, 44 cycles of 95° C. for 30″, 53° C. for 30″, 72° C. 30″, and 1 cycle 72° C. for 10′.
Pyrosequencing was performed using PyroGold reagents and the PyroMark MD instrument (Biotage). Briefly, 5 ul of biotinylated PCR product was immobilized onto 2 uL streptavidin-Sepharose beads (Amersham Biosciences) diluted in Binding Buffer. After applying a vacuum to collect the beads, the non-biotinylated DNA strand was removed using Dissociation Buffer (0.2 M NaOH) and the single stranded biotinylated product was washed, and placed onto a PSQ HS 96 plate containing 0.4uM sequencing primer. The sequencing primer was annealed to the ss DNA product at 90° C. for 2′, cooled, and subjected to the sequencing reaction using nucleotide volumes recommended for CDTs, and a nucleotide dispensation order generated by the PyroQ CpG software (bottom sequence of each pyrogram). In addition to a small CpG motif in the FOXP3 intron 1 which was reported to be involved in regulating FOXP3 expression in T cells, a prominent CpG island 5′ of the FOXP3 promoter was also identified.
Using a quantitative pyrosequencing method for FOXP3 analysis, the level of methylation in both the intronic CpG motif and the CpG island was quantitated in the promoter region of FOXP3, using DNA from 17 cases of micro-dissected normal and cancerous tissues. While no significant difference in methylation in the intronic CpG motif was observed between benign and cancerous tissues, a highly significant increase in the FOXP3 5′ CpG methylation was observed in the cancer samples (P=0.0075). Morover, the increase in methylation strongly correlate with reduction of FOXP3 expression. To verify the significance of DNA methylation, prostate cancer cell lines PC3 and Du145 were treated with a methyltransferase inhibitor (5-aza-2′-deoxycytidine (5-AZA)). 5-AZA-treatment caused a two-fold induction of the FOXP3 gene in the prostate cancer cell lines tested.
Another mechanism to inactivate FOXP3 expression is by gene deletion. To explore this possibility in prostate cancer samples, fluorescence in situ hybridization (FISH) was used to determine deletion of the FOXP3 gene in the prostate cancer tissue. The FISH was carried out as previously described (Zou et al., 2007, supra). Briefly, the FISH for FOXP3 deletion was done using BAC clone RP1 1-344014 (ntLocus X: 48,817,975-48,968,223), which was verified by PCR to contain the FOXP3 gene, using TMA and frozen samples. 23 of 145 samples (16%) tested show deletion of FOXP3 gene. Among them, 18/23 case have a single copy of X chromosome. However, 5/23 showed an increase in the number of X-chromosomes. In cells with X polysomy and FOXP3 deletion, FOXP3 deletion was complete in all X-chromosomes. Thus, X-chromosome duplications likely occurred after deletion of FOXP3.
Example 18 Somatic Mutations in Prostate Cancer Functionally Inactivate FOXP3In order to determine whether FOXP3 was somatically mutated in primary prostate cancer samples, cancerous and normal prostate tissues were isolated from the same patients and were compared to the DNA from exons and some exon-intron junction.
DNA samples from cancerous and benigne tissues dissected from 20 cases of prostate cancer tissues were amplified by PCR and sequenced. The somatic mutants were identified by comparing DNA sequence of normal and cancerous tissues from the same section. More specifically, both normal and malignant prostate tissues were isolated from frozen section under LCM. Genomic DNA was extracted from microdissected cells using PicoPure DNA Isolation kit (Molecular Devices, Sunnyvale, Calif.). Somatic mutations were identified by comparing FOXP3 sequences of cancerous tissue to those of normal tissues from the same patients. All DNA were isolated from frozen tissues and were amplified by PCR. The bulk PCR products were sequenced from both forward and reverse directions. The sequencing was repeated at least twice from independent PCR reactions. The mutated PCR products were cloned and 5-10 clones were sequenced to confirm these mutations.
The sequencing analyses demonstrate single base-pair changes in 5/20 samples tested. Among them, four were missense mutations (V97A, N1961, G203R, and K227R) while one caused a change in intron 6. The tumors with intron 6 mutation showed reduced expression of FOXP3.
Since WT FOXP3 suppressed the growth of prostate cancer cell lines, a colony growth assay (described in Example 16) was used to determine the effect of mutation. All of the missense mutations abrogated growth inhibition by FOXP3.
The cMYC promoter-luciferase gene vectors (pGL2-CMYC) were constructed by pGL2 vector with DNA fragments in promoter region of CMYC. HEK 293 cells were plated at a density of 5×104 cells per well into 24-well plates and then transiently co-transfected using FuGene 6 (Roche, Indianapolis, Ind.) with pGL2-cMYC luciferase reporter vector (Promega, Madison, Wis.) and pEF1-FOXP3 vector (Invitrogen, Carlsbad, Calif.) (1:2 ratio) according to the protocol of the manufacturer. After transient transfections for 48 h, cells were washed twice with ice-cold PBS and were lysed by 1× Lyses buffer (Promega, Madison, Wis.) for 15 min on shaker. The luciferase activity was performed on a Veritas Microplate Luminometer (Turner BioSystems, Sunnyvale, Calif.) using a Dual Luciferase Assay System (Promega, Madison, Wis.). The experiments were performed at least three times.
