DNA encoding the 15 kD outer membrane protein of Haemophilus influenzae
Murine monoclonal antibodies directed against a novel outer membrane protein (OMP) of Haemophilus influenzae have been isolated and characterized. The gene encoding of the outer membrane protein has also been isolated and characterized. Portions of the DNA sequence of the 15 kD OMP gene are useful as probes to diagnose the presence of Haemophilus influenzae in samples. These DNA's also make available polypeptide sequences of immunoreactive epitopes encoded within the gene, thus permitting the production of polypeptides which are useful as standards or reagents in diagnostic tests and/or as components of vaccines. Monoclonal antibodies directed against epitopes of the 15 kD OMP are also useful for diagnostic tests and as therapeutic agents for passive immunization.
1. Field of the Invention
This invention relates to the 15 kD outer membrane protein of Haemophilus influenzae type b and nontypable Haemophilus influenzae.
For the sake of simplicity, Haemophilus influenzae is hereinafter referred to as H. influenzae.
2. Discussion of the Prior Art
Haemophilus influenzae type b is a major cause of meningitis and other invasive bacterial diseases in children under the age of five. Efficacious vaccines have been produced. The vaccines contain the type b capsular polysaccharide conjugated to a carrier protein. Nontypable H. influenzae cause surface mucosal infections in children and adults. Such organisms also cause invasive disease in children in the developing world and immunocompromised patients. The vaccines which have been developed to prevent disease due to type b organisms are not effective against nontypable H. influenzae.
SUMMARY OF THE INVENTIONOuter membrane proteins elicit antibodies which are protective in animal models and therefore should be considered as components in the next generation of vaccines designed to prevent both serotype b and nontypable Haemophilus disease.
The object of the invention is to clone the gene for this H. influenzae protein, and to determine the DNA sequence thereof.
Accordingly, the present invention relates to a recombinant polynucleotide comprising a nucleotide sequence for the 15 kD protein of Haemophilus influenzae type b and nontypable Haemophilus influenzae, said protein having the amino acid sequence as follows:
10 20 30 40 50 60 GATCCCACCTTGTTTATTCCAATAATGGAACTTTATTTTATTAAAGGTATCTAAGTAGCA 70 80 90 100 110 120 CCCTATATAGGGATTAATTAACGAGGTTTAATAATGAACTTTAACTAAAATTTTACCAGC 130 140 150 160 170 180 ATTTGCTGCTGTAGTCTGTATTATCTGCTTGTGCAAAGGATGCACCTGAAATGACAAAAT MetThrLysS 190 200 210 220 230 240 CATCTGCGCAAATAGCTGAAATGCAAACACTTCCAACAATCACTGATAAAACAGTTGTAT erSerAlaGlnIleAlaGluMetGlnThrLeuProThrIleThrAspLysThrValValT 250 260 270 280 290 300 ATTCCTGCAATAAACAAACGGTGACTGCTGTGTATCAATTTGAAAACCAAGAACCAGTTG yrSerCysAsnLysGlnThrValThrAlaValTyrGlnPheGluAsnGlnGluPrnValA 310 320 330 340 350 360 CTGCAATGGTAAGTGTGGGCGATGGCATTATTGCCAAAGATTTTACTCGTGATAAATCAC laAlaMetValSerValGlyAspGlyIleIleAlaLysAspPheThrArgAspLysSerG 370 380 390 400 410 420 AAAATGACTTTACAAGTTTCGTTTCTGGGGATTATGTTTGGAATGTAGATAGTGGCTTAA lnAsnAspPheThrSerPheValSerGlyAspTyrValTrpAsnValAspSerGlyLeuT 430 440 450 460 470 480 CGTTAGATAAATTTGATTCTGTTGTGCCTGTCAATTTAATTCAAAAAGGTAAATCTAGCG hrLeuAspLysPheAspSerValValProValAsnLeuIleGlnLysGlyLysSerSerA 490 500 510 520 530 540 ATAATATCATCGTCAAAAATTGTGATGTAAACGTAAAAGCAACTAAAAAAGCAAATTTAT spAsnIleIleValLysAsnCysAspValAsnValLysAlaThrLysLysAlaAsnLeu* 550 560 570 580 590 600 AATTAATCCCAAATGAGCAGCATAATTGCTGGTTATTTATCTTCCTCGAGGGGAGATTTT oc 610 620 630 640 650 660 TTCTTGA (SEQ ID. NOS: 1 and 2) Nucleotide Sequence Coding for a Common Outer Membrane Protein from H. influenzae and Monoclonal AntibodiesThe 15 kD outer membrane protein described herein is conserved among type b and nontypable H. influenzae. Epitopes on the native protein are recognized by the murine monoclonal antibodies 6B11, 1A6, and 5E6. The epitopes are present on the surface of intact H. influenzae cells. The gene for the 15 kD protein has been cloned and the DNA sequence thereof has been determined. The gene, when expressed in an appropriate host/vector system, produces a recombinant protein which is reactive with the monoclonal antibodies. Since the protein is antigenically highly conserved, it should receive serious consideration for inclusion in a vaccine to prevent H. influenzae disease. Moreover monoclonal antibodies and DNA probes may be used as a diagnostic tool to detect the presence of H. influenzae.
