DNA sequences coding for a cinnamoyl COA reductase, and applications thereof in the control of lignin contents in plants
The present invention relates to any DNA sequence comprising as a coding region all or part of the nucleotidic sequence coding for a mRNA coding coding for a cinnamoyl CoA reductase (CCR) in lucern and/or corn, or all or part of the nucleotide sequence complementary of the latter and coding for an antisense mRNA susceptible of hybridizing with said mRNA. The invention also relates to the use of said sequences for implementing processes for the regulation of lignin biosynthesis in plants.
Latest Centre National de la Recherche Scientifique Patents:
- Method and device for determining red blood cells deformability
- Method for producing a dielectric layer on a structure made of materials III-V
- Method and device for quantum computing with Majorana modes
- Biomimetic G-quartet compounds
- Anti-CD32A antibodies and their use for evaluating the presence of a viral reservoir
The present invention relates to the use of DNA sequences which code for a cinnamoyl-CoA reductase (CCR) in plants, or any fragment of these sequences, or also any sequence derived from the latter, or their complementary sequences, in the context of carrying out processes for regulating the level of lignin in plants.
Lignin is a complex heterogeneous aromatic polymer which renders impermeable and reinforces the walls of certain plants cells.
Lignin is formed by polymerization of free radicals derived from monolignols, such as paracoumaryl, coniferyl and sinapyl alcohols (Higuchi, 1985, in Biosynthesis and degradation of wood components (T. Higuchi, ed.), Academic Press, Orlando, Fla. pp. 141-160).
Lignins have a wide variation in their relative content of monolignols, as a function of the species and the various tissues within the same plant
This variation is probably caused and controlled by different activities and specificities of substrates, the enzymes necessary for biosynthesis of lignin monomers (Higuchi, 1985, loc. cit.).
Beyond its role in the structure and development of plants, lignin represents a major component of the terrestrial biomass and assumes a major economic and ecological significance (Brown, 1985, J. Appl. Biochem. 7, 371-387; Whetten and Sederoff, 1991, l orest Ecology and Management, 43, 301-316).
At the level of exploitation of the biomass, it is appropriate first to note that lignin is a limiting factor of the digestibility and nutritional yield of fodder plants. In fact, it is clearly demonstrated that the digestibility of fodder plants by ruminants is inversely proportional to the content of lignin in these plants, the nature of the lignins also being a determining factor in this phenomenon (Buxton and Roussel, 1988, Crop. Sci., 28, 553-558; Jung and Vogel, 1986, J. Anim., Sci., 62, 1703-1712).
Among the main fodder plants in which it would be of interest to reduce the lignin contents there may be mentioned: lucerne, fescue, maize, fodder used for silaging . . . .
It should also be noted that high lignin contents are partly responsible for the limited quality of sunflower cake intended for feeding cattle, and for the reduction in germinative capacities of certain seeds in the horticultural sector.
It may also be emphasized that the intense lignification which results during preservation of plant components after harvesting rapidly renders products such as asparagus, yam, carrots etc . . . unfit for consumption.
Furthermore, it is also appropriate to note that more than 50 million tonnes of lignin are extracted from ligneous material each year in the context of production of paper pulp in the paper industry. This extraction operation, which is necessary to obtain cellulose, is costly in energy and, secondly, causes pollution through the chemical compounds used for the extraction, which are found in the environment (Dean and Eriksson, 1992, Holzforschung, 46, 135-147: Whetten and Sederoff, 1991, loc. cit.).
To reduce the proportions of lignins (which make up to 20 to 30% of the dry matter, depending on the species) to a few per cent (2 to 5%) would represent an increase in yield and a substantial saving (chemical products), and would contribute to improving the environment (reduction in pollution). Given the scale of use of ligneous material, these decreases would have extremely significant repercussions. In this case, the species concerned could be poplar, eucalyptus, Acacia magnium, the genus Casuarina and all the angiosperms and gymnosperms used for the production of paper pulp.
It is clear that in the two sectors under consideration, the reduction in the levels of lignins must be moderated to preserve the characteristics of rigidity and the normal architecture of the plant (or the tree), since the lignins which strengthen the cell walls play a significant role in maintaining the erect habit of plants.
The natural variations in the lignin contents observed in nature for the same species (deviations which can be up to 6-8% of the dry matter among individuals) justify the reductions suggested above.
The resistance to degradation of lignin, like the difficulties encountered in the context of its extraction, are probably due to the complex structure of this polymer, which is made up of ether bonds and carbon-carbon bonds between the monomers, as well as to the numerous chemical bonds which exist between the lignin and the other components of the cell wall (Sarkanen and Ludwig, 1971, in Lignins: Occurrence, Formation, Structure and Reactions (K. V. Sarkanen and C. H. Kudwig ed.) New York: Wiley—Interscience, pp. 1-18).
Starting from cinnamoyl-CoA, the biosynthesis of lignins in plants is effected in the following manner:
An approach to attempt to reduce the level of lignins in plants by genetic engineering would consist of inhibiting the synthesis of one of the enzymes in the biosynthesis chain of these lignins indicated above.
A particularly suitable technique in the context of such an approach is to use antisense mRNA which is capable of hybridizing with the mRNA which codes for these enzymes, and consequently to prevent, at least partly, the production of these enzymes from their corresponding mRNA.
Such an antisense strategy carried out with the aid of the gene which codes for the CAD in tobacco was the subject matter of European Patent Application no. 584 117, which describes the use of antisense mRNA which is capable of inhibiting the production of lignins in plants by hybridizing with the mRNA which codes for the CAD in these plants.
The results in the plants transformed in this way demonstrate a reduction in the activity of the CAD, but paradoxically the contents of lignins show no change. Complementary studies indicate that the lignins of transformed plants are different from control lignins, since the cinnamylaldehydes are incorporated directly into the lignin polymer.
One of the aims of the present invention is specifically that of providing a process which allows effective regulation of the contents of lignins in plants, either in the sense of a considerable reduction in these contents with respect to the normal contents in plants, or in the sense of an increase in these contents.
Another aim of the present invention is to provide tools for carrying out such a process, and more particularly constructions which can be used for the transformation of plants.
Another aim of the present invention is to provide genetically transformed plants, in particular fodder plants which can be digested better than non-transformed plants, or also transformed plants or trees for the production of paper pulp, from which the extraction of lignins would be facilitated and less polluting than in the case of non-transformed trees.
Another aim of the present invention is that of providing transformed plants which are more resistant to attacks from the environment, in particular to parasitic attacks, than the non-transformed plants are, or also transformed plants of a larger size, or of a smaller size (than that of the non-transformed plants).
The present invention relates to the use of recombinant nucleotide sequences containing one (or more) coding region(s), this (these) coding region(s) being made up of a nucleotide sequence chosen from the following:
the nucleotide sequence represented by SEQ ID NO 1 which codes for an mRNA, this mRNA itself coding for the cinnamoyl-CoA reductase (CCR) of lucerne represented by SEQ ID NO 2,
the nucleotide sequence represented by SEQ ID NO 3 which codes for an mRNA, this mRNA itself coding for the CCR of maize represented by SEQ ID NO 4,
a fragment of the nucleotide sequence represented by SEQ ID NO 1, or of that represented by SEQ ID NO 3, this fragment coding for a fragment of the CCR represented by SEQ ID NO 2 or for a fragment of the CCR represented by SEQ ID NO 3 respectively, this CCR fragment having an enzymatic activity equivalent to that of the two abovementioned CCRs,
the nucleotide sequence complementary to that represented by SEQ ID NO 1 or SEQ ID NO 3, this complementary sequence coding for an antisense mRNA which is capable of hybridizing with the mRNA coded by the sequences SEQ ID NO 1 and SEQ ID NO 3 respectively,
a fragment of the nucleotide sequence complementary to that represented by SEQ ID NO 1 or SEQ ID NO 3, this sequence fragment coding for an antisense mRNA which is capable of hybridizing with the mRNA which itself codes for the CCR represented by SEQ ID NO 2, or with the mRNA which itself codes for the CCR represented by SEQ ID NO 4 respectively,
the nucleotide sequence derived from the sequence represented by SEQ ID NO 1 or SEQ ID NO 3, in particular by mutation and/or addition and/or suppression and/or substitution of one or more nucleotides, this derived sequence coding either for an mRNA which itself codes for the CCR represented by SEQ ID NO 2 or SEQ ID NO 4 respectively, or for a fragment or a protein derived from the latter, this fragment or derived protein having an enzymatic activity equivalent to that of the said CCRs in plants,
the nucleotide sequence derived from the abovementioned complementary nucleotide sequence, or from the fragment of this complementary sequence as is described above, by mutation and/or addition and/or suppression and/or substitution of one or more nucleotides, this derived sequence coding for an antisense mRNA which is capable of hybridizing with one of the abovementioned mRNAs,
for transformation of plant cells in order to obtain transgenic plants within which the biosynthesis of lignins is regulated either in the sense of an increase or in the sense of a reduction in the contents of lignins produced, with respect to the normal contents of lignins produced in the plants, and/or in the sense of a modification of the composition of the lignins produced by the said transgenic plants with respect to the lignins produced in the non-transformed plants, in particular by carrying out one of the processes, described below, for regulation of the amount of lignin in the plants.
“Derived nucleotide sequence” in the text above and below is understood as meaning any sequence having at least about 50% (preferably at least 70%) of nucleotides homologous to those of the sequence from which it is derived.
“Derived protein” in the text above and below is understood as meaning any protein having at least about 50% (preferably at least 70%) of amino acids homologous to those of the protein from which it is derived.
The present invention more particularly relates to any DNA sequence, characterized in that it comprises, as the coding region:
the nucleotide sequence represented by SEQ ID NO 1 which codes for an mRNA, this mRNA itself coding for the CCR represented by SEQ ID NO 2, or
a fragment of the abovementioned nucleotide sequence, this fragment coding for a fragment of the CCR represented by SEQ ID NO 2) NO 2, this CCR fragment having an enzymatic activity equivalent to that of the abovementioned CCR, or
any nucleotide sequence derived from the abovementioned sequence represented by SEQ ID NO 1, or from a fragment, as is described above, of this sequence, in particular by mutation and/or addition and/or suppression and/or substitution of one or more nucleotides, this derived sequence coding for an mRNA which itself codes for the CCR represented by SEQ ID NO 2, or for a protein derived from the latter and having an enzymatic activity equivalent to that of the said CCR in plants.
The present invention more particularly relates to any DNA sequence, characterized in that it contains, as the coding region:
the nucleotide sequence represented by SEQ ID NO 3 which codes for mRNA, this mRNA itself coding for the CCR represented by SEQ ID NO 4, or
a fragment of the abovementioned nucleotide sequence, this fragment coding for a fragment of the CCR represented by SEQ ID NO 4, this CCR fragment having an enzymatic activity equivalent to that of the abovementioned CCR, or
any nucleotide sequence derived from the abovementioned sequence represented by SEQ ID NO 3, or from a fragment, as is described above, of this sequence, in particular by mutation and/or addition and/or suppression and/or substitution of one or more nucleotides, this derived sequence coding for an mRNA which itself codes for the CCR represented by SEQ ID NO 4, or for a protein derived from the latter and having an enzymatic activity equivalent to that of the said CCR in plants.
Protein having an enzymatic activity equivalent to that of the CCRs present in plants, and more particularly the CCRs represented by SEQ ID NO 2 and SEQ ID NO 4, is understood as meaning any protein which possesses a CCR activity as measured by the method of Luderitz and Grisebach published in Eur. J. Biochem. (1981), 119:115-127.
By way of illustration, this method is carried out by spectrophotometric measurement of the reducing activity of the protein (CCR or derived) by monitoring the disappearance of the cinnamoyl-CoAs at 366 nm. The reaction takes place at 30° C. in the course of 2 to 10 minutes. The composition of the reaction medium is as follows: phosphate buffer 100 mM, pH 6.25, 0.1 mM NADPH, 70 &mgr;M feruloyl-CoA, 5 to 100 &mgr;l enzymatic extract in a total volume of 500 &mgr;l.
The invention also relates to any DNA sequence, characterized in that it contains, as the coding region:
the nucleotide sequence complementary to that represented by SEQ ID NO 1, this complementary sequence coding for an antisense mRNA which is capable of hybridizing with the mRNA which itself codes for the CCR represented by SEQ ID NO 2, that is to say the mRNA coded by the sequence represented by SEQ ID NO 1, or coded by a sequence derived from the latter, as is defined above, or
a fragment of the abovementioned complementary sequence, this sequence fragment coding for an antisense mRNA which is capable of hybridizing with the mRNA which itself codes for the CCR represented by SEQ ID NO 2, as is defined above, or
any nucleotide sequence derived from the abovementioned complementary sequence, or from the fragment of this complementary sequence as is described above, in particular by mutation and/or addition and/or suppression and/or substitution of one or more nucleotides, this derived sequence coding for an antisense mRNA which is capable of hybridizing with the abovementioned mRNA.
The present invention more particularly relates to any DNA sequence, characterized in that it contains, as the coding region:
the nucleotide sequence complementary to that represented by SEQ ID NO 3, this complementary sequence coding for an antisense mRNA which is capable of hybridizing with the mRNA which itself codes for the CCR represented by SEQ ID NO 4, that is to say the mRNA coded by the sequence represented by SEQ ID NO 3, or coded by a sequence derived from the latter, as is defined above, or
a fragment of the abovementioned complementary sequence, this sequence fragment coding for an antisense mRNA which is capable of hybridizing with the mRNA which itself codes for the CCR represented by SEQ ID NO 4, as is defined above, or
any nucleotide sequence derived from the abovementioned complementary sequence, or from the fragment of this complementary sequence as is described above, in particular by mutation and/or addition and/or suppression and/or substitution of one or more nucleotides, this derived sequence coding for an antisense mRNA which is capable of hybridizing with the abovementioned mRNA.
It goes without saying that the sequences represented by SEQ ID NO 1 and SEQ ID NO 3, the complementary sequences, the derived sequences and the sequence fragments of the invention which are mentioned above must be considered as being represented in the sense 5′→3′.
The first nucleotide of a complementary sequence in the sense 5′→3′ as is described above is thus the complement of the last nucleotide of the sequence in the sense 5′→3′ which codes for a CCR (or CCR fragment or derived protein), the second nucleotide of this complementary sequence is the complement of the last-but-one nucleotide of the sequence which codes for a CCR, and so on, up to the last nucleotide of the said complementary sequence, which is the complement of the first nucleotide of the sequence which codes for a CCR.
The mRNA coded by the abovementioned complementary sequence is such that, if this mRNA is represented in the sense 5′→3′, its first nucleotide corresponds to the last nucleotide of the sequence which codes for a CCR, and thus hybridizes with the last nucleotide of the mRNA coded by the latter, while its last nucleotide corresponds to the first nucleotide of the sequence which codes for a CCR, and thus hybridizes with the first nucleotide of the mRNA coded by the latter.
Antisense mRNA in the text above and below is therefore understood as meaning any RNA coded by the said complementary sequence and represented in the reverse sense (3′→5′) to the sense in which the mRNA coded by the sequence which codes for a CCR (or CCR fragment or derived protein) is represented, the latter mRNA being also called sense mRNA (5′→3′).
The term antisense RNA therefore relates to an RNA sequence complementary to the sequence of bases of the messenger RNA, the term complementary being understood in the sense that each base (or a majority of the bases) of the antisense sequence (read in the sense 3′→5′) is capable of pairing with the corresponding bases (G with C, A with U) of the messenger RNA (sequence read in the sense (5′→3′).