Site-Directed Mutagenesis of cMYC Promoter-Luciferase Reporter Plasmid was prepared following the protocols from GeneTailor Site-Directed Mutagenesis System (Invitrogen, Carlsbad, Calif.). The mutagenesis primers are shown in Supplement Table S2. The FOXP3 binding motif sequence (-195 to -189: TGTTTAC (SEQ ID NO: 180)) in the CMYC promoter construct was mutagenized to generate mutated sequence (AAAAGGG (SEQ ID NO: 181)) or the binding motif deletion.
In addition, all of the mutants show 50-95% reduction in their ability to repress MYC promoter. Therefore, the data demonstrated that somatic mutations uncovered from prostate cancer samples caused the FOXP3 protein to be less active.
Example 19 Lineage-Specific Ablation of FoxP3 Expression Resulted in MYC Expression in the MouseTo test the cell-intrinsic effect of FoxP3 deletion, the mice with floxed FoxP3 allele (Fontenot et al., Immunity 22: 329-341(2005)) were crossed to a transgenic line that express Cre gene under the probasin promoter (Wu et al., Nat Genetics 20: 175-179 (1998)). The previous studies have demonstrated that this promoter causes prostate-specific deletion of Floxed genes, detectable starting in the new born mice.
Using microdissected tissue samples of 14-16 weeks old mice, more than 80% deletion of the FOXP3 locus was observed. Correspondingly, the FOXP3 mRNA was reduced by more than 16-fold. The more profound reduction in mRNA levels likely reflect the fact that our micro-dissected samples also contain non-epithelial cells. Importantly, tissue-specific deletion of FoxP3 lead to more than 4-fold reduction of MYC transcripts. Since the tissues were harvested prior to any sign of hyperplasia, it is likely that deletion of FoxP3 gene directly lead to activation of the MYC locus in mouse prostate epithelial cells. Moreover the fact that MYC up-regulation occurred prior to pathological alteration in the prostate epithelia is consistent with the notion that upregulation of MYC is the primary effect of the FoxP3 gene deletion.
The progression of prostate cancer in the TRAMP model was measured by MRI as described in Eng et al., Urology 54: 1112-1119 (1999). Briefly, MRI experiments were performed on a Varian system equipped with a 7.0-Tesla, 18.3-cm horizontal bore magnet (300-MHz proton frequency). For MRI examination, the mice were anesthetized with sodium pentobarbital (70 mg/kg intraperitoneally) and maintained at 37° C. inside the magnet using a heated circulation water blanket, with pelvis motion (due to respiration) minimized by a small plastic support placed before insertion into a 3-cm diameter quadrature birdcage coil (USA Instruments). Multislice images were acquired using a T1-weighted spin echo sequence (TR/TE=880/13, field of view=30×30 mm using a 128×128 matrix, slice thickness=1.5 mm, and slice separation=1.0 to 1.6 mm.). Each set contained 9 to 25 slices and enough sets were obtained to provide contiguous image data of the prostate tumor. Prostate volume was measured using the formula V=4/3[(D1+D2)/4]3π, where D1 and D2 corresponds to the longest and shortest (transverse and sagittal) diameter measured from the MRI image, respectivly. The accuracy of this measurement was confirmed by comparing prenecropsy MRI volumes to postnecropsy actual prostate volumes in select cases.
16-18 weeks-old mice with prostate-specific deletion of the FoxP3 locus had significant enlargement of the prostate. Histological examination of prostate tissue of WT and cKO 23≈26 weeks old mice indicated extensive hyperplasia in the mutant mice, with a 5-fold higher increase in the % of Ki67+ proloiferating epithelial cells in the mutant mice in compared to the WT. More importantly, the focus of carcinoma was readily identified in all 5 mutant mice examined but not in 6 WT control mice. Many loci showed disruption of basal membrane, which indicated that microinvasion had occurred. In rare cases, vascular invasion was identified in the mutant mice. Therefore, targeted mutation of the FoxP3 gene in the prostate tissue was sufficient to initiate the process of cancer development.