BRIEF DESCRIPTION OF THE DRAWINGSFIG. 1 is a Western blot analysis of H. influenzae with monoclonal antibodies;
FIG. 2 is a partial restriction map of plasmid pRSM1255 which contains the gene for the 15 kD outer membrane protein from H. influenzae type b strain 1613;
FIG. 3 is a Western blot analysis of the expression of the recombinant 15 kD protein;
FIG. 4 is a dot blot immunoassay of extracts of E. coli strains LE392/pGD103 and LE392/pRSM1311; and
FIG. 5 is the amino acid sequence for the polynucleotide of the present invention. (SEQ ID NOs 1 and 2 are set forth in this Figure.)
DESCRIPTION OF THE PREFERRED EMBODIMENT GENERATION OF MONOCLONAL ANTIBODIESMonoclonal antibodies (Mabs) were obtained from two independent fusion experiments. Mab 1A6 was generated from Balb/c mice immunized with sarcosyl-insoluble proteins of nontypable H. influenzae MTL6 as described by Hamel et al [see Journal of General Microbiology (1992), 138, 161-168] and monoclonal antibodies 6B11 and 5E6, were produced from mice immunized with outer membranes extracted from nontypable H. influenzae 12085 by the lithium chloride method described by Hamel et al [see J. Med. Microbiology, (1987) 23 163-170]. Isotype analysis revealed that the 1A6, 6B11 and 5E6 hybridomas secreted immunoglobulin IG2a, IG1 and IG3 respectively.
Referring to FIG. 1, Western Immunoblotting analysis of outer membrane preparations was performed. Outer membrane preparations were fractionated on 16% SDS-PAGE, transferred to nitrocellulose, and probed with Mab 1A6 (lane 1), 6B11 (lane 2), 5E6 (lane 3) and porin-specific Mab P2-18 (lane 4). The analysis indicated that the monoclonal antibodies were directed against a protein with an apparent mass of 15 kD. Antibody accessibility radioimmunoassay [see Proulx et al, Infection and Immunity (1991)59, 963-970] indicated that monoclonal antibodies bound to surface-exposed epitopes on both type b and nontypable H. influenzae isolates.
CONSERVATION OF 15 KD-EPITOPESA total of 193 H. influenzae isolates were tested by dot blot immunoassay for their reactivity with monoclonal antibodies 1A6, 6B11 and 5E6.