The strategy of antisense RNAs in the context of the present invention is a molecular approach which is particularly suitable for the aim of modulation of the levels of lignins in plants. The antisense RNA is an RNA produced by transcription of the non-coding DNA strand (non-sense strand).
This antisense strategy is more particularly described in European Patent no. 240 208.
It is thought that the inhibition of the synthesis of a protein by the antisense strategy, under the circumstances the CCR in the present case, is the consequence of the formation of a duplex between the two complementary RNAs (sense and antisense), thus preventing the production of the protein. The mechanism remains obscure, however. The RNA-RNA complex can interfere either with a subsequent transcription, or with the maturation, transportation or translation, or even lead to a degradation of the mRNA.
A combination of these effects is also possible.
The invention also relates to any mRNA coded by a DNA sequence according to the invention, and more particularly:
the mRNA coded by the DNA sequence represented by SEQ ID NO 1, or coded by a fragment or a derived sequence, as are defined above, the said mRNA being capable of coding in its turn for the CCR present in lucerne, such as is represented by SEQ ID NO 2, or for a fragment of this CCR or a derived protein, as are defined above,
the mRNA coded by the DNA sequence represented by SEQ ID NO 3, or coded by a fragment or a derived sequence, as are defined above, the said mRNA being capable of coding in its turn for the CCR present in maize, such as is represented by SEQ ID NO 4, or for a fragment of this CCR or a derived protein, as are defined above.
The invention also relates to any antisense mRNA as defined above, characterized in that it contains nucleotides complementary to all or only part of the nucleotides which make up an mRNA as described above according to the invention, the said antisense mRNA being capable of hybridizing (or of pairing) with the latter.
In this respect, the invention more particularly relates to the antisense mRNAs coded by the DNA sequences according to the invention, containing at least one region of 50 bases homologous to those of a region of the complementary sequences of the abovementioned DNA sequences of the invention.
There is no upper limit to the size of the DNA sequences which code for an antisense RNA according to the invention; they can be as long as the messenger usually produced in cells, or indeed as long as the genomic DNA sequence which codes for the mRNA of the CCR.
Such DNA sequences which code for an antisense RNA according to the invention advantageously contain between about 100 and about 1,000 base pairs.
The invention more particularly relates to any antisense sequence containing one (or more) antisense mRNA(s) as described above, or fragment(s) of this (these) antisense mRNA(s), and one (or more) sequence(s) corresponding to one (or more) catalytic domain(s) of a ribozyme.
In this respect, the invention more particularly relates to any antisense sequence as is described above containing the catalytic domain of a ribozyme flanked on both sides by arms of about 8 bases complementary to sequences which border a motif GUX (X representing C, U or A) contained in one of the mRNAs of the invention described above (also called target RNAs) (Haseloff J., et Gerlach W. L., 1988, Nature, 334:585-591).
The invention also relates to any DNA sequence which is capable of coding for an antisense sequence as is described above containing at least one catalytic domain of a ribozyme bonded to one or more antisense mRNA(s) of the invention, or fragment(s) of the antisense mRNA (advantageously fragments of about 8 bases as are described above).
The invention more particularly relates to:
any antisense mRNA as is described above, characterized in that it is coded by the nucleotide sequence complementary to that represented by SEQ ID NO 1, the said antisense mRNA being capable of hybridizing with the mRNA coded by the DNA sequence represented by SEQ ID NO 1,
any antisense mRNA as is described above, characterized in that it is coded by the nucleotide sequence complementary to that represented by SEQ ID NO 3, the said antisense mRNA being capable of hybridizing with the mRNA coded by the DNA sequence represented by SEQ ID NO 3.
The invention also relates to the recombinant polypeptides coded by the DNA sequences of the invention, the said recombinant polypeptides having an enzymatic activity equivalent to that of the CCRs in plants, and more particularly the recombinant CCRs coded by the sequences represented by SEQ ID NO 1 and SEQ ID NO 3, or by sequences derived from the latter according to the invention.
The invention more particularly relates to the recombinant polypeptides, and in particular the recombinant CCRs, such as are obtained by transformation of plant cells by integrating into their genome, in a stable manner, a recombinant nucleotide sequence as is defined below containing a DNA sequence according to the invention, in particular with the aid of a vector as is described below.
The expression “recombinant polypeptides” should be understood as meaning any molecule which has a polypeptide chain which is capable of being produced by genetic engineering, by the intermediary of a transcription phase of the DNA of the corresponding gene, leading to the obtaining of RNA which is subsequently transformed into mRNA (by suppression of introns), the latter being then translated by the ribosomes, in the form of proteins, the entire process being carried out under the control of suitable regulatory elements inside a host cell. The expression “recombinant polypeptides” used consequently does not exclude the possibility that the said polypeptides contain other groupings, such as glycosylated groupings.
The term “recombinant” of course indicates that the polypeptide has been produced by genetic engineering, since it results from expression, in a suitable cell host, of the corresponding nucleotide sequence which has been introduced beforehand into an expression vector used to transform the said cell host. However, this term “recombinant” does not exclude the possibility that the polypeptide is produced by a different process, for example by conventional chemical synthesis by the known methods used for synthesis of proteins, or proteolytic cleavage of molecules of larger size.
The invention more particularly relates to the CCR such as is present in lucerne cells and is represented by SEQ ID NO 2, or the CCR such as is present in maize cells and is represented by SEQ ID NO 4, the said CCRs being those obtained in an essentially pure form, by extraction and purification, from lucerne or maize, or any protein derived from the latter, in particular by addition and/or suppression and/or substitution of one or more amino acids, or any fragment resulting from the said CCRs or from their derived sequences, the said fragments and derived sequences being capable of having an enzymatic activity equivalent to that of the abovementioned CCRs.
The invention also relates to the nucleotide sequences which code for the CCR represented by SEQ ID NO 2 or SEQ ID NO 4, or any derived sequence or fragment of the latter, as are defined above, the said nucleotide sequences being characterized in that they correspond to all or part of the sequences represented by SEQ ID NO 1 or SEQ ID NO 3 respectively, or to any sequence derived from the latter by degeneration of the genetic code, and being nevertheless capable of coding for the CCRs or derived sequence or fragment of the latter, as are defined above.
The invention also relates to the complexes formed between the antisense mRNAs as are described above and the mRNAs according to the invention which are capable of coding for all or part of a CCR in plants.
The invention more particularly relates to the complex formed between the mRNA coded by the sequence SEQ ID NO 1 and the antisense mRNA coded by the sequence complementary to the sequence SEQ ID NO 1, and to the complex formed between the mRNA coded by the sequence SEQ ID NO 3 and the antisense mRNA coded by the sequence complementary to the sequence SEQ ID NO 3.
The invention more particularly relates to any recombinant nucleotide sequence (or recombinant DNA), characterized in that it contains at least one DNA sequence according to the invention chosen from those described above, the said DNA sequence being inserted into a heterologous sequence.
The invention more particularly relates to any recombinant nucleotide sequence as is described above containing, as the coding region, the nucleotide sequence represented by SEQ ID NO 1, or by SEQ ID NO 3, or any fragment or a nucleotide sequence derived from the latter, as are defined above, the said nucleotide sequences or the said fragment being inserted into a heterologous sequence, and being capable of coding for the CCR represented by SEQ ID NO 2, or by SEQ ID NO 4 respectively, or for a fragment of these CCRs, or for a protein derived from the latter, as are defined above.
The invention more particularly also relates to any recombinant nucleotide sequence containing, as the coding region, a nucleotide sequence complementary to that represented by SEQ ID NO 1, or by SEQ ID NO 3, or any fragment or any nucleotide sequence derived from this complementary sequence, as defined above, the said complementary sequences or the said fragment being inserted into a heterologous sequence and being capable of coding for an antisense mRNA which is capable of hybridizing with all or part of the mRNA which codes for a CCR in plants, and more particularly with all or part of the mRNA which codes for the CCR represented by SEQ ID NO 2, or by SEQ ID NO 4.
The recombinant DNAs according to the invention are further characterized in that they contain the elements necessary to regulate the expression of the nucleotide sequence which codes for a CCR, or of its complementary sequence which codes for an antisense mRNA according to the invention, in particular a promoter and a terminator of the transcription of these sequences.
Among the various promoters which can be used in the constructions of recombinant DNAs according to the invention there may be mentioned:
the endogenous promoter which controls the expression of the CCR in a plant, in particular the promoter situated upstream of the DNA sequence represented by SEQ ID NO 5 which codes, in eucalyptus, for the CCR represented by SEQ ID NO 6, or
promoters of a type which confers high expression, examples: 35S CAMV (described in Benfey et al. (1990), EMBO J., 9 (6), 1677-1684), EF1&agr; (promoter of the gene of an elongation factor in protein synthesis, described by Curie et al. (1991), Nucl. Acids Res., 19, 1305-1310),
promoters of a type specific for particular expression in individual tissues, examples: promoter CAD (described by Feuillet C. (1993), Thesis of the University of Toulouse III), promoter GRP 1-8 (described by Keller and Baumgartner, (1991), Plant Cell., 3, 1051-1061) for expression in specific vascular tissues.
The invention also relates to any recombinant nucleotide sequence as is described above, also containing, as the coding region, at least one nucleotide sequence which codes for all or part of an mRNA which itself codes for an enzyme other than the CCR, which is found to be involved in a stage of the biosynthesis of lignins in plants, in particular the mRNA which codes for cinnamyl alcohol dehydrogenase (CAD), or also containing, as the coding region, at least one nucleotide sequence which codes for all or part of an antisense mRNA which is capable of hybridizing with the abovementioned mRNA, in particular with the mRNA which codes for CAD.
The abovementioned recombinant nucleotide sequences of the invention are advantageously obtained from vectors, into which are inserted the DNA sequences which code for an enzyme necessary for the biosynthesis of lignins in plants.
The abovementioned vectors are digested with the aid of suitable restriction enzymes in order to recover the said DNA sequences which are inserted there.
The latter are then inserted downstream of a suitable promoter, and upstream of a suitable terminator of expression, within the recombinant DNAs according to the invention.
The invention more particularly relates to the recombinant DNAs which contain the sequence represented by SEQ ID NO 1 or that represented by SEQ ID NO 3, such as are obtained by digestion of the abovementioned vectors, recovery of the DNA sequence of the invention and insertion of the latter in the sense 5′→3′ within a heterologous DNA sequence containing a promoter and a terminator of the expression of the said sequence.
The invention also more particularly relates to the recombinant DNAs containing the sequence complementary to the sequence represented by SEQ ID NO 1 or that represented by SEQ ID NO 3, such as are obtained by digestion of the abovementioned vectors, recovery of the DNA sequence of the invention and insertion of the latter in the reverse sense, that is to say in the sense 3′→5′, within a heterologous DNA sequence containing a promoter and a terminator of the expression of the complementary sequence.
By way of example of the terminator which can be used in such constructions there may be mentioned the 3′ end of the gene of nopaline synthase of Agrobacterium lumefaciens.
Thus, generally, the recombinant nucleotide sequences according to the invention containing a DNA sequence which codes for a CCR (or a fragment of CCR or a derived protein), and/or other enzymes necessary for the biosynthesis of lignins, are obtained by recovery of the said DNA sequence from the abovementioned vectors and insertion of this sequence into the heterologous sequence, while the recombinant nucleotide sequences containing a DNA sequence which codes for an antisense mRNA according to the invention are obtained by recovery of the abovementioned DNA sequence and insertion of the latter in the reverse sense into the said heterologous sequence.
By way of illustration, all or part of the complementary DNA (cDNA) represented by SEQ ID NO 1 or SEQ ID NO 3 can be used for construction of the abovementioned recombinant DNAs, or also all or part of the genomic clone corresponding to a CCR (which corresponds to the abovementioned cDNAs+any introns). This genomic clone can be obtained using the cDNAs as probes to screen a genome bank, the latter itself being obtained by the method described by Sambrook, Fritsch and Maniatis, Molecular Cloning Laboratory Manual, Cold Spring Harbour Laboratory Press, 1989.
The invention also relates to any recombinant vector which can be used for the transformation of plants, characterized in that it contains a recombinant nucleotide sequence chosen from those described above, according to the invention, which is integrated into one of the sites of its genome which are not essential for its replication.
Among the abovementioned recombinant vectors which can be used for the transformation of plants, there may be mentioned: binary vectors derived from pBIN 19 (Bevan et al., (1984), Nucl. Acids Res., 12 (22), 8711-8721).
Examples of the construction of recombinant vectors according to the invention are described in the detailed description of the invention which follows.
The present invention also relates to a process for regulating the biosynthesis of lignins in plants, either by reducing or by increasing the amounts of lignins produced with respect to the normal amounts of lignins produced in these plants, the said process comprising a stage of transformation of cells of these plants with the aid of a vector containing:
the nucleotide sequence represented by SEQ ID NO 1 or by SEQ ID NO 3 or a fragment of the abovementioned nucleotide sequences, this fragment coding for an mRNA, this mRNA itself coding for a fragment of a CCR in plants, this CCR fragment having an enzymatic activity equivalent to that of the CCR represented by SEQ ID NO 2 or by SEQ ID NO 4, or of a nucleotide sequence derived from the abovementioned nucleotide sequences, or derived from the abovementioned fragment, in particular by mutation and/or addition and/or suppression and/or substitution of one or more nucleotides, this derived sequence coding for an mRNA, this mRNA itself coding for a derived protein having an enzymatic activity equivalent to that of at least one of the abovementioned CCRs, or
a nucleotide sequence complementary to all or part of the nucleotide sequences represented by SEQ ID NO 1 or by SEQ ID NO 3 which code for an mRNA, or the fragment of these sequences, or the sequence derived from the latter, as are defined above, this complementary sequence coding for an antisense mRNA which is capable of hybridizing with one of the abovementioned mRNA,
the said transformation being carried out in particular with the aid of a vector as is described above.
The invention more particularly relates to a process for reducing the amount of lignins produced by biosynthesis in plants, this process being carried out by transformation of the genome of these plants, incorporating:
at least one DNA sequence according to the invention as is described above which codes for an antisense mRNA which is capable of hybridizing with all or part of the mRNA which codes for the CCR represented by SEQ ID NO 2 or SEQ ID NO 4, or for a protein derived from the latter as is defined above,
and, where appropriate, at least one DNA sequence which codes for an antisense mRNA which is capable of hybridizing with an mRNA which codes for an enzyme other than the CCR, which is found to be involved in a stage of the biosynthesis of lignins in plants, in particular the mRNa which codes for CAD,
the said transformation being carried out:
either with the aid of a recombinant vector as is described above, containing a DNA sequence which codes for an antisense mRNA which is capable of hybridizing with the mRNA which codes for the CCR or for a derived protein, as is defined above, and, where appropriate, containing one or more DNA sequence(s) which code(s) for an antisense mRNA which is capable of hybridizing with an mRNA which codes for an enzyme other than the CCR as is defined above,
or with the aid of several recombinant vectors, at least one of which contains a DNA sequence which codes for an antisense mRNA which is capable of hybridizing with the mRNA which codes for the CCR or for a derived proteins, as is defined above, while the other recombinant vector(s) contain(s) a DNA sequence which codes for an antisense mRNA which is capable of hybridizing with an mRNA which codes for an enzyme other than the CCR, as is defined above.