Example 20 p21 is Upregulated after FOXP3 Induction and Contributes to its Tumor Suppressor ActivityAlthough FOXP3 has been shown to repress transcriptional activity of oncogenes, it was hypothesized the FOXP3 could induce the transcription of a tumor suppressor gene. To test this hypothesis, cells of the MCF-7-pBI-FOXP3/GFP cell line were cultured in medium lacking doxycylcine. 24 hours later, cells were collected at 0, 24, 36, 48, 72, and 96 hours. Cells were then measured for FOXP3 expression by realtime-PCR and Western blotting. FOXP3 was induced in the MCF-7-pBI-FOXP3/GFP cell line, but not the MCF-7-pBI-GFP/control cell line. Importantly, induction of FOXP3 expression by removal of doxycyline from the medium caused a rapid and progressive induction of p21 transcript, as determined by real-time PCR. This induction also was reflected at the protein levels by the Western blots.
Example 21 p21 Contribute to the Tumor Suppressor Activity of FOXP3In order to determine whether induction of p21 contributes to tumor suppression, MCF-7 cells with inducible expression of either FOXP3 or GFP were supertransfected with either vector control or shP21. After removing untransfected cells by drug selection, the cultures were maintained in doxycycline-free conditions for 10 days. The dead cells were removed and the plates were stained with violet crystal. The colony numbers was counted under a microscope.
p21 shRNA increased the number of colonies in the cell line that expressed FOXP3 by about 20-fold, but barely so for the control cell line expressing GFP only. The sizes of colonies were usually larger in the shRNA group, even for those that expressed GFP only, consistent with the notion that endogenous p21 in the MCF-7 cells limited its growth potential. The partial restoration of the colonies indicated that P21 induction contribute to the tumor suppressor activity of the FOXP3 gene.
Example 22 Inactivation of the FoxP3 Locus Resulted in Increased Skp2 ExpressionTo determine whether FOXP3 represses Skp2 expression, normal and cancerous mammary tissues were stained with anti-Skp2 and anti-p27 antibodies. As shown in FIG. 1A of Zuo et al., J Clin Invest 117: 3765-3773 (2007), Skp2 was found to be highly expressed in cancer cells, but not in normal epithelial cells from the same mouse.
To quantify the increases in Skp2 transcripts, cells were isolated from frozen sections by laser micro-dissection and mRNA were extracted for real-time RT-PCR analysis. The expression of Skp2 in normal mammary epithelial cells from either WT or FoxP3sf/+ mice, as well as mammary cancer tissues from mutant mice, were compared. As shown in FIG. 1B of Zuo et al., J Clin Invest 117: 3765-3773 (2007), in comparison to the WT epithelial cells, the heterozygous epithelial cells expressed two-fold higher levels of Skp2, which suggests a FoxP3 gene dose effect on the levels of Skp2. Moreover, in the cancerous tissue that silenced the wild-type allele, expression of Skp2 was substantially enhanced.
A potential caveat of this interpretation is that up-regulation of SKP2 may be due to cancer rather than to the silencing of the FoxP3 locus. Although the WT mice had lower incidences and later onsets of mammary cancer than the heterozygous mice, cancer did arise, both spontaneously and in response to carcinogen treatment. Thus, by comparing mouse mammary cancer tissues from WT and FOXP3sf/+ mice for expression of Skp2, one may be able to discern the contribution of FoxP3 mutation vs. the non-specific effect of cancer growth. As shown in Table 1 of Zuo et al., J Clin Invest 117: 3765-3773 (2007), 80% of the spontaneous cancers in the WT mice did not over-express Skp2. In contrast, 71% of the spontaneous tumors from the FoxP3f/+ mice did. A similar trend was observed in the carcinogen induced mammary tumors. Thus, inactivation of the FOXP3 locus is likely responsible for increased Skp2 expression in the mammary tumors.
Example 23 FoxP3 as a Transcriptional Repressor of Skp2Since FoxP3 is a transcription factor capable of repressing or promoting the expression of a large cohort of genes, whether Skp2 can be a direct target of FoxP3 was evaluated. A mouse mammary cancer line, TSA, was transfected with the V5-targeted FoxP3 protein and generated a polyclonal FOXP3-V5 CL30 and two subclones CL302 and CL305. Using real-time PCR analysis, it was found that the CL302 and 305 have approximately 5-fold higher FoxP3 transcript than the CL30 line. Skp2 transcripts were found to decrease by around 10-20-fold in the FOXP3-V5 transfectant line or clones compared with the vector control. The extent of reduction correlates with the FoxP3 transcript levels. In contrast, no changes in p27 mRNA levels were detected. Since Skp2 regulates the degradation of p27, the levels of these two proteins in FOXP3-V5 transfectants were also examined. As shown in FIG. 2B of Zuo et al., J Clin Invest (2007), supra, FoxP3 transfection dramatically reduced Skp2. Correspondingly, p27 was significantly increased in the FOXP3-V5 transfectant. To deter whether the increase of p27 was caused by more rapid degradation, vector or FoxP3-V5-transfected TSA cells were treated with cycloheximide (CHX) and the levels of p27 at 0, 1, 2 and 4 hours after treatment were measured by Western blot. As shown in FIG. 2C of Zuo et al., J Clin Invest (2007), supra, p27 was degraded at a much faster rate in the vector transfected TSA cells. Consistent with this notion, reduced ubiquination of p27 in the FoxP3-transfected cells was observed (FIG. 2D of Zuo et al., J Clin Invest (2007), supra).