TABLE 1 Characteristics of H. influenzae strains tested for monoclonal antibody reactivities Number Reactive/ Strains Total Numbera H. influenzae serotype b: Division: Clonal group A1b 27/27 Clonal group A2 59/59 Clonal group B1 5/5 Division: Clonal group J 1/1 H. influenzae serotype a: Division 1 2/2 Division 2 2/2 H. influenzae serotype d: 2/2 Division 1 H. influenzae nontypable 95/95 Other gram-negative speciesc 0/19 aReactivity of MAb 6B11. and 5E6 was tested individually by blot immunoassay. bThe chromosomal genotypes of H. influenzae expressing serotype a, b and d capsule were previously characterized by Dr. James Musser (see J. Musser et al “Global Genetic STructure and Molecular Epidermiology of Encopsulated Haemophilus Influenzae. Reviews of Infectious Diseases 12, 75-111). cNineteen isolates representing 19 other gram-negative species were tested. These are listed in Table 2. TABLE 2 Non-H. influenzae isolates tested Alcaligenes odorans Citrobacter freundii Flavobacterium odoratum Edwardsiella tarda Enterobacter cloaca Enterobacter aerogenes Klebsiella pneumoniae Moraxella catharrhalis Neisseria lactamica Neisseria perflava Neisseria subflava Pseudomonas aeruginaosa Proteus vulgaris Providencia rettgeri Serratia marcescens Salmonella thyphimurium Shigella flexneri Shigella sonnei Xanthomonas maltophilia MOLECULAR CLONING OF THE GENE FOR THE 15 KD OUTER MEMBRANE PROTEINA lambda EMBL3 genomic library of DNA from H. influenzae strain 1613 was immunologically screened with murine monoclonal antibody 6B11 as described by Munson and Grass [see Infection and Immunity (1988) 561 2235-2242]. An immunologically reactive clone was isolated by plaque purification. A liquid lysate was prepared and DNA was purified from a Promega lambda DNA kit according to the manufacturer's directions. The Haemophilus insert was identified as a SalI fragment of approximately 16 kb. DNA from the lambda clone was partially digested with Sau3A and fragments of approximately 3-6 kb were isolated by preparative agarose gel electrophoresis. The 3-6 kb fragments were ligated into the low copy number vector pGD103 [see Deich et al, Journal of Bacteriology (1988) 489- 498] which had been digested sequentially with BamHI and alkaline phosphatase. The ligation mixture was transformed into E. coli strain LE392 and the cells were plated on LB agar containing 35 &mgr;g/ml of kanamycin. Immunologically reactive colonies were identified by screening with murine Mab 6B11. Strain LE392/pRSM1255 was saved for further study. As shown in FIG. 2 plasmid pRSM1255 has an insert of approximately 3.8 kb. Strain LE392/pRSM1255 produces the full size protein as determined by Western blot (see FIG. 3). Membrane preparations were fractionated by SDS-PAGE, transferred to nitrocellulose and probed with murine monoclonal antibody 6B11. Lane 1is the total membrane preparation of H. influenzae strain 1613; lane 2 is the total membrane preparation of E. coli strain LE392/pGD103 and lane 3 is the total membrane preparation of E. coli strain LE392/pRSM1255. The full size 15 Kd protein is produced by E. coli strain LE392/pRSM1255.
In order to further subclone the gene for sequencing, pRSM1255 was partially digested with Sau3A, fragments of approximately 0.5 to 1.5 kb were isolated, ligated into BamHI-treated pGD103 and transformed into E. coli strain LE392. An immunologically positive clone, designated LE392/pRSM1311 was saved for further analysis. Western blot analysis employing Mab 6B11 indicated that the full size protein was produced by this strain (data not shown). The Haemophilus insert in pRSM1311 is approximately 0.6 kb in size. Extracts of E. coli strain LE392/pRSM1311 react with all three murine Mabs (FIG. 4). 5 &mgr;g of cell extracts were applied to the nitrocellulose and probed with Mabs 3B11, 1A6, and 5E6.
SEQUENCE ANALYSISThe insert was cloned into M13mp18 and M13mp19 as a SalI to EcoRI fragment and sequenced in both directions. A 369 codon open reading frame (SEQ ID NO:3) was identified encoding a protein composed of 123 amino acids (SEQ ID NO:2) and having a molecular weight of 13,460. The open reading frame is notable for a lysine at position 3 and a cysteine at position 26 suggesting that the protein is a lipoprotein with a 25 amino acid leader peptide. (The sequence of the protein without the leader peptide is set forth in SEQ ID NO:4.)
DNA and protein sequence analysis were done using Gen Bank (a trademark of NIH) and EMBL (from European Molecular Biology Organization) data bases. The nucleotide (SEQ ID NO:1) and derived amino acid sequence (SEQ ID NO:2) of the 15 kD outer membrane protein of H. influenzae type b, strain 1613 is set out in Table 3.