Another process for reducing the amount of lignins produced by biosynthesis in plants is that realized by transformation of the genome of these plants, incorporating:
at least one DNA sequence according to the invention represented by SEQ ID NO 1 or SEQ ID NO 3, or a fragment or a sequence derived from the latter, as are defined above,
and, where appropriate, at least one DNA sequence which codes for all or part of an enzyme other than the CCR, which is found to be involved in a stage of the biosynthesis of lignins in plants, in particular a DNA sequence which codes for all or part of CAD,
the said transformation being realized:
either with the aid of a recombinant vector as is described above containing the abovementioned DNA sequence according to the invention, or a fragment or a sequence derived from the latter, as are defined above, and, where appropriate, containing one or more DNA sequence(s) which code(s) for all or part of an enzyme other than the CCR, as is defined above,
or with the aid of several recombinant vectors, at least one of which contains an abovementioned DNA sequence according to the invention, or a fragment or a sequence derived from the latter, as are defined above, while the other recombinant vector(s) contain(s) a DNA sequence which codes for all or part of an enzyme other than the CCR, as is defined above.
The latter method makes use of the co-suppression mechanism. Co-suppression has been observed when copies of the endogenous gene have been introduced into the genome. Although the mechanism of co-suppression is currently unknown, one of the most frequent hypotheses adopted is that negative regulation of the expression of the gene would come from production of a small proportion of antisense RNA derived from a transgene through reading of the “bad” strand of the transgene (Grierson et al., Trends Biotech., 9: 122-123).
The invention also relates to a process for reducing the amount of lignins produced by biosynthesis in plants, this process being carried out by transformation of the genome of these plants incorporating a DNA sequence as is described above according to the invention, which codes for an antisense sequence containing one (or more) catalytic domain(s) of a ribozyme bonded to one (or more) antisense mRNA(s), or fragment(s) of the antisense mRNA of the invention, the said transformation being carried out with the aid of a recombinant vector containing a recombinant nucleotide sequence according to the invention, itself containing the abovementioned DNA sequence.
It is important to note that the abovementioned methods allow transformed plants which have different levels of reduction of the CCR activity (depending on the level of insertion of the DNA sequence which codes for the antisense mRNA, the number of copies of this DNA sequence integrated into the genome . . . ), and therefore of lignin contents, to be arrived at.
The choice of transformants will therefore allow controlled modulation of the contents of lignins compatible with a normal development of the plant.
Generally, considering that the normal average content of lignins of a plant varies between about 15% and about 35% by weight of dry matter, the reduction in the content of lignins resulting from carrying out one of the abovementioned processes is advantageously such that the plants thus transformed have an average content of lignins which varies between about 10% and about 30%, or even between about 12% and about 32%.
By way of illustration, the content of lignins in a plant can be measured by a variant of the method of Johnson et al., (1961), T.A.P.P.I., 44, 793-798, which is described in detail in Alibert and Boudet (1979), Physiol., Veg., 17 (1), 67-74, the main stages of which are the following: after obtaining a powder of benzene alcohol containing lignins of plant material, the lignins are solubilized with acetyl bromide and analysed as a function of their absorption in ultraviolet light.
The invention more particularly relates to the use of the abovementioned processes for reducing the contents of lignins in plants to obtain genetically transformed fodder plants which have reduced lignin contents with respect to the normal contents of lignins in these plants, the digestibility of which is therefore found to be improved with respect to these same non-transformed plants.
Among the main fodder plants which can be transformed in the context of the present invention there may be mentioned: lucerne, fescue, maize for silaging etc . . . .
The invention also relates to the use of the abovementioned processes for reducing the contents of lignins in plants to obtain genetically transformed plants, and more particularly trees, having reduced lignin contents with respect to the normal contents of lignins in these plants, these plants or trees being particularly advantageous for use in the context of the production of paper pulp.
A third potential field of application of the abovementioned processes for negative regulation of the expression of the gene of the CCR relates to stimulation of the growth of the transformed plants. Various arguments (Sauter and Kende, 1992, Plant and Cell Physiology, 33 (8):1089) emphasize that early and rapid lignification is a restraint on cell enlargement and thus on the growth of plants. The use of the abovementioned processes is thus capable of allowing better growth and therefore better yields for the plants with reduced lignification transformed in this way.
The invention also relates to a process for increasing the amount of lignins produced by biosynthesis in plants, this process being carried out by transformation of the genome of these plants, incorporating:
at least one DNA sequence according to the invention represented by SEQ ID NO 1 or SEQ ID NO 3, or a fragment or a sequence derived from the latter, as are defined above,
and, where appropriate, at least one DNA sequence which codes for all or part of an enzyme other than the CCR, which is found to be involved in a stage of the biosynthesis of lignins in plants, in particular a DNA sequence which codes for all or part of CAD,
the said transformation being carried out:
either with the aid of a recombinant vector as is described above containing the abovementioned DNA sequence according to the invention, or a fragment or a sequence derived from the latter, as are defined above, and, where appropriate, containing one or more DNA sequence(s) which code(s) for all or part of an enzyme other than the CCR, as is defined above,
or with the aid of several recombinant vectors, at least one of which contains an abovementioned DNA sequence according to the invention, or a fragment or a sequence derived from the latter, as are defined above, while the other recombinant vector(s) contain(s) a DNA sequence which codes for all or part of an enzyme other than the CCR, as is defined above.
Generally, always considering that the normal average content of lignins in a plant varies between about 15% and about 35% by weight of dry matter, the increase in the content of lignins resulting from carrying out the abovementioned process is advantageously such that the plants thus transformed have an average content of lignins which varies between about 20% and about 40%, or even between about 18% and about 38%.
The invention more particularly relates to the use of the abovementioned process for increasing the content of lignins in plants (also called a process for over-expression of the gene of the CCR) to obtain genetically transformed plants having increased lignin contents with respect to the normal contents of lignins in these plants, of which the resistance properties to environmental attacks, in particular to parasitic attacks, are thus found to be improved with respect to these same non-transformed plants. In the latter case, it is particularly advantageous to use, in combination with the CCR gene, or a derived sequence, in the abovementioned vectors, specific promoters which are expressed particularly in the tissues of the surface and/or in response to wounding.
Furthermore, the invention also relates to the use of the abovementioned process of over-cxpression of the gene of the CCR for improving the growth of the plants genetically transformed in this way, in particular in certain sectors, such as horticulture or arboriculture, where it is desirable to obtain plants of reduced size.
Finally, the benzene rings of lignin have a higher intrinsic energy than the aliphatic chains of the glucose residues of cellulose. The increase by the abovementioned process of the invention in the proportion of lignin in plants used as fuels thus allows an improvement in the energy potential of these combustible plants.
In the two cases of negative regulation or of over-expression of the CCR, it is entirely foreseeable that the modulation of this activity has repercussions on the content of lignins in the transformed plants. In fact, the CCR, of which the level of activity is very low in the plant, seems to be the regulatory enzyme of lignin synthesis.
Regarding the transformation techniques used to carry out one of the processes of the invention which are described above, the following techniques will advantageously be used:
A) The technology of transformation by the intermediary of the plasmid Ti of Agrobacterium tumefaciens described by Bevan (1984) Nucleic Acid Research, 12, 8711-8721. This essentially makes use of the method of co-culture, and involves a co-transformation with a selection gene to be able to identify the transformants.
It is particularly applicable to dicotyledons, e.g.: tobacco, lucerne, rape.
B) The technique of direct transfer of genes by biolistics described in detail by (Zumbrum et al., 1989, Technique 1, 204-216; Sanford et al., 1991, Technique 3, 3-16).
This technique involves combination of the recombinant DNA according to the invention with microparticles of gold or tungsten, which are propelled with the aid of a particle gun onto the tissue to be transformed. It will be applied in particular to the transformation of species which are unaffected by Agrobacteria.
In the two abovementioned cases, verification of the presence of the recombinant DNA according to the invention will be carried out by hybridization experiments of the Southern type and gene amplification (polymerase chain reaction) with the aid of probes and oligonucleotide primers resulting from, in particular, the sequence SEQ ID NO 1 or SEQ ID NO 3.
The invention also relates to the cells of plants transformed by a vector according to the invention, in particular by the techniques described above, and containing a DNA sequence according to the invention integrated in their genome in a stable manner.
The invention also relates to the transformed plants such as are obtained by culture of the abovementioned transformed cells.
The transformed plants can then be propagated sexually or vegetatively in vitro or in natura.
The invention also relates to the fragments of plants, in particular fruits, seeds or pollen, transformed by incorporation into their genome of a DNA sequence according to the invention with the aid of the abovementioned recombinant vectors.
The invention also relates to antibodies directed against the recombinant polypeptides of the invention, and more particularly those directed against the abovementioned recombinant CCRs.
Such antibodies can be obtained by immunization of an animal with these polypeptides, followed by recovery of the antibodies formed.
It goes without saying that this production is not limited to polyclonal antibodies.
It is also applied to any monoclonal antibody produced by any hybridoma which is capable of being formed by conventional methods from the splenic cells of an animal, in particular the mouse or rat, immunized against one of the purified polypeptides of the invention on the one hand and cells of a suitable myeloma on the other hand, and of being selected by its capacity to produce monoclonal antibodies which recognize the abovementioned polypeptide initially used for immunization of the animals.
The invention also relates to the use of the abovementioned antibodies directed against the recombinant polypeptides of the invention for carrying out a method for detection or analysis of the CCRs in plants from samples taken from the latter.
It is appropriate to state that the nucleotide sequences represented by SEQ ID NO 5, SEQ ID NO 7, SEQ ID NO 9 and SEQ ID NO 11 which code, respectively, for the CCR of eucalyptus represented by SEQ ID NO 6, the CCR of poplar represented by SEQ ID NO 8, the CCR of fescue represented by SEQ ID NO 10 and the CCR of tobacco represented by SEQ ID NO 12, as well as the sequence represented by SEQ ID NO 13 which codes for the protein represented by SEQ ID NO 14 derived from the abovementioned CCR of eucalyptus, are excluded from the nucleotide sequences of the invention and their abovementioned use.
Furthermore, the sequences complementary to the nucleotide sequences SEQ ID NO 5, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 11 and SEQ ID NO 13, and also the fragments or sequences derived from these nucleotide sequences or from their complementary sequences, inasmuch as these fragments and derived sequences are identical to fragments and derived sequences as are defined above, nucleotide sequences represented by SEQ ID NO 1 and SEQ ID NO 3 or their complementary sequences, are excluded from the nucleotide sequences of the invention and their abovementioned use.
The following are also excluded from the context of the present invention:
the mRNAs coded by the DNA sequences represented by SEQ ID NO 5, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 11 and SEQ ID NO 13, or coded by a fragment or a sequence derived from these DNA sequences, inasmuch as this fragment or derived sequence are identical to fragments and derived sequences, as are defined above, of the sequences represented by SEQ ID NO 1 and SEQ ID NO 3,
the antisense mRNAs made up of nucleotides complementary to the abovementioned mRNAs,
the polypeptides represented by SEQ ID NO 6, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12 and SEQ ID NO 14, and also any fragment or sequence derived from the abovementioned polypeptides, inasmuch as this fragment or derived sequence are identical to the fragments and derived sequences, as are defined above, of the polypeptide sequences represented by SEQ ID NO 2 and SEQ ID NO 4.
Ihe invention will be detailed further in the description which follows for the preparation of the CCR in purified form in eucalyptus, and of the cDNA which codes for the CCR of eucalyptus, lucerne and maize.
A) Preparation of the Purified CCR of Eucalyptus and of the cDNA Which Codes for a CCR of Eucalyptus 1. Purification of the CCR of EucalyptusThe CCR has been the subject of a very limited number of studies. Among the few publications relating to it, there may be mentioned:
Wengenmayer H., Ebel J., Grisebach H., 1976—Enzymatic synthesis of lignin precursors, purification and properties of a cinnamoyl-CoA: NADPH reductase from cell suspension cultures from soybean (Glycine max), Eur. J. Biochem., 65, 529-536.
Luderitz T., Grisebach H., 1981—Enzymatic synthesis of lignin precursors, comparison of cinnamoyl: CoA reductase and cinnamyl alcohol dehydrogenase: NADP dehydrogenase from spruce (Picea abies L.) and soybean (Glycine max L.), Eur. J. Biochem., 119: 115-127.
Sarni F., Grand C., Boudet A. M., 1984—Purification and properties of cinnamoyl-CoA reductase and cinnamyl alcohol dehydrogenase from poplar stems (Populus x euramericana). Eur. J. Biochem., 139: 259-265.
The work described below has contributed to the definition of an original, simple and rapid protocol for the purification of the CCR of eucalyptus. This protocol is also more effective than those described previously in the literature. In fact, it has allowed, for the first time, the preparation of enzyme purified to homogeneity in amounts sufficient to obtain internal peptide sequences and to lead in time to cloning of the corresponding cDNA.
All the stages of purification of the CCR were carried out at 4° C.
1. Preparation of a Crude Extract of the Xylem of Eucalyptus.
The plant material was obtained by “scraping” a xylem-enriched tissue fraction from branches of Eucalyptus gunnii aged 5 years.
300 g xylem, frozen beforehand in liquid nitrogen, were reduced to a powder with the aid of a coffee grinder. The ground material thus obtained was homogenized in one litre of extraction buffer (100 mM Tris-HCl pH 7.6, 2% PEG 6000, 5 mM DTT, 2% PVPP), filtered over two layers of Miracloth, and brought to 30% saturation in ammonium sulphate. After centrifugation at 15,000×g for 30 minutes, the sediment obtained is resuspended in 60 ml of buffer 1 [20 mM Tris-HCl p7.5, 5 mM DTT (dithiothreitol), 5% ethylene glycol]. Ihe extract thus obtained is “clarified” by a centrifugation at 10,000×g for 15 min, and then desalinated by passage over Sephadex G25 equilibrated in buffer 1.
2. Affinity Chromatography on Red Sepharose.
The crude desalinated extract is deposited on a “Red Sepharose” affinity column (1.5×19 cm, Pharmacia), equilibrated in buffer 1. After a first rinsing of the column with 50 ml buffer 1, the proteins are eluted by a linear gradient of Tris from 20 mM to 1.5 M Tris-HCl pH 7.5, containing 5 mM DDT and 5% ethylene glycol. The total volume of the gradient is 200 ml and the flow rate is 36 ml/h. The fractions having a CCR activity are combined and desalinated by passage over a Sephadex G25 column equilibrated in buffer 1.
3. Anion Exchange Chromatography on MonoQ.
The fractions thus combined and desalinated are chromatographed over a MonoQ anion exchange column (HR 5/5, Pharmacia). Elution of the proteins is carried out by application of a linear gradient from 20 to 300 mM of Tris-HCl pH 7.5 containing 5% ethylene glycol and 5 mM DTT. The total volume of the gradient is 50 ml and the flow rate is 1 ml/min. As in the preceding stage, the fractions containing the active CCR enzyme are combined and desalinated, but in this case the equilibration buffer of the Sephadex G25 columns is a 20 mM phosphate buffer pH 7.6 containing 5 mM DTT (buffer 2).
4. Affinity Chromatography on “Mimetic Red”
The group of CCR fractions thus obtained is deposited on a Mimetic Red 2 A6XL column (ACL, Cambridge). The column is washed beforehand with 30 ml buffer 2 containing 8 mM NAD. The aim of this washing is to eliminate enzymes which function specifically with NAD as a cofactor, such as malate dehydrogenase, which is copurified with the CCR in the preceding stages. Specific elution of the CCR is obtained by application of an NADP gradient (15 ml) of 0-8 mM in buffer 2. The fractions containing the pure and active CCR are stored at −80° C., after addition of a stabilizer (ethylene glycol to a final concentration of 5%).
The purified enzyme thus obtained has a specific activity of 451 nKat/mg protein, using feruloyl-CoA as the substrate. The yield obtained (36 &mgr;g pure protein per 300 g plant starting material) does not reflect the proportion of CCR in planta, and in fact in a major effort to eliminate the maximum contamination at each purification stage, only the fractions having a very high CCR activity are treated in the following stage. The purification factor obtained by this protocol is 282.