To further confirm that the down-regulation of Skp2 by FOXP3 occurred at the transcription level, the 2.0 kb upstream of the murine Skp2 gene was cloned into the luciferase reporter vector pGL2 and tested the effects of FOXP3 of this promoter's activity by luciferse assay. As shown in FIG. 3A of Zuo et al., J Clin Invest (2007), supra, FOXP3 substantially repressed the promoter activity of the Skp2 gene.
Analysis of the Skp2 promoter revealed 4 potential binding sites within the 2 Kb promoter region (FIG. 3B of Zuo et al., J Clin Invest (2007), supra). Chromatin immunoprecipitation (ChIP) was carried out to determine whether the FoxP3 binds to the promoter. The nuclear preparations from the FoxP3-transfected cells were fixed with paraformaldehyde. After sonication, the FoxP3-associated genomic DNA was immunoprecipitated and quantitated by real-time PCR. To avoid artifacts associated with differential amplification, the quantity of precipitated DNA was compared to the total input genomic DNA, amplified by the same pairs of primers. In addition, the small amount of DNA precipitated by the IgG control was subtracted. As shown in FIG. 3B of Zuo et al., J Clin Invest., 2007, supra, the primers corresponding to the −0.8 Kb and -1.2 Kb regions yielded significant amounts of product, which is equal to 5-6% of input DNA. In contrast, those corresponding to either the −2.2 or +0.6 Kb region yielded no specific signal.
To determine the significance of the interaction, whether deletion of either binding site disrupts the repression of promoter activity by FoxP3 was tested. As shown in FIG. 3C of Zuo et al., J Clin Invest., 2007, supra, while the WT promoter was repressed by FoxP3, deletion of either site eliminated the repression. Thus, data presented in this section demonstrate that the binding of FoxP3 to specific sites in the Skp2 promoter is essential for FoxP3 repression of Skp2 expression.
Example 24 FoxP3 Expression caused Polyploidy of Breast Cancer Cell LinesThe % of cells with polyploidy can be used as a valuable parameter for Skp2 function. A FoxP3-transfected TSA cell line with moderate levels of the FoxP3-V5 protein was chosen to test the effect of FoxP3 expression (FIG. 4A upper panel of Zuo et al., J Clin Invest., 2007, supra) on the cellular function of Skp2 in order to avoid possible artifacts associated with over-expression. Real-time PCR revealed that the levels of FoxP3 transcripts in the stable transfectants is about 4.5 fold that of the ex vivo mammary epithelial isolates after normalizing against Ck19 transcripts (FIG. 4A, lower panel of Zuo et al., J Clin Invest., 2007, supra). Since not all mammary epithelial cells express FoxP3, the difference between the transfectants and physiological levels of normal cells is likely to be even smaller. As shown in FIG. 4B of Zuo et al., J Clin Invest., 2007, supra, only slightly more than 50% of the transfectants had demonstrable levels of the FoxP3-V5 fusion protein. This allowed for the comparison of the DNA contents of the FoxP3hi and FoxP31o subsets from the same culture, and of control vector transfectants. As shown in FIG. 4B right panels of Zuo et al., J Clin Invest., 2007, supra, less than I% of the control vector transfected cells had >4C DNA content, as expected. The same pattern was observed in the FoxP31o subset from the FoxP3 transfectants. In contrast, about 25% of the FoxP3hi cells had >4C DNA contents.
To determine whether the polyploidy can be attributed to down-regulation of Skp2, the Skp2 cDNA was ectopically expressed in the FoxP3-V5-transfects. As shown in FIG. 4C of Zuo et al., J Clin Invest., 2007, supra, the ectopic expression of Skp2 significantly reduced the % of cells with polyploidy. These data demonstrate that by suppressing Skp2 expression, FoxP3 has a very significant impact on cell cycle progression.
Example 25 FoxP3 and SKP2 Expression in Normal and Malignant Human Breast epithelial CellsA critical issue is whether FoxP3 expression regulates SKP2 in human breast epithelial cells. To substantiate that inactivation of FOXP3 is a primary event leading to over-expression of SKP2, the early passage of normal human mammary epithelial cells (HMEC) was transduced with lentiviral vector encoding siRNA specific for FOXP3 or control lentiviral vector. The un-transduced cells were eliminated by blasticidin. As shown in FIG. 5A of Zuo et al., J Clin Invest., 2007, supra, the FOXP3 siRNA transduction caused a more than 100-fold reduction in the FOXP3 transcript. Corresponding to this, a 4-fold increase of the SKP2 transcripts was observed (FIG. 5B of Zuo et al., J Clin Invest., 2007, supra). These data demonstrate that in human mammary epithelial cells, FOXP3 is an important regulator for the SKP2 gene.