TABLE3 MW for gene product = i3460. Number of amino acids = 123 10 20 30 40 50 60 GATCCCACCTTGTTTATTCCAATAATGGAACTTTATTTTATTAAAGGTATCTAAGTAGCA 70 80 90 100 110 120 CCCTATATAGGGATTAATTAACGAGGTTTAATAATGAACTTTAACTAAAATTTTACCAGC 130 140 150 160 170 180 ATTTGCTGCTGTAGTCTGTATTATCTGCTTGTGCAAAGGATGCACCTGAAATGACAAAAT Met ThrLys S 190 200 210 220 230 240 CATCTGCGCAAATAGCTGAAATGCAAACACTTCCAACAATCACTGATAAAACAGTTGTAT erSerAlaGlnIleAlaGluMetGlnThrLeuProThrIleThrAspLysThrValValT 250 260 270 280 290 300 ATTCCTGCAATAAACAAACGGTGACTGCTGTGTATCAATTTGAAAACCAAGAACCAGTTG yrSerCysAsnLysGlnThrValThrAlaValTyrGlnPheGluAsnGlnGluProValA 310 320 330 340 350 360 CTGCAATGGTAAGTGTGGGCGATGGCATTATTGCCAAAGATTTTACTCGTGATAAATCAC laAlaMetValSerValGlyAspGlyIleI1eAlaLysAspPheThrArgAspLysSerG 370 380 390 400 410 420 AAAATGACTTTACAAGTTTCGTTTCTGGGGATTATGTTTGGAATGTAGATAGTGGCTTAA lnAsnAspPheThrSerPheValSerGlyAspTyrValTrpAsnValAspSerGlyLeuT 430 440 450 460 470 480 CGTTAGATAAATTTGATTCTGTTGTGCCTGTCAATTTAATTCAAAAAGGTAAATCTAGCG hrLeuAspLysPheAspSerValValProValAsnLeuIleGlnLysGlyLysSerSerA 490 500 510 520 530 540 ATAATATCATCGTCAAAAATTGTGATGTAAACGTAAAAGCAACTAAAAAAGCAAATTTAT spAsnIleIleValLysAsnCysAspValAsnValLysAlaThrLysLysAlaAsnLeu* 550 560 570 580 590 600 AATTAATCCCAAATGACCAGCATAATTGCTGGTTATTTATCTTCCTCGAGGGGAGATTTT oc 610 620 630 640 650 660 TTCTTGAThe sequence was found to have no significant homology to any known proteins including two previously described Haemophilus outer membrane lipoproteins of similar size.
The research described herein was supported in part by United States Public Health Service grant R01AI17572 from the National Institutes of Health.
The sequence for the polynucleotide claimed in this application is as follows:
SEQUENCE DESCRIPTION: SEQ ID NO: 1: GATCCCACCTTGTTTATTCCAATAATGGAACTTTATTTTATTAAAGGTATCTAAGTAGCA. 60 CCCTATATAGGGATTAATTAACGAGGTTTAATAATGAACTTTAACTAAAATTTTACCAGC 120 ATTTGCTGCTGTAGTCTGTATTATCTGCTTGTGCAAAGGATGCACCTGAAATGACAAAAT 180 CATCTGCGCAAATAGCTGAAATGCAAACACTTCCAACAATCACTGATAAAACAGTTGTAT 240 ATTCCTGCAATAAACAAACGGTGACTGCTGTGTATCAATTTGAAAACCAAGAACCAGTTG 300 CTGCAATGGTAAGTGTGGGCGATGGCATTATTGCCAAAGATTTTACTCGTGATAAATCAC 360 AAAATGACTTTACAAGTTTCGTTTCTGGGGATTATGTTTGGAATGTAGATAGTGGCTTAA 420 CGTTAGATAAATTTGATTCTGTTGTGCCTGTCAATTTAATTCAAAAAGGTAAATCTAGCG 480 ATAATATCATCGTCAAAAATTGTGATGTAAACGTAAAAGCAACTAAAAAAGCAAATTTAT 540 AATTAATCCCAAATGACCAGCATAATTGCTGGTTATTTATCTTCCTCGAGGGGAGATTTT 600 TTCTTGA 607The amino acid sequence for the outer membrane protein of haemophilus influenzae claimed in this application is as follows:
SEQUENCE DESCRIPTION: SEQ ID NO: 2: Met Thr Lys Ser Ser Ala Gln Ile Ala Glu Met Gln Thr Leu Pro Thr 1 5 10 15 Ile Thr Asp Lys Thr Val Val Tyr Ser Cys Asn Lys Gln Thr Val Thr 20 25 30 Ala Val Tyr Gln Phe Glu Asn Gln Glu Pro Val Ala Ala Met Val Ser 35 40 45 Val Gly Asp Gly Ile Ile Ala Lys Asp Phe Thr Arg Asp Lys Ser Gln 50 55 60 Asn Asp Phe Thr Ser Phe Val Ser Gly Asp Tyr Val Trp Asn Val Asp 65 70 75 80 Ser Gly Leu Thr Leu Asp Lys Phe Asp Ser Val Val Pro Val Asn Leu 85 90 95 Ile Gln Lys Gly Lys Ser Ser Asp Asn Ile Ile Val Lys Asn Cys Asp 100 105 110 Val Asn Val Lys Ala Thr Lys Lys Ala Asn Leu 115 120 2 607 base pairs nucleic acid single linear DNA (genomic) NO NO misc_feature 171..539 /note=“Nucleotides 171 through 539 encode the outer membrane protein of Haemophilus Influenzae of Sequence ID No. 2.” 