II Characterization of the CCRThe CCR of eucalyptus is a monomer of 38 kD, as demonstrated by convergent results obtained for the size of the native enzyme by exclusion chromatography over Superose 6 (Pharmacia) and for the size of the monomer sub-unit on denaturing electrophoresis gel. The isoelectric point, estimated by chromatography over MonoP (Pharmacia) is close to 7.
Investigation of the optimum pH and buffer shows that measurement of the CCR activity as was initially described (Luderitz and Grisebach, 1981) is excellently suitable for measurement of the CCR activity of eucalyptus (100 mM phosphate buffer, pH 6.25).
The purity of the CCR present in the state of a single band on monodimensional electrophoresis gel (SDS PAGE) was confirmed by a single spot being obtained after bidimensional electrophoresis and staining with silver.
III Preparation of the cDNA Which Codes for the CCR of EucalyptusIn order to avoid any problem of undetectable residual contamination, the pure enzyme was subjected to preparative electrophoresis under semi-denaturing conditions and digested in situ in the gel. The digestion was carried out with the aid of endolysine C, which cuts proteins specifically after lysine residues, allowing the preparation of relatively long peptides. The peptides resulting from the digestion were separated by reverse phase HPLC, and some of them were sequenced with the aid of a protein microsequencer (Applied Biosystems 470). The sequences of these internal peptides are shown below:
peptide 8 (a) (SEQ ID NO: 15) Asn-Trp-Tyr-Cys-Tyr-Gly-Lys
(b) (SEQ ID NO: 16) His-Leu-Pro-Val-Pro-X-Pro-Pro-Glu-Asp-Ser-Val-Arg
X representing any amino acid
peptide 10 (SEQ ID NO: 17) Thr-Tyr-Ala-Asn-Ser-Val-Gln-Ala-Tyr-Val-His-Val-Lys
peptide 13 (SEQ ID NO: 18) Gly-Cys-Asp-Gly-Val-Val-His-Thr-Ala-Ser-Pro-Val-Thr-Asp-Asp
peptide 17 (SEQ ID NO: 19) Leu-Arg-Asp-Leu-Gly-Leu-Glu-Phe-Thr-Pro-Val-Lys
peptide 18 (SEQ ID NO: 20) Gly-Asp-Leu-Met-Asp-Tyr-Gly-Ser-Leu-Glu-Glu-Ala-Ile-Lys
The cDNA which codes for the CCR was obtained by screening, with the aid of oligonucleotides of a cDNA bank constructed in the phage &lgr; ZAPII (commercially available vector, Stratagène) from messengers extracted from the xylem of Eucalyptus gunnii. 600,000 phages were screened with the aid of a group of degenerated oligonucleotides marked at the 3′ end with 32phosphorus with the aid of a terminal transferase. The oligonucleotide sequences used for the screening were determined from the abovementioned internal peptide sequences. Since these peptides were generated by cutting with endolysine C, a lysine was added in the first position to allow production of oligonucleotides of less degeneration. In fact, this amino acid can be coded only by two codons, forms part of the amino acids of which the code is degenerated less, and consequently is entirely suitable for preparation of oligonucleotides from peptide sequences.
The oligonucleotide sequences used for screening the cDNA bank of eucalyptus which are derived from the amino acids underlined (I=inosine) are indicated below:
peptide 8 (a) (SEQ ID NO: 21) Lys-Asn-Trp-Tyr-Cys-Tyr-Gly-Lys
poligonucleotide 8 (SEQ ID NO: 22) AA(A/G)AA(C/T)TGGTA(C/T)TG(C/T)TA(T/C)GGIAA
peptide 13 (SEQ ID NO: 23) Lys-Gly-Cys-Asp-Gly-Val-Val-His-Thr-Ala-Ser-Pro-Val-Thr-Asp-Asp
oligonucleotide 13 (SEQ ID NO: 24) AA(G/A)GGITG(C/T)GA(C/T)GGIGTIGTICA
peptide 17 (SEQ ID NO: 25) Lys-Leu-Arg-Asp-Leu-Gly-Leu-Glu-Phe-Thr-Pro-Val-Lys
oligonucleotide 17 (SEQ ID NO: 26) GA/(G/A)TT(C/T)ACICCIGTIAA
peptide 18 (SEQ ID NO: 27) Lys-Gly-Asp-Leu-Met-Asp-Tyr-Gly-Ser-Leu-Glu-Glu-Ala-Ile-Lys
oligonucleotide 8 (SEQ ID NO: 28) AA(G/A)GGIGA(C/T)(C/T)TIATGGA(C/T)TA(C/T)GG
The hybridization conditions used for the screening are as follows: the prehybridization is carried out for 6 to 7 hours in 5×SSPE, 0.25% skimmed milk powder and 0.05% SDS (sodium dodecyl sulphate) at 42° C. The hybridization is carried out in this same solution in the presence of 4 oligonucleotides marked at 3′ by ddATP&agr;32P, for 24 hours at 42° C. At the end of these 24 hours of hybridization, the filters are washed three times for 15 minutes in 2×SSC and 0.1% SDS and then brought into contact with an autoradiography film for 24 hours at −80° C. The phages which hybridize with the group of oligonucleotides were purified by 2 supplementary screening cycles (“plate purification”). Once purified, the six positive clones were tested with each of the oligonucleotides taken independently. One phage reacted positively with the 4 oligonucleotides, and was treated in order to “excise” the recombinant Bluescript plasmid following the manufacturer's instructions (Stratagène). The restriction map of the insert (coding for the CCR) contained in this plasmid is shown in diagram form on FIG. 1.
IV Characterization and Identification of the cDNA of the CCRThe amino acid sequences (represented by SEQ ID NO 6) deduced from the nucleotide sequence (represented by SEQ ID NO 5) codes for a protein of 335 amino acids, the molecular weight of which is 36.5 kD and the isoelectric point of which is about 5.8. It is important to emphasize that all the peptide sequences obtained from the purified CCR are found in the peptide sequence deduced from the nucleotide sequence of the cDNA.
Investigations of homologies with already-existing clones were carried out using the BLAST and FASTA programs in all the available protein and nucleic banks. A significant homology was found with another reductase of the metabolism of phenolic compounds, dihydroflavonol reductase (DFR). The identity is about 40% and the similarity approaches 20% between the peptide sequence deduced from the cDNA of the CCR and the sequences of the various dihydroflavonol reductases catalogued in the banks, which confirms that the clone identified differs from a clone which codes for a DFR.
V Production of Active Recombinant CCR in E. coliFor all further work in the identification of the cDNA of the CCR, the recombinant protein was produced in E. coli and its enzymatic activity was investigated. The experimental details of this approach are described below.
1—Introduction of the cDNA into the Expression Vector pT7-7.
In order to be able to clone the cDNA in the expression vector pr7-7 (commercially available) under the control of the promoter of T7 polymerase, we had to introduce an NdeI site at the ATG of the cDNA. This was carried out with the aid of a Taq polymerase during a reaction for gene amplification by PCR (polymerase chain reaction) between a muted oligonucleotide and a commercial primer, T7, situated on the Bluescript downstream of the 3′ end of the cDNA. The amplification product obtained is digested by KpnI, this site is then repaired with the aid of the Klenow fragment of DNA polymerase I before the fragment is subjected to digestion by NdeI, and the fragment obtained, containing an NdeI site at 5′ and a free end at 3′, is then inserted with the aid of a T4 DNA ligase into the vector PT7-7, which has been opened beforehand by NdeI and SmaI.
The sequence of the abovementioned muted oligonucleotide is indicated below.
The bases underlined and in italics were modified with respect to the initial sequence, allowing the creation of an NdeI site (CATATG):
5′GGCAATCCCCATATGCCCGTCGACGC3 (SEQ ID NO: 29)
2. Over-expression of the CCR in E. coli BL21
The construction thus obtained is introduced into the strain E. coli BL21 (commercially available), which carries on its chromosome the gene of T7 polymerase under control of the promoter lac UV5, a promoter which can be induced by IPTG. The recombinant culture is cultured at 37° C. until the OD measured is 1 at 600 nm, and the production of the CCR is then induced by addition of IPTG (0.25% finally) to the culture medium. Samples are taken at various times after the induction, and the cells are lysed by the protocol described by Grima-Pettenati et al. (1993). After centrifugation, the supernatant containing the soluble proteins is used to measure the CCR activity and to visualize the production of CCR, after electrophoresis under denaturing conditions. The appearance of a polypeptide of about 38 kD, the intensity of which increases with the post-induction time and which does not exist in negative controls (strain BL21 containing only the vector pT7-7 without the insert), is found. Furthermore, the final proof of the identity of the CCR clone is provided by measurement of a CCR activity (about 7 nKat/ml culture after induction for 3 h at 37° C.) in the protein extracts originating from strains of BL21 containing only pT7-7+cDNA CCR.
The vector called pEUCCR (shown on FIG. 2), containing the sequence represented by SEQ ID NO 5 cloned in the Bluescript vector, has been deposited in culture in cells of E. coli DH5&agr; at the Collection Nationale de Culture de Micro-organismes [National Culture Collection of Micro-organisms] (CNCM) of the Institut Pasteur in Paris (France) on March 17th, 1994 under no. I-1405.
LEGEND TO THE FIGURESFIG. 1: Restriction map of the cDNA which codes for the CCR of eucalyptus.
FIG. 2: Schematic representation of the plasmid pEUCCR containing the sequence represented by SEQ ID NO 5 (and identified by CCR in the plasmid pEUCCR).
FIG. 3: Schematic representation of the construction of a vector containing a DNA sequence which codes for the CCR of eucalyptus according to the invention (or sense CCR vector).
FIG. 4: Schematic representation of the construction of a vector containing a DNA sequence which codes for an antisense RNA which is capable of hybridizing with the mRNA which codes for the CCR of eucalyptus according to the invention (or antisense CCR vector).
REGARDING THE DNA SOURCE SERVING FOR THE CONSTRUCTION OF AN ANTISENSE (OR SENSE) VECTORThe antisense RNA is preferentially derived from the sequence contained in the clone pEUCCR. This sequence can be obtained in various ways:
1) by cutting the DNA (cDNA) sequence of the CCR contained in pEUCCR with suitable restriction enzymes,
2) by performing a gene amplification (PCR) with the aid of defined oligonucleotides such that the desired DNA fragment is synthesized.
The DNA fragment thus obtained is cloned in an expression vector of plants downstream of a promoter and upstream of a terminator. The cloning is carried out such that the DNA fragment is inserted in reverse orientation with respect to the promoter. In this new vector, the strand which was initially the matrix strand becomes the coding strand and vice versa.
The new vector codes for an RNA, the sequence of which is complementary to the messenger RNA sequence deduced from the sequence contained in pEUCCR.
The 2 RNAs are thus complementary by their sequence and also by their orientation (5′-3′).
As the source of DNA for transcription of the antisense RNA, it is appropriate to use a cDNA clone such as that contained in pEUCCR.
Example of Antisense Cloning (cf. FIG. 4)
The cDNA of the CCR is obtained by a double digestion (BamHI and KpnI) from the vector pEUCCR. The DNA fragment thus liberated is separated physically from the cloning vector by an agarose gel electrophoresis (Bluescript).
The part of the gel containing this DNA fragment is cut out and treated to obtain the purified DNA (several methods can be used, including “low-melting agarose” described in Sambrook et al. loc. cit., and Gene Clean, the kit of which is commercially available).
The fragment which carries the BamHI and KpnI ends is “ligated” with an expression vector of plants which has been digested beforehand by these same enzymes, chosen such that the cDNA is inserted in reverse orientation with respect to the promoter 35S. The strand which will be transcribed in the plants will in this case be the non-coding strand.
Example of Sense Cloning (cf. FIG. 3)
In this case, there are no “practical” restriction sites for realizing translational fusion with the promoter 35S of the expression vector. More convenient new sites were inserted with the aid of the gene amplification technique (PCR). Two oligonucleotides have been defined at 5′ and 3′ of the cDNA, to which have been added the sequences of sites recognized by KpnI and BamHI (NB: these are the same sites as have been used for the abovementioned antisense cloning, but are positioned differently with respect to the 5′-3′ orientation).
Gene amplification leads to a fragment containing all the coding sequence of the cDNA flanked by 2 restriction sites being obtained. The subsequent procedure is identical to that described for the antisense construction.
In this case, however, a fusion of the promoter in phase with the ATG of the CCR has been realized, which must lead to an over-expression of the messenger RNA and therefore of the protein CCR.
The examples of cloning of sense and antisense sequences described above in the case of the CCR of eucalyptus can also be applied in the case of the CCR of lucerne and that of maize.
B) Preparation of the cDNA Which Codes for the CCR of Lucerne (Medicago truncatula)Characteristics of the cDNA Bank:
The bank used was constructed from total RNA extracts of roots of Medicago truncatula in the vector &lgr;ZAPH (“ZAP-cDNA synthesis” kit from Stratagène).
Screening of the cDNA Bank:
Probe:
Screening of the lucerne bank was carried out with the aid of the cDNA which codes for the CCR of eucalyptus. A fragment of 800 bp (Xho-Xho) of pEUCCR marked by the technique of random priming was used as the probe.
Display of the Bank and Imprints on Nitrocellulose Filter:
300,000 clones were displayed and then transferred to the nitrocellulose filter (Schleicher & Schuell). For this, the filters were placed on the culture boxes for 5 min and then immersed successively in the following solutions:
1.5M NaCl/0.5M NaOH 5 min 1.5M NaCl/0.5M Tris pH 8 5 min 3 × SSC 2 minheating for 2 hours at 80° C.
Prehybridization-hybridization:
The filters were prehybridized for 12 hours and then hybridized for 24 hours at 37° C. in the following medium:
Prehybridization and hybridization medium:
formamide 20%
dextran 10%
NaCl 1 M
DNA of salmon sperm (1 mg/ml)
0.2% polyvinylpyrrolidone
0.2% BSA
0.2% ficoll
0.05 M Tris-HCl pH 7.5
0.1% sodium pyrophosphate
1% SDS.
After hybridization, the filters were washed 2× for 10 min at ambient temperature in 2×SSC-1% SDS, and then 2× for 30 min at 55° C. in the same solution.
After autoradiographic exposure of the filters, 15 positive lysis areas were identified. These lysis areas were purified by two additional screening cycles under the hybridization conditions described above.
Excision in vivo:
From the positive clones, the Bluescript plasmid of the &lgr; phage was excised by the in vivo excision protocol of the “ZAP-cDNA synthesis kit”.
The CCR cDNA of lucerne:
The cDNA which codes for the CCR of lucerne, 1,404 bp in size, is inserted into the EcoRI (5′ side) and Xho (3′ side) sites of the Bluescript vector. It is made up of the following parts:
a non-translated transcribed 5′ part of 167 bp,
a region of 1,028 bp which codes for a protein of 342 amino acids,
a non-translated transcribed 3′ part of 209 bp.
The cDNA obtained is represented by SEQ ID NO 1, and the sequence of amino acids deduced from this cDNA is represented by SEQ ID NO 2.
C) Preparation of the cDNA Which Codes for the CCR of MaizeCharacteristics of the cDNA Bank:
The bank used was constructed from total RNA extracts from the roots of maize (variety AMO 406) deprived of iron, in the vector &lgr;ZAP (“ZAP-cDNA synthesis” kit from Stratagène).