To identify FOXP3 targets in malignant breast epithelial cells, cell lines with the inducible expression of FOXP3 were produced from MCF-7, a human mammary cancer cell line that does not over-express the HER-2 oncogene, as diagramed in FIG. 6A of Zuo et al., J Clin Invest., 2007, supra. The expression of SKP2 was analyzed at different time points after the cells were cultured in the absence of deoxycyclin, which induced the expression of FOXP3. The levels of SKP2 were quantitated by real-time PCR and were compared with control cell lines expressing GFP but not FOXP3 under the same conditions. The relative levels of the SKP2 transcripts of the control cell lines and the FOXP3 expressing cells at different times are presented in FIG. 6B of Zuo et al., J Clin Invest., 2007, supra. Using the levels of un-induced cells as references, nearly a 4-fold reduction of SKP2 mRNA was observed within 24 hours of removing deoxycyclin in the FOXP3-transfectants. By 48 hours more than an 8-fold reduction was observed. No reduction of SKP2 transcript was observed in control cell lines cultured under the same condition. These data demonstrate a rapid repression of the SKP2 transcripts following FOXP3 induction.
It is shown herein that the FOXP3 locus is frequently inactivated in the majority of, although not all, mammary cancer tissues in humans. On the other hand, SKP2 is over expressed in nearly 50% of the breast cancer samples. If a loss of FOXP3 contributes to SKP2 expression, one may expect an increased rate of the SKP2+ samples among the FOXP3− tumors. To address this issue, 206 cases of breast cancer samples in tissue microarray were independently stained and double blindly scored for their expression of SKP2 and FOXP3. As shown in FIG. 7 of Zuo et al., J Clin Invest (2007), supra, among the FOXP3+ samples, less than 30% of the cells expressed SKP2. In contrast, more than 56% of the FOXP3− samples showed SKP2 over-expression. Statistical analysis revealed that the difference is highly significant (P=0.0016).
Example 26 The Ectopic Expression of SKP2 Bypass FOXP3-Mediated Growth inhibition for a HER-21o Breast Cancer Cell LineAs demonstrated herein, FOXP3 can suppress the growth of both ErbB2hi and ErbB21o tumor cell lines. While the repression of ErbB2hi tumor cell line TSA can be rescued by the ectopic expression of ErbB2, the target responsible for growth inhibition of the ErbB21o tumor cells remained to be identified. To determine the relevance of SKP2 repression in growth inhibition by FOXP3, either vector or SKP2 was ectopically expressed in the MCF7 cell line with tet-off inducible expression of FOXP3. The impact of the SKP2 expression was visualized by colony formation following tet-off induction of FOXP3. As shown in FIG. 8 of Zuo et al., J Clin Invest (2007), supra, in the vector transfected group, Tet-off induction of FOXP3 wiped out all MCF7 colonies, as expected. Remarkably, ectopic expression of SKP2 resulted in almost complete restoration of the colonies (FIG. 8A of Zuo et al., J Clin Invest (2007), supra), although the colony size is still somewhat less than the culture without FOXP3 induction (FIG. 8B of Zuo et al., J Clin Invest (2007), supra). These results demonstrate a critical role of SKP2 down-regulation in the ErbB21o breast cancer cell line.
The foregoing description is given for clearness of understanding only, and no unnecessary limitations should be understood therefrom, as modifications within the scope of the invention may be apparent to those having ordinary skill in the art.
All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
The use of the terms “a” and “an” and “the” and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
Claims
1. A method of reducing tumor growth, said tumor comprising a breast cancer cell, a prostate cancer cell, or a thymic epithelial cancer cell, which cancer cell is sensitive to FOXP3 tumor suppressor activity in a subject, comprising administering directly to the cancer cell a recombinant expression vector comprising (i) a nucleic acid encoding a FOXP3 protein and (ii) a promoter sequence active in the cancer cell, wherein the promoter sequence is operably linked to said nucleic acid, wherein expression of said nucleic acid is in an amount effective to reduce tumor growth in the subject.
2. The method of claim 1, wherein the nucleic acid encodes a FOXP3 protein comprising the amino acid sequence of any of SEQ ID NOs: 20 to 26 and 28 to 36.
3. The method of claim 1, wherein the nucleic acid comprises the nucleotide sequence of any of SEQ ID NOs: 1 to 7 and 9 to 17.
4. The method of claim 1, wherein the subject is a mammal.
5. The method of claim 4, wherein the mammal is a human.
6. The method of claim 1, wherein the method effectively reduces metastasis of the cancer cell.
7. The method of claim 1, wherein the method further effectively increases survival of the subject.
8. The method of claim 1, wherein the method effectively increases apoptosis of the cancer cell.
9. The method of claim 1, wherein the method effectively increases killing of the cancer cell in said tumor.
| 5449752 | September 12, 1995 | Fujii et al. |
| 20030170648 | September 11, 2003 | Khattri et al. |
| 0612728 | August 1994 | EP |
| WO-2004/022104 | March 2004 | WO |
| WO-2006/138478 | December 2006 | WO |
- Karanikas et al (J Transl Med, 6: 19: 1-8).