1 GATCCCACCT TGTTTATTCC AATAATGGAA CTTTATTTTA TTAAAGGTAT CTAAGTAGCA 60 CCCTATATAG GGATTAATTA ACGAGGTTTA ATAATGAACT TTAACTAAAA TTTTACCAGC 120 ATTTGCTGCT GTAGTCTGTA TTATCTGCTT GTGCAAAGGA TGCACCTGAA ATGACAAAAT 180 CATCTGCGCA AATAGCTGAA ATGCAAACAC TTCCAACAAT CACTGATAAA ACAGTTGTAT 240 ATTCCTGCAA TAAACAAACG GTGACTGCTG TGTATCAATT TGAAAACCAA GAACCAGTTG 300 CTGCAATGGT AAGTGTGGGC GATGGCATTA TTGCCAAAGA TTTTACTCGT GATAAATCAC 360 AAAATGACTT TACAAGTTTC GTTTCTGGGG ATTATGTTTG GAATGTAGAT AGTGGCTTAA 420 CGTTAGATAA ATTTGATTCT GTTGTGCCTG TCAATTTAAT TCAAAAAGGT AAATCTAGCG 480 ATAATATCAT CGTCAAAAAT TGTGATGTAA ACGTAAAAGC AACTAAAAAA GCAAATTTAT 540 AATTAATCCC AAATGACCAG CATAATTGCT GGTTATTTAT CTTCCTCGAG GGGAGATTTT 600 TTCTTGA 607 123 amino acids amino acid linear protein NO misc_feature 1..123 /note=“Nucleotides 171 through 539 encode the outer membrane protein of Haemophilus Influenzae of Sequence ID No. 2.” 2 Met Thr Lys Ser Ser Ala Gln Ile Ala Glu Met Gln Thr Leu Pro Thr 1 5 10 15 Ile Thr Asp Lys Thr Val Val Tyr Ser Cys Asn Lys Gln Thr Val Thr 20 25 30 Ala Val Tyr Gln Phe Glu Asn Gln Glu Pro Val Ala Ala Met Val Ser 35 40 45 Val Gly Asp Gly Ile Ile Ala Lys Asp Phe Thr Arg Asp Lys Ser Gln 50 55 60 Asn Asp Phe Thr Ser Phe Val Ser Gly Asp Tyr Val Trp Asn Val Asp 65 70 75 80 Ser Gly Leu Thr Leu Asp Lys Phe Asp Ser Val Val Pro Val Asn Leu 85 90 95 Ile Gln Lys Gly Lys Ser Ser Asp Asn Ile Ile Val Lys Asn Cys Asp 100 105 110 Val Asn Val Lys Ala Thr Lys Lys Ala Asn Leu 115 120 SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 4 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 607 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 171..539 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GATCCCACCT TGTTTATTCC AATAATGGAA CTTTATTTTA TTAAAGGTAT C TAAGTAGCA 60 CCCTATATAG GGATTAATTA ACGAGGTTTA ATAATGAACT TTAACTAAAA T TTTACCAGC 120 ATTTGCTGCT GTAGTCTGTA TTATCTGCTT GTGCAAAGGA TGCACCTGAA A TG ACA 176 Met Thr 1 AAA TCA TCT GCG CAA ATA GCT GAA ATG CAA A CA CTT CCA ACA ATC ACT 224 Lys Ser Ser Ala Gln Ile Ala Glu Met Gln T hr Leu Pro Thr Ile Thr 5 10 15 GAT AAA ACA GTT GTA TAT TCC TGC AAT AAA C AA ACG GTG ACT GCT GTG 272 Asp Lys Thr Val Val Tyr Ser Cys Asn Lys G ln Thr Val Thr Ala Val 20 25 30 TAT CAA TTT GAA AAC CAA GAA CCA GTT GCT G CA ATG GTA AGT GTG GGC 320 Tyr Gln Phe Glu Asn Gln Glu Pro Val Ala A la Met Val Ser Val Gly 35 40 45 50 GAT GGC ATT ATT GCC AAA GAT TTT ACT CGT G AT AAA TCA CAA AAT GAC 368 Asp Gly Ile Ile Ala Lys Asp Phe Thr Arg A sp Lys Ser Gln Asn Asp 55 60 65 TTT ACA AGT TTC GTT TCT GGG GAT TAT GTT T GG AAT GTA GAT AGT GGC 416 Phe Thr Ser Phe Val Ser Gly Asp Tyr Val T rp Asn Val Asp Ser Gly 70 75 80 TTA ACG TTA GAT AAA TTT GAT TCT GTT GTG C CT GTC AAT TTA ATT CAA 464 Leu Thr Leu Asp Lys Phe Asp Ser Val Val P ro Val Asn Leu Ile Gln 85 90 95 AAA GGT AAA TCT AGC GAT AAT ATC ATC GTC A AA AAT TGT GAT