Screening of the cDNA Bank:
Probe:
Screening of the maize bank was carried out with the aid of the CCR cDNA of eucalyptus. A fragment of 800 bp (Xho-Xho) of pEUCCR marked by the technique of random priming was used as the probe.
Display of the Bank and Imprints on Nitrocellulose Filter:
500,000 clones were displayed and then transferred to the nitrocellulose filter (Schleicher & Schuell). For this, the filters were placed on the culture boxes for 5 min and then immersed successively in the following solutions:
1.5M NaCl/0.5M NaOH 5 min 1.5M NaCl/0.5M Tris pH 8 5 min 3 × SSC 2 minheating at 80° C. for 2 hours.
Prehybridization-hybridization:
The filters were prehybridized for 12 hours and then hybridized for 24 hours at 55° C. in the following medium:
Prehybridization and hybridization medium:
3×SSC
0.5% SDS
0.1% powdered milk
DNA of salmon sperm (1 mg/ml).
After hybridization, the filters were washed 2× for 10 min at ambient temperature in 3× SSC-0.5% SDS, and then 2× for 45 min at 60° C. in the same solution.
After autoradiographic exposure of the filters, 20 positive lysis areas were identified. These lysis areas were purified by 3 additional screening cycles under the hybridization conditions described above.
Excision in vivo:
From the positive clones, the Bluescript plasmid of the &lgr; phage was excised by the in vivo excision protocol of the “ZAP-cDNA synthesis kit”.
The cDNA obtained is represented by SEQ ID NO 3, and the sequence of amino acids deduced from this cDNA is represented by SEQ ID NO 4.
29 1568 base pairs nucleic acid double linear cDNA to mRNA unknown CDS 278..1306 1 CATGATTACG CCAAGCTCGA AATTAACCCT CACTAAAGGG AACAAAAGCT GGAGCTCCAC 60 CGCGGTGGCG GCCGCTCTAG AACTAGTGGA TCCCCCGGGC TGCAGGAATT CGGCACGAG 120 GGATAGAGAA GAAAGGTGGT CATATTTCCC ACTTATTATT ACAAAGTAAC GTCACACCA 180 CTTTATCACC ACCTTTCTTC TCTATCCCAT TCATTCTCAT TCATTCATTC ACCTCACCT 240 ACCTCACCTC ACCTCCCTTT ACAAGAAGAA GGAATAT ATG CCT GCC GCT ACC GCA 295 Met Pro Ala Ala Thr Ala 1 5 GCC GCC GCC GCC GAA TCT TCC TCA GTT TCC GGC GAA ACC ATA TGT GTC 343 Ala Ala Ala Ala Glu Ser Ser Ser Val Ser Gly Glu Thr Ile Cys Val 10 15 20 ACC GGG GCC GGT GGC CTC ATC GCT TCT TGG ATG GTT AAG CTC CTC TTG 391 Thr Gly Ala Gly Gly Leu Ile Ala Ser Trp Met Val Lys Leu Leu Leu 25 30 35 GAG AAA GGC TAT ACC GTT CGA GGA ACC TTG CGA AAC CCA GAT GAT CCA 439 Glu Lys Gly Tyr Thr Val Arg Gly Thr Leu Arg Asn Pro Asp Asp Pro 40 45 50 AAA AAT GGG CAC TTG AAA AAG TTG GAA GGA GCA AAA GAA AGG CTA ACT 487 Lys Asn Gly His Leu Lys Lys Leu Glu Gly Ala Lys Glu Arg Leu Thr 55 60 65 70 TTG GTC AAA GTT GAT CTC CTT GAT CTT AAC TCC GTT AAA GAA GCT GTT 535 Leu Val Lys Val Asp Leu Leu Asp Leu Asn Ser Val Lys Glu Ala Val 75 80 85 AAT GGA TGT CAT GGT GTC TTT CAC ACT GCT TCT CCC GTT ACA GAT AAC 583 Asn Gly Cys His Gly Val Phe His Thr Ala Ser Pro Val Thr Asp Asn 90 95 100 CCC GAG GAA ATG GTG GAG CCA GCA GTG AAT GGA GCA AAG AAT GTG ATC 631 Pro Glu Glu Met Val Glu Pro Ala Val Asn Gly Ala Lys Asn Val Ile 105 110 115 ATA GCT GGT GCA GAA GCA AAA GTG AGG CGC GTG GTT TTC ACA TCA TCA 679 Ile Ala Gly Ala Glu Ala Lys Val Arg Arg Val Val Phe Thr Ser Ser 120 125 130 ATT GGT GCA GTC TAT ATG GAC CCC AAT AGG AGT GTT GAT GTA GAG GTT 727 Ile Gly Ala Val Tyr Met Asp Pro Asn Arg Ser Val Asp Val Glu Val 135 140 145 150 GAT GAG TCT TGC TGG AGT GAT TTG GAG TTT TGC AAG AAA ACC AAG AAT 775 Asp Glu Ser Cys Trp Ser Asp Leu Glu Phe Cys Lys Lys Thr Lys Asn 155 160 165 TGG TAT TGC TAT GGG AAA GCA GTG GCA GAA GCA GCA GCA TGG GAT GTA 823 Trp Tyr Cys Tyr Gly Lys Ala Val Ala Glu Ala Ala Ala Trp Asp Val 170 175 180 GCA AAA GAG AAA GGT GTG GAT TTG GTT GTA GTG AAT CCA GTT TTG GTT 871 Ala Lys Glu Lys Gly Val Asp Leu Val Val Val Asn Pro Val Leu Val 185 190 195 CTT GGA CCA TTG CTA CAA CCT ACA ATC AAT GCA AGC ACA ATT CAC ATA 919 Leu Gly Pro Leu Leu Gln Pro Thr Ile Asn Ala Ser Thr Ile His Ile 200 205 210 CTA AAA TAC CTA ACT GGT TCA GCT AAG ACC TAT GCA AAT GCA ACA CAA 967 Leu Lys Tyr Leu Thr Gly Ser Ala Lys Thr Tyr Ala Asn Ala Thr Gln 215 220 225 230 GCT TAT GTT CAT GTT AGG GAT GTT GCA TTA GCT CAC ATA CTT GTT TAT 1015 Ala Tyr Val His Val Arg Asp Val Ala Leu Ala His Ile Leu Val Tyr 235 240 245 GAG AAA CCT TCT GCT TCT GGT AGA TAC TTA TGT GCT GAA ACT TCA CTT 1063 Glu Lys Pro Ser Ala Ser Gly Arg Tyr Leu Cys Ala Glu Thr Ser Leu 250 255 260 CAT CGT GGG GAG CTT GTT GAA ATT CTT GCT AAG TAT TTC CCT GAG TAC 1111 His Arg Gly Glu Leu Val Glu Ile Leu Ala Lys Tyr Phe Pro Glu Tyr 265 270 275 CCA ATT CCT ACC AAG TGT TCA GAT GAA AAG AAT CCT CGA GTG AAA CCA 1159 Pro Ile Pro Thr Lys Cys Ser Asp Glu Lys Asn Pro Arg Val Lys Pro 280 285 290 CAT ATC TTC TCA AAT AAA AAA CTG AAG GAT TTG GGA TTG GAA TTT ACA 1207 His Ile Phe Ser Asn Lys Lys Leu Lys Asp Leu Gly Leu Glu Phe Thr 295 300 305 310 CCA GTG AGT GAA TGT TTA TAT GAA ACC GTT AAG AGC CTA CAA GAC CAA 1255 Pro Val Ser Glu Cys Leu Tyr Glu Thr Val Lys Ser Leu Gln Asp Gln 315 320 325 GGT CAC CTT TCT ATT CCA AAC AAA GAA GAT TCT CTA GCA GTC AAA TCC 1303 Gly His Leu Ser Ile Pro Asn Lys Glu Asp Ser Leu Ala Val Lys Ser 330 335 340 TAAACCAACC ATCCTTTGTT AACAAGTTCA ATTCAGGGCC AAAAAGAATC ATCTTTTA 1363 TACCTGCGAG GCTTTAGGCT CTAGCAATTT GATACTATAA ATGACCGTAA TTGGATGG 1423 AGTTGTAAGA AAGTATCATG CTAGAATTTA CTATTTGTCT TTATGTTTGA AAAATAAG 1483 CATTATATTA AAAAAAAAAA AAAAAAAAAA AACTCGAGGG GGGGCCCGGT ACCCAATT 1543 CCCTATAGTG AGTCGTATTA CAATT 1568 342 amino acids amino acid linear protein unknown 2 Met Pro Ala Ala Thr Ala Ala Ala Ala Ala Glu Ser Ser Ser Val Ser 1 5 10 15 Gly Glu Thr Ile Cys Val Thr Gly Ala Gly Gly Leu Ile Ala Ser Trp 20 25 30 Met Val Lys Leu Leu Leu Glu Lys Gly Tyr Thr Val Arg Gly Thr Leu 35 40 45 Arg Asn Pro Asp Asp Pro Lys Asn Gly His Leu Lys Lys Leu Glu Gly 50 55 60 Ala Lys Glu Arg Leu Thr Leu Val Lys Val Asp Leu Leu Asp Leu Asn 65 70 75 80 Ser Val Lys Glu Ala Val Asn Gly Cys His Gly Val Phe His Thr Ala 85 90 95 Ser Pro Val Thr Asp Asn Pro Glu Glu Met Val Glu Pro Ala Val Asn 100 105 110 Gly Ala Lys Asn Val Ile Ile Ala Gly Ala Glu Ala Lys Val Arg Arg 115 120 125 Val Val Phe Thr Ser Ser Ile Gly Ala Val Tyr Met Asp Pro Asn Arg 130 135 140 Ser Val Asp Val Glu Val Asp Glu Ser Cys Trp Ser Asp Leu Glu Phe 145 150 155 160 Cys Lys Lys Thr Lys Asn Trp Tyr Cys Tyr Gly Lys Ala Val Ala Glu 165 170 175 Ala Ala Ala Trp Asp Val Ala Lys Glu Lys Gly Val Asp Leu Val Val 180 185 190 Val Asn Pro Val Leu Val Leu Gly Pro Leu Leu Gln Pro Thr Ile Asn 195 200 205 Ala Ser Thr Ile His Ile Leu Lys Tyr Leu Thr Gly Ser Ala Lys Thr 210 215 220 Tyr Ala Asn Ala Thr Gln Ala Tyr Val His Val Arg Asp Val Ala Leu 225 230 235 240 Ala His Ile Leu Val Tyr Glu Lys Pro Ser Ala Ser Gly Arg Tyr Leu 245 250 255 Cys Ala Glu Thr Ser Leu His Arg Gly Glu Leu Val Glu Ile Leu Ala 260 265 270 Lys Tyr Phe Pro Glu Tyr Pro Ile Pro Thr Lys Cys Ser Asp Glu Lys 275 280 285 Asn Pro Arg Val Lys Pro His Ile Phe Ser Asn Lys Lys Leu Lys Asp 290 295 300 Leu Gly Leu Glu Phe Thr Pro Val Ser Glu Cys Leu Tyr Glu Thr Val 305 310 315 320 Lys Ser Leu Gln Asp Gln Gly His Leu Ser Ile Pro Asn Lys Glu Asp 325 330 335 Ser Leu Ala Val Lys Ser 340 1556 base pairs nucleic acid double linear cDNA to mRNA unknown CDS 195..1310 3 GTTCCCATGA TTACGCCAAG CTCGAAATTA ACCCTCACTA AAGGGAACAA AAGCTGGAGC 60 TCCACCGCGG TGGCGGCCGC TCTAGAACTA GTGGATCCCC CGGGCTGCAG GAATTCGGC 120 CGAGAGGACA CAAGCGAGCG CTAGCCAGAA GAGCAGCTGC AGGTACTATT ATCATCGTC 180 TCGTCGTCGC CAGG ATG ACC GTC GTC GAC GCC GTC GTC TCC TCC ACC GAT 230 Met Thr Val Val Asp Ala Val Val Ser Ser Thr Asp 1 5 10 GCC GGC GCC CCT GCC GCC GCC GCC GCA CCG GTA CCG GCG GGG AAC GGG 278 Ala Gly Ala Pro Ala Ala Ala Ala Ala Pro Val Pro Ala Gly Asn Gly 15 20 25 CAG ACC GTG TGC GTC ACC GGC GCG GCC GGG TAC ATC GCC TCG TGG TTG 326 Gln Thr Val Cys Val Thr Gly Ala Ala Gly Tyr Ile Ala Ser Trp Leu 30 35 40 GTG AAG CTG CTG CTC GAG AAG GGA TAC ACT GTG AAG GGC ACC GTG AGG 374 Val Lys Leu Leu Leu Glu Lys Gly Tyr Thr Val Lys Gly Thr Val Arg 45 50 55 60 AAC CCA GAT GAC CCG AAG AAC GCG CAC CTC AGG GCG CTG GAC GGC GCC 422 Asn Pro Asp Asp Pro Lys Asn Ala His Leu Arg Ala Leu Asp Gly Ala 65 70 75 GCC GAG CGG CTG ATC CTC TGC AAG GCC GAT CTG CTG GAC TAC GAC GCC 470 Ala Glu Arg Leu Ile Leu Cys Lys Ala Asp Leu Leu Asp Tyr Asp Ala 80 85 90 ATC TGC CGC GCC GTG CAG GGC TGC CAG GGC GTC TTC CAC ACC GCC TCC 518 Ile Cys Arg Ala Val Gln Gly Cys Gln Gly Val Phe His Thr Ala Ser 95 100 105 CCC GTC ACC GAC GAC CCG GAG CAA ATG GTG GAG CCG GCG GTG CGC GGC 566 Pro Val Thr Asp Asp Pro Glu Gln Met Val Glu Pro Ala Val Arg Gly 110 115 120 ACC GAG TAC GTG ATC AAC GCG GCG GCG GAG GCC GGC ACG GTG CGG CGG 614 Thr Glu Tyr Val Ile Asn Ala Ala Ala Glu Ala Gly Thr Val Arg Arg 125 130 135 140 GTG GTG TTC ACG TCG TCC ATC GGC GCC GTG ACC ATG GAC CCC AAG CGC 662 Val Val Phe Thr Ser Ser Ile Gly Ala Val Thr Met Asp Pro Lys Arg 145 150 155 GGG CCC GAC GTC GTG GTC GAC GAG TCG TGC TGG AGC GAC CTC GAG TTC 710 Gly Pro Asp Val Val Val Asp Glu Ser Cys Trp Ser Asp Leu Glu Phe 160 165 170 TGC GAG AAA ACC AGG AAC TGG TAC TGC TAC GGC AAG GCG GTG GCG GAG 758 Cys Glu Lys Thr Arg Asn Trp Tyr Cys Tyr Gly Lys Ala Val Ala Glu 175 180 185 CAG GCG GCG TGG GAG GCG GCC CGG CGG CGG