- Voskoglou-Nomikos et al (Clinical Cancer Research, 2003, 9, 4227-4239).
- Kelland et al (European Journal of Cancer, 2004, 40, 827-836).
- Merlo et al (J Clin Oncol, 27(1): 1746-1752, 2009).
- International Preliminary Report of Patentability, PCT/US2008/063419, dated Nov. 17, 2009.
- ASHP Handbook on Injectable Drugs, 4th ed., pp. 622-630 (1986).
- Banker et al. (Eds.),Pharmaceutics and Pharmacy Practice. J. B. Lippincott Company, Philadelphia, PA. 238-50 (1982).
- Bennett et al., The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat. Genet. 27: 20-1 (2001).
- Brunkow et al., Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat. Genet. 27: 68-73 (2001).
- Eng et al., Early castration reduces prostatic carcinogenesis in transgenic mice. Urology. 54: 1112-9 (1999).
- Fontenot et al.. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat. Immunol. 4: 330-6 (2003).
- Garcia de Palazzo et al., Immunohistochemical detection of c-erbB-2 expression by neoplastic human tissue using monospecific and bispecific monoclonal antibodies. Int. J. Biol. Markers. 8: 233-9 (1993).
- Kelly et al., The role of c-myc in the proliferation of normal and neoplastic cells. J. Clin. Immunol. 5: 65-77 (1985).
- Maguire et al., The neu (c-erbB-2) oncogene. Semin. Oncol. 6: 148-55 (1989).
- Nakayama et al., Ubiquitin ligases: cell-cycle control and cancer. Nat. Rev. Cancer. 6: 369-81 (2006).
- Piao et al., Frequent loss Xq25 on the inactive X chromosome in primary breast carcinomas is associated with tumor grade and axillary lymph node metastasis. Genes Chromosomes Cancer. 33: 262-9 (2002).
- Roncuzzi et al., Loss of heterozygosity at pseudoautosomal regions in human breast cancer and association with negative hormonal phenotype. Cancer Genet. Cytogenet. 135: 173-6 (2002).
- Schechter et al., The neu oncogene: an erb-B-related gene encoding a 185,000-Mr tumour antigen. Nature. 312: 513-6 (1984).
- Spatz et al., X-chromosome genetics and human cancer. Nat. Rev. Cancer, 4: 617-29 (2004).
- Todorovic-Rakovic et al., Comparison between immunohistochemistry and chromogenic in situ hybridization in assessing HER-2 status in breast cancer. Pathol. Int. 55: 318-23 (2005).
- Wildin et al., X-linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy. Nat. Genet. 27: 18-20 (2001).
- Wooster et al., Identification of the breast cancer susceptibility gene BRCA2. Nature. 378: 789-92 (1995).
- Xu e al., Evidence for a prostate cancer susceptibility locus on the X chromosome. Nat. Genet. 20: 175-9 (1998).
- Ziegler, FOXP3: of mice and men. Annu. Rev. Immunol. 24: 209-26 (2006).
- Zuo et al., FOXP3 is a novel transcriptional repressor for the breast cancer oncogene SKP2. J. Clin. Invest. 117: 3765-73 (2007).
- Bofin et al., Detection and quantitation of HER-2 gene amplification and protein expression in breast carcinoma. Am. J. Clin. Pathol. 122: 110-9 (2004).
- Chang et al., The Scurfy mutation of FoxP3 in the thymus stroma leads to defective thymopoiesis. J. Exp. Med. 202: 1141-51 (2005).
- Chatila et al., JM2, encoding a fork head-related protein, is mutated in X-linked autoimmunity-allergic disregulation syndrome. J. Clin. Invest. 106: R75-81 (2000).
- Chen et al., Cutting edge: Broad expression of the FoxP3 locus in epithelial cells: a caution against early interpretation of fatal inflammatory diseases following in vivo depletion of FoxP3-expressing cells. J. Immunol. 180: 5163-6 (2008).
- Dai et al., Evolving gene/transcript definitions significantly alter the interpretation of GeneChip data. Nucl. Acids Res. 33: e175 (2005).
- de Felipe, Skipping the co-expression problem: the new 2A “CHYSEL” technology. Genet. Vaccines and Ther. 2: 13 (2004).
- Floess et al., Epigenetic control of the foxp3 locus in regulatory T cells. PLOS. Biol. 5: e38 (2007).
- Fontenot et al., Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity. 22: 329-41 (2005).
- Godfrey et al., Fatal lymphoreticular disease in the scurfy (sf) mouse requires T cells that mature in a sf thymic environment: potential model for thymic education. Proc. Natl. Acad. Sci. USA. 88: 5528-32 (1991).