GTA AAC 512 Lys Gly Lys Ser Ser Asp Asn Ile Ile Val L ys Asn Cys Asp Val Asn 100 105 110 GTA AAA GCA ACT AAA AAA GCA AAT TTA TAATTAAT CC CAAATGACCA 559 Val Lys Ala Thr Lys Lys Ala Asn Leu 115 120 GCATAATTGC TGGTTATTTA TCTTCCTCGA GGGGAGATTT TTTCTTGA 607 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 123 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Thr Lys Ser Ser Ala Gln Ile Ala Glu M et Gln Thr Leu Pro Thr 1 5 10 15 Ile Thr Asp Lys Thr Val Val Tyr Ser Cys A sn Lys Gln Thr Val Thr 20 25 30 Ala Val Tyr Gln Phe Glu Asn Gln Glu Pro V al Ala Ala Met Val Ser 35 40 45 Val Gly Asp Gly Ile Ile Ala Lys Asp Phe T hr Arg Asp Lys Ser Gln 50 55 60 Asn Asp Phe Thr Ser Phe Val Ser Gly Asp T yr Val Trp Asn Val Asp 65 70 75 80 Ser Gly Leu Thr Leu Asp Lys Phe Asp Ser V al Val Pro Val Asn Leu 85 90 95 Ile Gln Lys Gly Lys Ser Ser Asp Asn Ile I le Val Lys Asn Cys Asp 100 105 110 Val Asn Val Lys Ala Thr Lys Lys Ala Asn L eu 115 120 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 369 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: ATGACAAAAT CATCTGCGCA AATAGCTGAA ATGCAAACAC TTCCAACAAT C ACTGATAAA 60 ACAGTTGTAT ATTCCTGCAA TAAACAAACG GTGACTGCTG TGTATCAATT T GAAAACCAA 120 GAACCAGTTG CTGCAATGGT AAGTGTGGGC GATGGCATTA TTGCCAAAGA T TTTACTCGT 180 GATAAATCAC AAAATGACTT TACAAGTTTC GTTTCTGGGG ATTATGTTTG G AATGTAGAT 240 AGTGGCTTAA CGTTAGATAA ATTTGATTCT GTTGTGCCTG TCAATTTAAT T CAAAAAGGT 300 AAATCTAGCG ATAATATCAT CGTCAAAAAT TGTGATGTAA ACGTAAAAGC A ACTAAAAAA 360 GCAAATTTA 369 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 98 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: Cys Asn Lys Gln Thr Val Thr Ala Val Tyr G ln Phe Glu Asn Gln Glu 1 5 10 15 Pro Val Ala Ala Met Val Ser Val Gly Asp G ly Ile Ile Ala Lys Asp 20 25 30 Phe Thr Arg Asp Lys Ser Gln Asn Asp Phe T hr Ser Phe Val Ser Gly 35 40 45 Asp Tyr Val Trp Asn Val Asp Ser Gly Leu T hr Leu Asp Lys Phe Asp 50 55 60 Ser Val Val Pro Val Asn Leu Ile Gln Lys G ly Lys Ser Ser Asp Asn 65 70 75 80 Ile Ile Val Lys Asn Cys Asp Val Asn Val L ys Ala Thr Lys Lys Ala 85 90 95 Asn LeuClaims
1. The recombinant polynucleotide having the sequence
2. A vector comprising a recombinant polynucleotide, wherein the recombinant polynucleotide is the recombinant polynucleotide of claim 1.
3. A host cell transformed with the vector of claim 2.
4. A recombinant expression system comprising a polynucleotide encoding a polypeptide comprising one or more immunoreactive epitopes of the 15 kD outer membrane protein of claim 1, wherein the polynucleotide is operably linked to a control sequence compatible with a desired host.
5. A cell transformed with a recombinant expression system, wherein the expression system is the recombinant expression system of claim 4.
6. A recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2.
7. The recombinant polynucleotide of claim 6, comprising the nucleotide sequence of SEQ ID NO: 3.
8. A recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4.
9. A recombinant vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2.
10. The recombinant vector of claim 9, wherein the recombinant polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3.