GGC GTG GAC CTG GTG GTG 806 Gln Ala Ala Trp Glu Ala Ala Arg Arg Arg Gly Val Asp Leu Val Val 190 195 200 GTG AAC CCC GTG CTG GTG GTG GGC CCC CTG CTG CAG GCG ACG GTG AAC 854 Val Asn Pro Val Leu Val Val Gly Pro Leu Leu Gln Ala Thr Val Asn 205 210 215 220 GCC AGC ATC GCG CAC ATC CTC AAG TAC CTG GAC GGC TCG GCC CGC ACC 902 Ala Ser Ile Ala His Ile Leu Lys Tyr Leu Asp Gly Ser Ala Arg Thr 225 230 235 TTC GCC AAC GCC GTG CAG GCG TAC GTG GAC GTG CGC GAC GTG GCC GAC 950 Phe Ala Asn Ala Val Gln Ala Tyr Val Asp Val Arg Asp Val Ala Asp 240 245 250 GCG CAC CTC CGC GTC TTC GAG AGC CCC CGC GCG TCC GGC CGC CAC CTC 998 Ala His Leu Arg Val Phe Glu Ser Pro Arg Ala Ser Gly Arg His Leu 255 260 265 TGC GCC GAG CGC GTC CTC CAC CGC GAG GAC GTC GTC CGC ATC CTC GCC 1046 Cys Ala Glu Arg Val Leu His Arg Glu Asp Val Val Arg Ile Leu Ala 270 275 280 AAG CTC TTC CCC GAG TAC CCC GTC CCA GCC AGG TGC TCC GAC GAG GTG 1094 Lys Leu Phe Pro Glu Tyr Pro Val Pro Ala Arg Cys Ser Asp Glu Val 285 290 295 300 AAT CCG CGG AAG CAG CCG TAC AAG TTC TCC AAC CAG AAG CTC CGG GAC 1142 Asn Pro Arg Lys Gln Pro Tyr Lys Phe Ser Asn Gln Lys Leu Arg Asp 305 310 315 CTG GGG CTG CAG TTC CGG CCG GTC AGC CAG TCG CTT TAC GAC ACG GTG 1190 Leu Gly Leu Gln Phe Arg Pro Val Ser Gln Ser Leu Tyr Asp Thr Val 320 325 330 AAG AAC CTC CAG GAG AAG GGC CAC CTG CCG GTG CTC GGA GAG CGG ACG 1238 Lys Asn Leu Gln Glu Lys Gly His Leu Pro Val Leu Gly Glu Arg Thr 335 340 345 ACG ACG GAG GCC GCC GAC AAG GAT GCC CCC GCG GCC GAG ATG CAG CAG 1286 Thr Thr Glu Ala Ala Asp Lys Asp Ala Pro Ala Ala Glu Met Gln Gln 350 355 360 GGA GGG ATC GCC ATC CGT GCC TGAGAGGGCG ATGCCACACA TGAACACCAA 1337 Gly Gly Ile Ala Ile Arg Ala 365 370 AGCAATGTTC ATACTGCTGC CCTGCACCTG CACCTTCCCC TGCTGTGTAA ACAGGCCT 1397 GTTTGTTCTG GCTGATAGTG ATGTACCCTA AGACTTGTAA CGTCATGTTC GTTCTTGT 1457 ACTATAGCGA GTGAATAAAA TTGGTTAATG TTGGATAATT CCAAAAAAAA AAAAAAAA 1517 CTCGAGGGGG GGCCCGGTAC CCAATTCGCC CTATAGTGA 1556 371 amino acids amino acid linear protein unknown 4 Met Thr Val Val Asp Ala Val Val Ser Ser Thr Asp Ala Gly Ala Pro 1 5 10 15 Ala Ala Ala Ala Ala Pro Val Pro Ala Gly Asn Gly Gln Thr Val Cys 20 25 30 Val Thr Gly Ala Ala Gly Tyr Ile Ala Ser Trp Leu Val Lys Leu Leu 35 40 45 Leu Glu Lys Gly Tyr Thr Val Lys Gly Thr Val Arg Asn Pro Asp Asp 50 55 60 Pro Lys Asn Ala His Leu Arg Ala Leu Asp Gly Ala Ala Glu Arg Leu 65 70 75 80 Ile Leu Cys Lys Ala Asp Leu Leu Asp Tyr Asp Ala Ile Cys Arg Ala 85 90 95 Val Gln Gly Cys Gln Gly Val Phe His Thr Ala Ser Pro Val Thr Asp 100 105 110 Asp Pro Glu Gln Met Val Glu Pro Ala Val Arg Gly Thr Glu Tyr Val 115 120 125 Ile Asn Ala Ala Ala Glu Ala Gly Thr Val Arg Arg Val Val Phe Thr 130 135 140 Ser Ser Ile Gly Ala Val Thr Met Asp Pro Lys Arg Gly Pro Asp Val 145 150 155 160 Val Val Asp Glu Ser Cys Trp Ser Asp Leu Glu Phe Cys Glu Lys Thr 165 170 175 Arg Asn Trp Tyr Cys Tyr Gly Lys Ala Val Ala Glu Gln Ala Ala Trp 180 185 190 Glu Ala Ala Arg Arg Arg Gly Val Asp Leu Val Val Val Asn Pro Val 195 200 205 Leu Val Val Gly Pro Leu Leu Gln Ala Thr Val Asn Ala Ser Ile Ala 210 215 220 His Ile Leu Lys Tyr Leu Asp Gly Ser Ala Arg Thr Phe Ala Asn Ala 225 230 235 240 Val Gln Ala Tyr Val Asp Val Arg Asp Val Ala Asp Ala His Leu Arg 245 250 255 Val Phe Glu Ser Pro Arg Ala Ser Gly Arg His Leu Cys Ala Glu Arg 260 265 270 Val Leu His Arg Glu Asp Val Val Arg Ile Leu Ala Lys Leu Phe Pro 275 280 285 Glu Tyr Pro Val Pro Ala Arg Cys Ser Asp Glu Val Asn Pro Arg Lys 290 295 300 Gln Pro Tyr Lys Phe Ser Asn Gln Lys Leu Arg Asp Leu Gly Leu Gln 305 310 315 320 Phe Arg Pro Val Ser Gln Ser Leu Tyr Asp Thr Val Lys Asn Leu Gln 325 330 335 Glu Lys Gly His Leu Pro Val Leu Gly Glu Arg Thr Thr Thr Glu Ala 340 345 350 Ala Asp Lys Asp Ala Pro Ala Ala Glu Met Gln Gln Gly Gly Ile Ala 355 360 365 Ile Arg Ala 370 1297 base pairs nucleic acid double linear cDNA to mRNA unknown CDS 136..1140 5 CGGCCGGGAC GACCCGTTCC TCTTCTTCCG GGTCACCGTC ACCATGTTAC ACAACATCTC 60 CGGCTAAAAA AAAAAGGAAA AAAAGCGCAA CCTCCACCTC CTGAACCCCT CTCCCCCCT 120 GCCGGCAATC CCACC ATG CCC GTC GAC GCC CTC CCC GGT TCC GGC CAG ACC 171 Met Pro Val Asp Ala Leu Pro Gly Ser Gly Gln Thr 1 5 10 GTC TGC GTC ACC GGC GCC GGC GGG TTC ATC GCC TCC TGG ATT GTC AAG 219 Val Cys Val Thr Gly Ala Gly Gly Phe Ile Ala Ser Trp Ile Val Lys 15 20 25 CTT CTC CTC GAG CGA GGC TAC ACC GTG CGA GGA ACC GTC AGG AAC CCA 267 Leu Leu Leu Glu Arg Gly Tyr Thr Val Arg Gly Thr Val Arg Asn Pro 30 35 40 GAC GAC CCG AAG AAT GGT CAT CTG AGA GAT CTG GAA GGA GCC AGC GAG 315 Asp Asp Pro Lys Asn Gly His Leu Arg Asp Leu Glu Gly Ala Ser Glu 45 50 55 60 AGG CTG ACG CTG TAC AAG GGT GAT CTG ATG GAC TAC GGG AGC TTG GAA 363 Arg Leu Thr Leu Tyr Lys Gly Asp Leu Met Asp Tyr Gly Ser Leu Glu 65 70 75 GAA GCC ATC AAG GGG TGC GAC GGC GTC GTC CAC ACC GCC TCT CCG GTC 411 Glu Ala Ile Lys Gly Cys Asp Gly Val Val His Thr Ala Ser Pro Val 80 85 90 ACC GAC GAT CCT GAG CAA ATG GTG GAG CCA GCG GTG ATC GGG ACG AAA 459 Thr Asp Asp Pro Glu Gln Met Val Glu Pro Ala Val Ile Gly Thr Lys 95 100 105 AAT GTG ATC GTC GCA GCG GCG GAG GCC AAG GTC CGG CGG GTT GTG TTC 507 Asn Val Ile Val Ala Ala Ala Glu Ala Lys Val Arg Arg Val Val Phe 110 115 120 ACC TCC TCC ATC GGT GCA GTC ACC ATG GAC CCC AAC CGG GCA GAC GTT 555 Thr Ser Ser Ile Gly Ala Val Thr Met Asp Pro Asn Arg Ala Asp Val 125 130 135 140 GTG GTG GAC GAG TCT TGT TGG AGC GAC CTC GAA TTT TGC AAG AGC ACT 603 Val Val Asp Glu Ser Cys Trp Ser Asp Leu Glu Phe Cys Lys Ser Thr 145 150 155 AAG AAC TGG TAT TGC TAC GGC AAG GCA GTG GCG GAG AAG GCC GCT TGG 651 Lys Asn Trp Tyr Cys Tyr Gly Lys Ala Val Ala Glu Lys Ala Ala Trp 160 165 170 CCA GAG GGC AAG GAG AGA GGG GTT GAC CTC GTG GTG ATT AAC CCT GTG 699 Pro Glu Gly Lys Glu Arg Gly Val Asp Leu Val Val Ile Asn Pro Val 175 180 185 CTC GTG CTT GGA CCG CTC CTT CAG TCG ACG ATC AAT GCG AGC ATC ATC 747 Leu Val Leu Gly Pro Leu Leu Gln Ser Thr Ile Asn Ala Ser Ile Ile 190 195 200 CAC ATC CTC AAG TAC TTG ACT GGC TCA GCC AAG ACC TAC GCC AAC TCG 795 His Ile Leu Lys Tyr Leu Thr Gly Ser Ala Lys Thr Tyr Ala Asn Ser 205 210 215 220 GTC CAG GCG TAC GTG CAC GTC AAG GAC GTC GCG CTT GCC CAC GTC CTT 843 Val Gln Ala Tyr Val His Val Lys Asp Val Ala Leu Ala His Val Leu 225 230 235 GTC TTG GAG ACC CCA TCC GCC TCA GGC CGC TAT TTG TGC GCC GAG AGC 891 Val Leu Glu Thr Pro Ser Ala Ser Gly Arg Tyr Leu Cys Ala Glu Ser 240 245 250 GTC CTC CAC CGT GGC GAT GTG GTG GAA ATC CTT GCC AAG TTC TTC CCT 939 Val Leu His Arg Gly Asp Val Val Glu Ile Leu Ala Lys Phe Phe Pro 255 260 265 GAG TAT AAT GTA CCG ACC AAG TGC TCT GAT GAG GTG AAC CCA AGA GTA 987 Glu Tyr Asn Val Pro Thr Lys Cys Ser Asp Glu Val Asn Pro Arg Val 270 275 280 AAA CCA TAC AAG TTC TCC AAC CAG AAG CTG AGA GAC TTG GGG CTC GAG 1035 Lys Pro Tyr Lys Phe Ser Asn Gln Lys Leu Arg Asp Leu Gly Leu Glu 285 290 295 300 TTC ACC CCG GTG AAG CAG TGC CTG TAC GAA ACT GTC AAG AGC TTG CAG 1083 Phe Thr Pro Val Lys Gln Cys Leu Tyr Glu Thr Val Lys Ser Leu Gln 305 310 315 GAG AAA GGC CAC CTA CCA GTC CCC TCC CCG CCG GAA GAT TCG GTG CGT 1131 Glu Lys Gly His Leu Pro Val Pro Ser Pro Pro Glu Asp Ser Val Arg 320 325 330 ATT CAG GGA TGATCTTAGA TCCATCACGG TGCGCATTTG TAATCCGGAG 1180 Ile Gln Gly 335 AAATGAGAGA AACATGTGGG AATTTGTTTG TACTTTTCTA AGTCAAACCT GGAGATAC 1240 ACCCTGAGTT CTGCATTGGA ATGGAAGTTG TCAATTGTTC CAAAAAAAAA AAAAAAA 1297 335 amino acids amino acid linear protein unknown 6 Met Pro Val Asp Ala Leu Pro Gly Ser Gly Gln Thr Val Cys Val Thr 1 5 10 15 Gly Ala Gly Gly Phe Ile Ala Ser Trp Ile Val Lys Leu Leu Leu Glu 20 25 30 Arg Gly Tyr Thr Val Arg Gly Thr Val Arg Asn Pro Asp Asp Pro Lys 35 40 45 Asn Gly His Leu Arg Asp Leu Glu Gly Ala Ser Glu Arg Leu Thr Leu 50 55 60 Tyr Lys Gly Asp Leu Met Asp Tyr Gly Ser Leu Glu Glu Ala Ile Lys 65 70 75 80 Gly Cys Asp Gly Val Val His Thr Ala Ser Pro Val Thr Asp Asp Pro 85 90 95 Glu Gln Met Val Glu Pro Ala Val Ile Gly Thr Lys Asn Val Ile Val 100 105 110 Ala Ala Ala Glu Ala Lys Val Arg Arg Val Val Phe Thr Ser Ser Ile 115 120 125 Gly Ala Val Thr Met Asp Pro Asn Arg Ala Asp Val Val Val Asp Glu 130 135 140 Ser Cys Trp Ser Asp Leu Glu Phe Cys Lys Ser Thr Lys Asn Trp Tyr 145 150 155 160 Cys Tyr Gly Lys Ala Val Ala Glu Lys Ala Ala Trp Pro Glu Gly Lys 165 170 175 Glu Arg Gly Val Asp Leu Val Val Ile Asn Pro Val Leu Val Leu Gly 180 185 190 Pro Leu Leu Gln Ser Thr Ile Asn Ala Ser Ile Ile His Ile Leu Lys 195 200 205 Tyr Leu Thr Gly Ser Ala Lys Thr Tyr Ala Asn Ser Val Gln Ala Tyr 210 215 220 Val His Val Lys Asp Val Ala Leu Ala His Val Leu Val Leu Glu Thr 225 230 235 240 Pro Ser Ala Ser Gly Arg Tyr Leu Cys Ala Glu Ser Val Leu His Arg 245 250 255 Gly Asp Val Val Glu Ile Leu Ala Lys Phe Phe Pro Glu Tyr Asn Val 260 265 270 Pro Thr Lys Cys Ser Asp Glu Val Asn Pro Arg Val Lys Pro Tyr Lys 275 280 285 Phe Ser Asn Gln Lys Leu Arg Asp Leu Gly Leu Glu Phe Thr Pro Val 290 295 300 Lys Gln Cys Leu Tyr Glu Thr Val Lys Ser Leu Gln Glu Lys Gly His 305 310 315 320 Leu Pro Val Pro Ser Pro Pro Glu Asp Ser Val Arg Ile Gln Gly 325 330 335 1376 base pairs nucleic acid double linear cDNA to mRNA unknown CDS 99..1112 7 GAAAACACAC CTCCTCTCTT CTTTGTCTCT GTCTGTTCTC CACTTTCCCA GTCACCAAAC 60 TCGTATGCAT ATAATTACAT TTATCTAAAT ATAACAAC ATG CCT GTT GAT GCT 113 Met