- Godfrey et al., Transplantation of T cell-mediated, lymphoreticular disease from the scurfy (sf) mouse. Am. J. Pathol. 145: 281-6 (1994).
- Jimenez et al., Determination of Her-2/Neu status in breast carcinoma: comparative analysis of immunohistochemistry and fluorescent in situ hybridization. Mod. Pathol. 13: 37-45 (2000).
- Kallioniemi et al., ERBB2 amplification in breast cancer analyzed by fluorescence in situ hybridization. Proc. Natl. Acad. Sci. USA. 89: 5321-5 (1992).
- Kim et al., CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. J. Exp. Med. 204: 1543-51 (2007).
- Knudson, Mutation and cancer: statistical study of retinoblastoma. Proc. Natl. Acad. Sci. USA. 68: 820-3 (1971).
- Kristiansen et al., High incidence of skewed X chromosome inactivation in young patients with familial non-BRCA1/BRCA2 breast cancer. J. Med. Genet. 42: 877-80 (2005).
- Miki et al., A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science. 266: 66-71 (1994).
- Reimold et al., Chondrodysplasia and neurological abnormalities in ATF-2-deficient mice. Nature. 379: 262-5 (1996).
- Richardson et al., X chromosomal abnormalities in basal-like human breast cancer. Cancer Cell. 9: 121-32 (2006).
- Samuels et al., High frequency of mutations of the PIK3CA gene in human cancers. Science. 304: 554 (2004).
- Slamon et al., Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science. 235: 177-82 (1987).
- Slamon et al., Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N. Engl. J. Med. 344: 783-92 (2001).
- Wang et al., Control of inducible chemoresistance: enhanced anti-tumor therapy through increased apoptosis by inhibition of NF-kappaB. Nat. Med. 5: 412-17 (1999).
- Weinstein, Cancer. Addiction to oncogenes—the Achilles heal of cancer. Science. 297: 63-4 (2002).
- Wooster, Breast and ovarian cancer. N. Engl. J. Med. 348: 2339-47 (2003).
- Xing et al., The ets protein PEA3 suppresses HER-2/neu overexpression and inhibits tumorigenesis. Nat. Med. 6: 189-95 (2000).
- Yaziji et al., HER-2 testing in breast cancer using parallel tissue-based methods. JAMA. 291: 1972-7 (2004).
- Genbank accession No. EF419427, Felis catus FoxP3 mRNA, complete cds, released Feb. 28, 2007.
- Genback accession No. ABN79272, FoxP3 [Felis catus], released Feb. 28, 2007.
- Genbank accession No. DQ387959, Mus musculus scurfin (Foxp3) mRNA, complete cds, released Feb. 28, 2007.
- Genbank accession No. ABD52722, scurfin [Mus musculus], released Feb. 28, 2007.
- Genbank accession No. DQ322170, Bos taurus forkhead/winged helix transcription factor 3 (Foxp3) mRNA, complete cds, released Jan. 15, 2006.
- Genbank accession No. ABC59848, forkhead/winged helix transcription factor 3 [Bos taurus], released Jan. 15, 2006.
- Genbank accession No. AY841945, Peromyscus maniculatus forkhead box P3 (Foxp3) mRNA, partial cds, released Dec. 26, 2004.
- Genbank accession No. DQ010327, Homo sapiens forkhead box P3 (FOXP3) mRNA, complete cds, alternatively spliced, released May 10, 2005.
- Genbank accession No. AAY27088, forkhead box P3 [Homo sapiens], released May 10, 2005.
- Genbank accession No. NM—001045933, Bos taurus forkhead box P3 (FOXP3), mRNA, released May 10, 2005.
- Genbank accession No. AY357713, Mus musculus strain NOD/LtJ forkhead box P3 (Foxp3) mRNA, complete cds, released Jan. 1, 2004.
- Genbank accession No. AAR11306, forkhead box P3 [Mus musculus], released Jan. 1, 2004.
- Genbank accession No. AY357712, Mus musculus strain C57BL/6 forkhead box P3 (Foxp3) mRNA, complete cds, released Jan. 1, 2004.
- Genbank accession No. AAR11305, forkhead box P3 [Mus musculus], released Jan. 1, 2004.
- Genbank accession No. AY376065, Macaca fascicularis foxp3 mRNA, complete cds, released Sep. 22, 2003.
- Genbank accession No. AAQ82647, foxp3 [Macaca fascicularis], released Sep. 22, 2003.
- Genbank accession No. AF277994, Mus musculus scurfin (Foxp3) gene, complete cds, released Jan. 24, 2001.
- Genbank accession No. AAG53608, scurfin [Mus musculus], released Jan. 24, 2001.
- Genbank accession No. AF277993, Homo sapiens scurfin (FOXP3) mRNA, complete cds, released Aug. 8, 2005.
- Genbank accession No. AAG53607, scurfin [Homo sapiens], released Aug. 8, 2005.