11. A recombinant vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4.
12. A host cell transformed with a vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2.
13. The host cell of claim 12, wherein the recombinant polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3.
14. A host cell transformed with a vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4.
15. A recombinant expression system comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 operably linked to a control sequence compatible with a desired host.
16. The recombinant expression system of claim 15, wherein the recombinant polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3.
17. A recombinant expression system comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 operably linked to a control sequence compatible with a desired host.
18. A cell transformed with a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2.
19. The cell of claim 18, wherein the recombinant polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3.
20. A cell transformed with a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4.
21. A method of making a recombinant vector capable of expressing a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, comprising
- inserting a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 into a plasmid.
22. The method of claim 21, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3.
23. A method of making a recombinant vector capable of expressing a polypeptide comprising the amino acid sequence of SEQ ID NO: 4, comprising
- inserting a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4 into a plasmid.
24. A method of making a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, comprising
- culturing a host cell transformed with a recombinant vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, whereby the host cell expresses the polypeptide, and
- isolating the polypeptide.
25. The method of claim 24, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3.
26. A method of making a polypeptide comprising the amino acid sequence of SEQ ID NO: 4, comprising
- culturing a host cell transformed with a recombinant vector comprising a recombinant polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 4, whereby the host cell expresses the polypeptide, and
- isolating the polypeptide.
- Young et al. PNAS. 80: 1194-1198. 1993.*
- Dugourd et al. Abstracts of Gen Meet ASM p. 88, Abstract B-373.*
- Green et al. Infection and Immunity 55: 2878-2883, 1987.*
- Grass et al., Abstracts of Gen Meeting of ASM P. 105, Abst. D-57.*
- Humel et al. J. Med. Microbiol. 23: 163-70, 1987, Abstract only.
Type: Grant
Filed: Apr 2, 1998
Date of Patent: Jun 25, 2002
Inventors: Bernard R. Brodeur (Sillery, Quebec), Josee Hamel (Sillery, Quebec), Robert S. Munson, Jr. (Hilliard, OH), Susan Grass (St Louis, MO)
Primary Examiner: Jennifer E. Graser
Attorney, Agent or Law Firm: Foley & Lardner
Application Number: 09/053,945
International Classification: A61K/3902; A61K/39102; C07H/2102; C12P/2106;