Pro Val Asp Ala 1 5 TCA TCA CTT TCA GGC CAA GGC CAA ACT ATC TGT GTC ACC GGG GGT GGT 161 Ser Ser Leu Ser Gly Gln Gly Gln Thr Ile Cys Val Thr Gly Gly Gly 10 15 20 GGT TTC ATT GCT TCT TGG ATG GTT AAA CTT CTT TTA GAT AAA GGT TAC 209 Gly Phe Ile Ala Ser Trp Met Val Lys Leu Leu Leu Asp Lys Gly Tyr 25 30 35 ACT GTT AGA GGA ACT GCG AGG AAC CCA GCT GAT CCC AAG AAT TCT CAT 257 Thr Val Arg Gly Thr Ala Arg Asn Pro Ala Asp Pro Lys Asn Ser His 40 45 50 TTG AGG GAG CTT GAA GGA GCT GAA GAA AGA TTA ACT TTA TGC AAA GCT 305 Leu Arg Glu Leu Glu Gly Ala Glu Glu Arg Leu Thr Leu Cys Lys Ala 55 60 65 GAT CTT CTT GAT TAT GAG TCT CTT AAA GAG GGT ATT CAA GGG TGT GAT 353 Asp Leu Leu Asp Tyr Glu Ser Leu Lys Glu Gly Ile Gln Gly Cys Asp 70 75 80 85 GGT GTT TTC CAC ACT GCT TCT CCT GTC ACA GAT GAT CCG GAA GAA ATG 401 Gly Val Phe His Thr Ala Ser Pro Val Thr Asp Asp Pro Glu Glu Met 90 95 100 GTG GAG CCA GCA GTG AAC GGG ACC AAA AAT GTG ATA ATT GCG GCG GCT 449 Val Glu Pro Ala Val Asn Gly Thr Lys Asn Val Ile Ile Ala Ala Ala 105 110 115 GAG GCC AAA GTC CGA CGA GTG GTG TTC ACG TCA TCA ATT GGC GCT GTG 497 Glu Ala Lys Val Arg Arg Val Val Phe Thr Ser Ser Ile Gly Ala Val 120 125 130 TAC ATG GAT CCC AAT AAG GGC CCA GAT GTT GTC ATT GAT GAG TCT TGC 545 Tyr Met Asp Pro Asn Lys Gly Pro Asp Val Val Ile Asp Glu Ser Cys 135 140 145 TGG AGT GAT CTT GAA TTC TGC AAG AAC ACC AAG AAT TGG TAT TGC TAT 593 Trp Ser Asp Leu Glu Phe Cys Lys Asn Thr Lys Asn Trp Tyr Cys Tyr 150 155 160 165 GGA AAG GCT GTG GCA GAA CAA GCT GCA TGG GAT ATG GCT AAG GAG AAA 641 Gly Lys Ala Val Ala Glu Gln Ala Ala Trp Asp Met Ala Lys Glu Lys 170 175 180 GGG GTG GAC CTA GTG GTG GTT AAC CCA GTG CTG GTG CTT GGA CCA TTG 689 Gly Val Asp Leu Val Val Val Asn Pro Val Leu Val Leu Gly Pro Leu 185 190 195 TTG CAG CCC ACT GTC AAT GCT AGC ATC ACT CAC ATC CTC AAG TAC CTC 737 Leu Gln Pro Thr Val Asn Ala Ser Ile Thr His Ile Leu Lys Tyr Leu 200 205 210 ACC GGC TCA GCC AAG ACA TAT GCT AAC TCT GTT CAA GCT TAT GTG CAT 785 Thr Gly Ser Ala Lys Thr Tyr Ala Asn Ser Val Gln Ala Tyr Val His 215 220 225 GTT AGG GAT GTG GCA CTA GCC CAC ATT TTA GTC TTT GAG ACG CCT TCC 833 Val Arg Asp Val Ala Leu Ala His Ile Leu Val Phe Glu Thr Pro Ser 230 235 240 245 GCC TCC GGC CGT TAC CTT TGC TCT GAG AGC GTT CTC CAC CGT GGA GAG 881 Ala Ser Gly Arg Tyr Leu Cys Ser Glu Ser Val Leu His Arg Gly Glu 250 255 260 GTG GTG GAA ATC CTT GCA AAG TTC TTC CCT GAG TAC CCC ATC CCT ACC 929 Val Val Glu Ile Leu Ala Lys Phe Phe Pro Glu Tyr Pro Ile Pro Thr 265 270 275 AAG TGC TCA GAT GAG AAG AAC CCA AGA AAA CAA CCT TAC AAG TTC TCA 977 Lys Cys Ser Asp Glu Lys Asn Pro Arg Lys Gln Pro Tyr Lys Phe Ser 280 285 290 AAC CAG AAG CTA AGG GAT CTG GGT TTC GAA TTC ACC CCA GTA AAG CAG 1025 Asn Gln Lys Leu Arg Asp Leu Gly Phe Glu Phe Thr Pro Val Lys Gln 295 300 305 TGT CTG TAT GAA ACT GTT AAG AGT TTG CAG GAA AAG GGT CAC CTT CCA 1073 Cys Leu Tyr Glu Thr Val Lys Ser Leu Gln Glu Lys Gly His Leu Pro 310 315 320 325 ATC CCA AAA CAA GCT GCA GAA GAG TCT TTG AAA ATT CAA TAAGGCCTCT 1122 Ile Pro Lys Gln Ala Ala Glu Glu Ser Leu Lys Ile Gln 330 335 TGGAACTATT TATTAGGATT GTTCCATACC CCAAGTTTGG ATCGCAAATG CTAGGGAA 1182 GAGCATATTA AAGAATGCCA ATGTGCAGGT GTTTTAGTAT TTTACATGAA GAACTCTG 1242 TATCCTTGTG CTTATAATAA TTTTTTTCAA GTGAGTGTCT TCAAATGTTC AACTTGTA 1302 TGTGGTTGTC TAACTTTATC CAGTTTCAAT ATAAAAGAGG AACGATTCTA TGTCTTAA 1362 AAAAAAAAAA AAAA 1376 338 amino acids amino acid linear protein unknown 8 Met Pro Val Asp Ala Ser Ser Leu Ser Gly Gln Gly Gln Thr Ile Cys 1 5 10 15 Val Thr Gly Gly Gly Gly Phe Ile Ala Ser Trp Met Val Lys Leu Leu 20 25 30 Leu Asp Lys Gly Tyr Thr Val Arg Gly Thr Ala Arg Asn Pro Ala Asp 35 40 45 Pro Lys Asn Ser His Leu Arg Glu Leu Glu Gly Ala Glu Glu Arg Leu 50 55 60 Thr Leu Cys Lys Ala Asp Leu Leu Asp Tyr Glu Ser Leu Lys Glu Gly 65 70 75 80 Ile Gln Gly Cys Asp Gly Val Phe His Thr Ala Ser Pro Val Thr Asp 85 90 95 Asp Pro Glu Glu Met Val Glu Pro Ala Val Asn Gly Thr Lys Asn Val 100 105 110 Ile Ile Ala Ala Ala Glu Ala Lys Val Arg Arg Val Val Phe Thr Ser 115 120 125 Ser Ile Gly Ala Val Tyr Met Asp Pro Asn Lys Gly Pro Asp Val Val 130 135 140 Ile Asp Glu Ser Cys Trp Ser Asp Leu Glu Phe Cys Lys Asn Thr Lys 145 150 155 160 Asn Trp Tyr Cys Tyr Gly Lys Ala Val Ala Glu Gln Ala Ala Trp Asp 165 170 175 Met Ala Lys Glu Lys Gly Val Asp Leu Val Val Val Asn Pro Val Leu 180 185 190 Val Leu Gly Pro Leu Leu Gln Pro Thr Val Asn Ala Ser Ile Thr His 195 200 205 Ile Leu Lys Tyr Leu Thr Gly Ser Ala Lys Thr Tyr Ala Asn Ser Val 210 215 220 Gln Ala Tyr Val His Val Arg Asp Val Ala Leu Ala His Ile Leu Val 225 230 235 240 Phe Glu Thr Pro Ser Ala Ser Gly Arg Tyr Leu Cys Ser Glu Ser Val 245 250 255 Leu His Arg Gly Glu Val Val Glu Ile Leu Ala Lys Phe Phe Pro Glu 260 265 270 Tyr Pro Ile Pro Thr Lys Cys Ser Asp Glu Lys Asn Pro Arg Lys Gln 275 280 285 Pro Tyr Lys Phe Ser Asn Gln Lys Leu Arg Asp Leu Gly Phe Glu Phe 290 295 300 Thr Pro Val Lys Gln Cys Leu Tyr Glu Thr Val Lys Ser Leu Gln Glu 305 310 315 320 Lys Gly His Leu Pro Ile Pro Lys Gln Ala Ala Glu Glu Ser Leu Lys 325 330 335 Ile Gln 1273 base pairs nucleic acid double linear cDNA to mRNA unknown CDS 66..1091 9 TCGTAGCTCT TCCCTTTCAC CAACAAGCTA GTTTAGACAA GTACAGTGGT ACTGTAAGAG 60 CAACA ATG ACC GTT GTC GAC GCC GCC GCG CCG CAG CTG CCT GGC CAT 107 Met Thr Val Val Asp Ala Ala Ala Pro Gln Leu Pro Gly His 1 5 10 GGG CAG ACC GTG TGC GTC ACC GGC GCC GCG GGG TAC ATC GCG TCG GGG 155 Gly Gln Thr Val Cys Val Thr Gly Ala Ala Gly Tyr Ile Ala Ser Gly 15 20 25 30 CTC GTC AAG CTG CTC CTG GAG AGA GGC TAC ACC GTG AAG GGC ACA GTG 203 Leu Val Lys Leu Leu Leu Glu Arg Gly Tyr Thr Val Lys Gly Thr Val 35 40 45 AGG AAC CCA GAT GAT CCC AAG AAC GCC CAC CTG AAG GCG CTG GAC GGC 251 Arg Asn Pro Asp Asp Pro Lys Asn Ala His Leu Lys Ala Leu Asp Gly 50 55 60 GCC ACC AAG AGG CTG ATC CTC TGC AAA GCC GAC CTC CTC GAC TAC GAC 299 Ala Thr Lys Arg Leu Ile Leu Cys Lys Ala Asp Leu Leu Asp Tyr Asp 65 70 75 GCC ATA TGC GCC GCC GTC GAG GGC TGC CAC GGC GTG TTC CAC ACC GCC 347 Ala Ile Cys Ala Ala Val Glu Gly Cys His Gly Val Phe His Thr Ala 80 85 90 TCT CCA GTC ACC GAT GAT CCT GAG CAG ATG GTG GAG CCG GCG GTG CGG 395 Ser Pro Val Thr Asp Asp Pro Glu Gln Met Val Glu Pro Ala Val Arg 95 100 105 110 GGC ACG GAG TAC GTG ATC AAC GCG GCA GCG GAT GCG GGA ACG GTG CGC 443 Gly Thr Glu Tyr Val Ile Asn Ala Ala Ala Asp Ala Gly Thr Val Arg 115 120 125 CGG GTG GTG TTC ACG TCG TCA ATC GGT GCC ATC ACC ATG GAC CCC AAC 491 Arg Val Val Phe Thr Ser Ser Ile Gly Ala Ile Thr Met Asp Pro Asn 130 135 140 CGC GGT CCT GAC GTA GTC GTC AAT GAG TCC TGC TGG AGC GAC CTC GAA 539 Arg Gly Pro Asp Val Val Val Asn Glu Ser Cys Trp Ser Asp Leu Glu 145 150 155 TTC TGC AAG AAA ACC AAG AAC TGG TAC TGC TAC GGC AAG GCC GTG GCG 587 Phe Cys Lys Lys Thr Lys Asn Trp Tyr Cys Tyr Gly Lys Ala Val Ala 160 165 170 GAG CAG GCT GCG TGG GAG GCG GCC AGG AAG CGC GGC ATC GAC CTC GTC 635 Glu Gln Ala Ala Trp Glu Ala Ala Arg Lys Arg Gly Ile Asp Leu Val 175 180 185 190 GTC GTG AAC CCT GTG CTC GTG GTA GGG CCG CTG CTG CAA CCA ACG GTG 683 Val Val Asn Pro Val Leu Val Val Gly Pro Leu Leu Gln Pro Thr Val 195 200 205 AAC GCT AGC GCC GCA CAC ATC CTC AAG TAC CTC GAC GGC TCG GCC AAG 731 Asn Ala Ser Ala Ala His Ile Leu Lys Tyr Leu Asp Gly Ser Ala Lys 210 215 220 AAG TAC GCC AAC GCT GTG CAG TCA TAC GTA GAC GTG CGT GAC GTA GCC 779 Lys Tyr Ala Asn Ala Val Gln Ser Tyr Val Asp Val Arg Asp Val Ala 225 230 235 GGC GCG CAC ATC CGG GTG TTC GAG GCG CCT GAG GCG TCG GGC CGG TAC 827 Gly Ala His Ile Arg Val Phe Glu Ala Pro Glu Ala Ser Gly Arg Tyr 240 245 250 CTC TGC GCC GAG CGC GTG CTG CAC CGT GGG GAC GTT GTC CAA ATC CTC 875 Leu Cys Ala Glu Arg Val Leu His Arg Gly Asp Val Val Gln Ile Leu 255 260 265 270 AGC AAA CTC TTG CCT GAG TAC CCT GTG CCA ACA AGG TGC TCT GAT GAA 923 Ser Lys Leu Leu Pro Glu Tyr Pro Val Pro Thr Arg Cys Ser Asp Glu 275 280 285 GTG AAC CCA CGG AAG CAG CCT TAT AAG ATG TCC AAC CAG AAG CTG CAG 971 Val Asn Pro Arg Lys Gln Pro Tyr Lys Met Ser Asn Gln Lys Leu Gln 290 295 300 GAT CTT GGC CTC CAG TTC ACT CCT GTG AAC GAC TCT CTG TAT GAG ACC 1019 Asp Leu Gly Leu Gln Phe Thr Pro Val Asn Asp Ser Leu Tyr Glu Thr 305 310 315 GTG AAG AGC CTC CAG GAG AAG GGA CAT CTC CTA GTA CCA AGC AAA CCC 1067 Val Lys Ser Leu Gln Glu Lys Gly His Leu Leu Val Pro Ser Lys Pro 320 325 330 GAG GGA TTA AAC GGT GTA ACG GCA TGATACTGCT AAAGAAGCAG CAGAGTTCA 1121 Glu Gly Leu Asn Gly Val Thr Ala 335 340 GTGCTCCTGT AACATGGTCA AACATGAGTT GTTTTTCTGT ATAAATTCTA TCCAGTAT 1181 TGTTATTTAA GTGAACTAAG AGAACAGAAT ATTGTATCAT CTTCGATGTC CAATACCT 1241 AAGTGATTTG TTTTGCCACC TAAAAAAAAA AA 1273 342 amino acids amino acid linear protein unknown 10 Met Thr Val Val Asp Ala Ala Ala Pro Gln Leu Pro Gly His Gly Gln 1 5 10 15 Thr Val Cys Val Thr Gly Ala Ala Gly Tyr Ile Ala Ser Gly Leu Val 20 25 30 Lys Leu Leu Leu Glu Arg Gly Tyr Thr Val Lys Gly Thr Val Arg Asn 35 40 45 Pro Asp Asp Pro Lys Asn Ala His Leu Lys Ala Leu Asp Gly Ala Thr 50 55 60 Lys Arg Leu Ile Leu Cys Lys Ala Asp Leu Leu Asp Tyr Asp Ala Ile 65 70 75 80 Cys Ala Ala Val Glu Gly Cys His Gly Val Phe His Thr Ala Ser Pro 85 90 95 Val Thr Asp Asp Pro Glu Gln Met Val Glu Pro Ala Val Arg Gly Thr 100 105 110 Glu Tyr Val Ile Asn Ala Ala Ala