- Genbank accession No. AF277992, Mus musculus scurfin (Foxp3) mRNA, complete cds; alternatively spliced, released Aug. 18, 2005.
- Genbank accession No. AAG53606, scurfin [Mus musculus], released Aug. 18, 2005.
- Genbank accession No. NM—054039, Mus musculus forkhead box P3 (Foxp3), mRNA, released Aug. 18, 2005.
- Genbank accession No. NP—473380, forkhead box P3 [Mus musculus], released Aug. 18, 2005.
- Genbank accession No. AF277991, Mus musculus scurfin (Foxp3) mRNA, complete cds; alternatively spliced, released Aug. 18, 2005.
- Genbank accession No. AAG53605, scurfin [Mus musculus], released Aug. 18, 2005.
- Genbank accession No. AAW28860, forkhead box P3 [Peromyscus maniculatus], released Dec. 26, 2004.
- Nucleotide GSS submission: DQ045675, Pan troglodytes FOXP3 gene, Virtual Transcript, partial sequence, genomic survey sequence, released Jun. 2, 2005.
- Nucleotide GSS submission: DQ045674, Homo sapiens FOXP3 gene, Virtual Transcript, partial sequence, genomic survey sequence, released Jun. 2, 2005.
- Genbank accession No. NC—000023, Homo sapiens chromosome X, reference assembly, complete sequence, released Aug. 29, 2002.
- Genbank accession No. BQ184335.1, Homo sapiens cDNA clone, mRNA sequence, released Apr. 30, 2002.
- Genbank accession No. DB342786.1, DB342786 THYMU2 Homo sapiens cDNA clone THYMU2005410 3-, mRNA sequence, released Oct. 21, 2005.
- Genbank accession No. NM—014009, Homo sapiens forkhead box P3 (FOXP3), transcript variant 1, mRNA—curated from Genbank accession Nos. AF277993, BQ184335.1, and DB342786.1, Jul. 12, 2011.
- Genbank accession No. NP—054728, Homo sapiens forkhead box P3 (FOXP3)—protein sequence translation of Genbank accession No. NM—014009, Jul. 12, 2011.
- Genbank accession No. NM—001032918, Macaca mulatta forkhead box P3 (FOXP3), mRNA, released Sep. 28, 2004.
- Genbank accession No. XP—001143169, Predicted: forkhead box P3 [Pan troglodytes], released Dec. 6, 2003.
- Genbank accession No. XM—001143169, Predicted: Pan troglodytes forkhead box P3 (FOXP3), mRNA, released Dec. 6, 2003.
- Banham et al., FOXP1 a novel candidate tumor suppressor gene on chromosome 3p. Cancer Detection Prevent. (2000).
- Bennett et al., The immune dysregulation, polydocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nat. Genet. 27: 20-1 (2001).
- Bovenzi et al., Antineoplastic antion of 5-aza-2′deoxycytidine and histone deacetylase inhibitor and their effect on the expression of retinoic acid receptor beta and estrogen receptor alpha genes in breast carcinoma cells. Cancer Chemother. Pharmacol. 48: 71-6 (2001).
- Gupta et al., Expression of FOXP3 and vascular endothelial growth factor in human breat cancer: Its correlation with angiogenesis and disease progression. EJC Supplements. 4: 126 (2006).
- Katoh et al., Human FOX gene family (Review). International J. Oncol. 25: 1495-1500 (2004).
- Mastrangelo et al., A phase I study of emetine hydrochloride (NSC 33669) in solid tumors. Cancer May 1973. 31: 1170-5 (1973).
- Zuo Tao et al., FOX3 is an X-linked breast cancer suppressor gene and an important repressor of the HER-2/ErbB2 oncogene. Cell. 129: 1275-86 (2007).
- Zuo Tao et al., FOXP3 is a novel transcriptional repressor for the breast cancer oncogene SKP2. J. Clin. Invest. 117: 3765-73 (2007).
- International Search Report, European Patent Office, PCT/US2008/063419, dated Feb. 13, 2009.
Type: Grant
Filed: May 12, 2008
Date of Patent: Apr 17, 2012
Patent Publication Number: 20090325868
Assignee: The Regents of the University of Michigan (Ann Arbor, MI)
Inventors: Yang Liu (Ann Arbor, MI), Pan Zheng (Ann Arbor, MI), Xing Chang (Ann Arbor, MI), Lizhong Wang (Ann Arbor, MI), Runhua Liu (Ann Arbor, MI), Yin Wang (Ann Arbor, MI), Yan Liu (Ann Arbor, MI), Tao Zuo (Columbus, OH)
Primary Examiner: Thaian N Ton
Assistant Examiner: Magdalene Sgagias
Attorney: Marshall, Gerstein & Borun LLP
Application Number: 12/119,158
International Classification: A61K 48/00 (20060101); A01N 63/00 (20060101);