Asp Ala Gly Thr Val Arg Arg Val 115 120 125 Val Phe Thr Ser Ser Ile Gly Ala Ile Thr Met Asp Pro Asn Arg Gly 130 135 140 Pro Asp Val Val Val Asn Glu Ser Cys Trp Ser Asp Leu Glu Phe Cys 145 150 155 160 Lys Lys Thr Lys Asn Trp Tyr Cys Tyr Gly Lys Ala Val Ala Glu Gln 165 170 175 Ala Ala Trp Glu Ala Ala Arg Lys Arg Gly Ile Asp Leu Val Val Val 180 185 190 Asn Pro Val Leu Val Val Gly Pro Leu Leu Gln Pro Thr Val Asn Ala 195 200 205 Ser Ala Ala His Ile Leu Lys Tyr Leu Asp Gly Ser Ala Lys Lys Tyr 210 215 220 Ala Asn Ala Val Gln Ser Tyr Val Asp Val Arg Asp Val Ala Gly Ala 225 230 235 240 His Ile Arg Val Phe Glu Ala Pro Glu Ala Ser Gly Arg Tyr Leu Cys 245 250 255 Ala Glu Arg Val Leu His Arg Gly Asp Val Val Gln Ile Leu Ser Lys 260 265 270 Leu Leu Pro Glu Tyr Pro Val Pro Thr Arg Cys Ser Asp Glu Val Asn 275 280 285 Pro Arg Lys Gln Pro Tyr Lys Met Ser Asn Gln Lys Leu Gln Asp Leu 290 295 300 Gly Leu Gln Phe Thr Pro Val Asn Asp Ser Leu Tyr Glu Thr Val Lys 305 310 315 320 Ser Leu Gln Glu Lys Gly His Leu Leu Val Pro Ser Lys Pro Glu Gly 325 330 335 Leu Asn Gly Val Thr Ala 340 1293 base pairs nucleic acid double linear cDNA to mRNA unknown CDS 95..1108 11 CCGAGCCTAT TTCTTCCCTA TATCCACTCA TCCTTGTCTT ATATCATCAT CATCATCATC 60 TACCTAAACC TGAGCTCAAC AGAAAAGTAA TACC ATG CCG TCA GTT TCC GGC 112 Met Pro Ser Val Ser Gly 1 5 CAA ATC GTT TGT GTT ACT GGC GCC GGA GGT TTC ATC GCC TCT TGG CTC 160 Gln Ile Val Cys Val Thr Gly Ala Gly Gly Phe Ile Ala Ser Trp Leu 10 15 20 GTT AAA ATT CTT CTG GAA AAA GGC TAC ACT GTT AGA GGA ACA GTA CGA 208 Val Lys Ile Leu Leu Glu Lys Gly Tyr Thr Val Arg Gly Thr Val Arg 25 30 35 AAT CCA GAT GAT CGA AAA AAT AGT CAT TTG AGG GAG CTT GAA CGA GCA 256 Asn Pro Asp Asp Arg Lys Asn Ser His Leu Arg Glu Leu Glu Arg Ala 40 45 50 AAA GAG ACA TTG ACT CTG TGC AGA GCT GAT CTT CTT GAT TTT CAG AGT 304 Lys Glu Thr Leu Thr Leu Cys Arg Ala Asp Leu Leu Asp Phe Gln Ser 55 60 65 70 TTG CGA GAA GCA ATC AGC GGC TGT GAC GGA GTT TTC CAC ACA CGT TCT 352 Leu Arg Glu Ala Ile Ser Gly Cys Asp Gly Val Phe His Thr Arg Ser 75 80 85 CCT GTC ACT GAT GAT CCA GAA CAA ATG GTG GAG CCA GCA GTT ATT GGT 400 Pro Val Thr Asp Asp Pro Glu Gln Met Val Glu Pro Ala Val Ile Gly 90 95 100 ACA AAG AAT GTG ATA ACG GCA GCA GCA GAG GCC AAG GTG CGA CGT GTG 448 Thr Lys Asn Val Ile Thr Ala Ala Ala Glu Ala Lys Val Arg Arg Val 105 110 115 GTG TTC ACT TCG TCA ATT GGT GCT GTG TAT ATG GAC CCA AAC AGG GAC 496 Val Phe Thr Ser Ser Ile Gly Ala Val Tyr Met Asp Pro Asn Arg Asp 120 125 130 CCT GAT AAG GTT GTC GAC GAG ACT TGT TGG AGT GAT CCT GAC TTC TGC 544 Pro Asp Lys Val Val Asp Glu Thr Cys Trp Ser Asp Pro Asp Phe Cys 135 140 145 150 AAA AAC ACC AAG AAT TGG TAT TGT TAT GGG AAG ATG GTG GCA GAA CAA 592 Lys Asn Thr Lys Asn Trp Tyr Cys Tyr Gly Lys Met Val Ala Glu Gln 155 160 165 GCA GCA TGG GAC GAA GCA AGG GAG AAA GGA GTC GAT TTG GTG GCA ATC 640 Ala Ala Trp Asp Glu Ala Arg Glu Lys Gly Val Asp Leu Val Ala Ile 170 175 180 AAC CCA GTG TTG GTG CTT GGA CCA CTG CTC CAA CAG AAT GTG AAT GCC 688 Asn Pro Val Leu Val Leu Gly Pro Leu Leu Gln Gln Asn Val Asn Ala 185 190 195 AGT GTT CTT CAC ATC CAC AAG TAC CTA ACT GGC TCT GCT AAA ACA TAT 736 Ser Val Leu His Ile His Lys Tyr Leu Thr Gly Ser Ala Lys Thr Tyr 200 205 210 ACG TCC AAT TCA CTT CAG GCA TAT GTT CAT GTT AGG GAT GTG GCT TTA 784 Thr Ser Asn Ser Leu Gln Ala Tyr Val His Val Arg Asp Val Ala Leu 215 220 225 230 CGT CAC ATA CTT GTG TAC GAG ACA CCT TCT GCA TCT GGC CGT TAT CTC 832 Arg His Ile Leu Val Tyr Glu Thr Pro Ser Ala Ser Gly Arg Tyr Leu 235 240 245 TGT GCC GAG AGT GTG CTG CAT CGC TGC GAT GTG GTT GAA ATT CTC GCC 880 Cys Ala Glu Ser Val Leu His Arg Cys Asp Val Val Glu Ile Leu Ala 250 255 260 AAA TTC TTC CCG GAG TAT CCT ATC CCC ACC AAG TGT TCA GAT GTG ACG 928 Lys Phe Phe Pro Glu Tyr Pro Ile Pro Thr Lys Cys Ser Asp Val Thr 265 270 275 AAG CCA AGG GTA AAA CCG TAC AAA TTC TCA AAC CAA AAG CTA AAG GAT 976 Lys Pro Arg Val Lys Pro Tyr Lys Phe Ser Asn Gln Lys Leu Lys Asp 280 285 290 TTG GGT CTG GAG TTT ACA CCA GTA CAA TGC TTA TAT GAA ACG GTG AAG 1024 Leu Gly Leu Glu Phe Thr Pro Val Gln Cys Leu Tyr Glu Thr Val Lys 295 300 305 310 AGT CTA CAA GAG AAA GGT CAC CTT CCA ATT CCT ACT CAA AAG GAT GAG 1072 Ser Leu Gln Glu Lys Gly His Leu Pro Ile Pro Thr Gln Lys Asp Glu 315 320 325 ATT ATT CGA ATT CAG TCT GAG AAA TTC AGA AGC TCT TAGCATGTAT 1118 Ile Ile Arg Ile Gln Ser Glu Lys Phe Arg Ser Ser 330 335 TGAGGAAAAG GGATCAATGG TTAAAGTTGA CCATGGCGTT GTCCCTTTAT GTACCAAG 1178 CAAATGCACC TAGAAATTTA CTTGTCTACT CTGTTGTACT TTTACTTGTC ATGGAAAT 1238 TTTTAGTGTT TTCATTGTTA TGAGATATAT TTTGGTGTAA AAAAAAAAAA AAAAA 1293 338 amino acids amino acid linear protein unknown 12 Met Pro Ser Val Ser Gly Gln Ile Val Cys Val Thr Gly Ala Gly Gly 1 5 10 15 Phe Ile Ala Ser Trp Leu Val Lys Ile Leu Leu Glu Lys Gly Tyr Thr 20 25 30 Val Arg Gly Thr Val Arg Asn Pro Asp Asp Arg Lys Asn Ser His Leu 35 40 45 Arg Glu Leu Glu Arg Ala Lys Glu Thr Leu Thr Leu Cys Arg Ala Asp 50 55 60 Leu Leu Asp Phe Gln Ser Leu Arg Glu Ala Ile Ser Gly Cys Asp Gly 65 70 75 80 Val Phe His Thr Arg Ser Pro Val Thr Asp Asp Pro Glu Gln Met Val 85 90 95 Glu Pro Ala Val Ile Gly Thr Lys Asn Val Ile Thr Ala Ala Ala Glu 100 105 110 Ala Lys Val Arg Arg Val Val Phe Thr Ser Ser Ile Gly Ala Val Tyr 115 120 125 Met Asp Pro Asn Arg Asp Pro Asp Lys Val Val Asp Glu Thr Cys Trp 130 135 140 Ser Asp Pro Asp Phe Cys Lys Asn Thr Lys Asn Trp Tyr Cys Tyr Gly 145 150 155 160 Lys Met Val Ala Glu Gln Ala Ala Trp Asp Glu Ala Arg Glu Lys Gly 165 170 175 Val Asp Leu Val Ala Ile Asn Pro Val Leu Val Leu Gly Pro Leu Leu 180 185 190 Gln Gln Asn Val Asn Ala Ser Val Leu His Ile His Lys Tyr Leu Thr 195 200 205 Gly Ser Ala Lys Thr Tyr Thr Ser Asn Ser Leu Gln Ala Tyr Val His 210 215 220 Val Arg Asp Val Ala Leu Arg His Ile Leu Val Tyr Glu Thr Pro Ser 225 230 235 240 Ala Ser Gly Arg Tyr Leu Cys Ala Glu Ser Val Leu His Arg Cys Asp 245 250 255 Val Val Glu Ile Leu Ala Lys Phe Phe Pro Glu Tyr Pro Ile Pro Thr 260 265 270 Lys Cys Ser Asp Val Thr Lys Pro Arg Val Lys Pro Tyr Lys Phe Ser 275 280 285 Asn Gln Lys Leu Lys Asp Leu Gly Leu Glu Phe Thr Pro Val Gln Cys 290 295 300 Leu Tyr Glu Thr Val Lys Ser Leu Gln Glu Lys Gly His Leu Pro Ile 305 310 315 320 Pro Thr Gln Lys Asp Glu Ile Ile Arg Ile Gln Ser Glu Lys Phe Arg 325 330 335 Ser Ser 1297 base pairs nucleic acid double linear cDNA to mRNA unknown CDS 136..1140 13 CGGCCGGGAC GACCCGTTCC TCTTCTTCCG GGTCACCGTC ACCATGTTAC ACAACATCTC 60 CGGCTAAAAA AAAAAGGAAA AAAAGCGCAA CCTCCACCTC CTGAACCCCT CTCCCCCCT 120 GCCGGCAATC CCACC ATG CCC GTC GAC GCC CTC CCC GGT TCC GGC CAG ACC 171 Met Pro Val Asp Ala Leu Pro Gly Ser Gly Gln Thr 1 5 10 GTC TGC GTC ACC GGC GCC GGC GGG TTC ATC GCC TCC TGG ATT GTC AAG 219 Val Cys Val Thr Gly Ala Gly Gly Phe Ile Ala Ser Trp Ile Val Lys 15 20 25 CTT CTC CTC GAG CGA GGC TAC ACC GTG CGA GGA ACC GTC AGG AAC CCA 267 Leu Leu Leu Glu Arg Gly Tyr Thr Val Arg Gly Thr Val Arg Asn Pro 30 35 40 GAC GAC CCG AAG AAT GGT CAT CTG AGA GAT CTG GAA GGA GCC AGC GAG 315 Asp Asp Pro Lys Asn Gly His Leu Arg Asp Leu Glu Gly Ala Ser Glu 45 50 55 60 AGG CTG ACG CTG TAC AAG GGT GAT CTG ATG GAC GAC GGG AGC TTG GAA 363 Arg Leu Thr Leu Tyr Lys Gly Asp Leu Met Asp Asp Gly Ser Leu Glu 65 70 75 GAA GCC ATC AAG GGG TGC GAC GGC GTC GTC CAC ACC GCC TCT CCG GTC 411 Glu Ala Ile Lys Gly Cys Asp Gly Val Val His Thr Ala Ser Pro Val 80 85 90 ACC GAC GAT CCT GAG CAA ATG GTG GAG CCA GCG GTG ATC GGG ACG AAA 459 Thr Asp Asp Pro Glu Gln Met Val Glu Pro Ala Val Ile Gly Thr Lys 95 100 105 AAT GTG ATC GTC GCA GCG GCG GAG GCC AAG GTC CGG CGG GTT GTG TTC 507 Asn Val Ile Val Ala Ala Ala Glu Ala Lys Val Arg Arg Val Val Phe 110 115 120 ACC TCC TCC ATC GGT GCA GTC ACC ATG GAC CCC AAC CGG GCA GAC GTT 555 Thr Ser Ser Ile Gly Ala Val Thr Met Asp Pro Asn Arg Ala Asp Val 125 130 135 140 GTG GTG GAC GAG TCT TGT TGG AGC GAC CTC GAA TTT TGC AAG AGC ACT 603 Val Val Asp Glu Ser Cys Trp Ser Asp Leu Glu Phe Cys Lys Ser Thr 145 150 155 AAG AAC TGG TAT TGC TAC GGC AAG GCA GTG GCG GAG AAG GCC GCT TGG 651 Lys Asn Trp Tyr Cys Tyr Gly Lys Ala Val Ala Glu Lys Ala Ala Trp 160 165 170 CCA GAG GGC AAG GAG AGA GGG GTT GAC CTC GTG GTG ATT AAC CCT GTG 699 Pro Glu Gly Lys Glu Arg Gly Val Asp Leu Val Val Ile Asn Pro Val 175 180 185 CTC GTG CTT GGA CCG CTC CTT CAG TCG ACG ATC AAT GCG AGC ATC ATC 747 Leu Val Leu Gly Pro Leu Leu Gln Ser Thr Ile Asn Ala Ser Ile Ile 190 195 200 CAC ATC CTC AAG TAC TTG ACT GGC TCA GCC AAG ACC TAC GCC AAC TCG 795 His Ile Leu Lys Tyr Leu Thr Gly Ser Ala Lys Thr Tyr Ala Asn Ser 205 210 215 220 GTC CAG GCG TAC GTG CAC GTC AAG GAC GTC GCG CTT GCC CAC GTC CTT 843 Val Gln Ala Tyr Val His Val Lys Asp Val Ala Leu Ala His Val Leu 225 230 235 GTC TTG GAG ACC CCA TCC GCC TCA GGC CGC TAT TTG TGC GCC GAG AGC 891 Val Leu Glu Thr Pro Ser Ala Ser Gly Arg Tyr Leu Cys Ala Glu Ser 240 245 250 GTC CTC CAC CGT GGC GAT GTG GTG GAA ATC CTT GCC AAG TTC TTC CCT 939 Val Leu His Arg Gly Asp Val Val Glu Ile Leu Ala Lys Phe Phe Pro 255 260 265 GAG TAT AAT GTA CCG ACC AAG TGC TCT GAT GAG GTG AAC CCA AGA GTA 987 Glu Tyr Asn Val Pro Thr Lys Cys Ser Asp Glu Val Asn Pro Arg Val 270 275 280 AAA CCA TAC AAG TTC TCC AAC CAG AAG CTG AGA GAC TTG GGG CTC GAG 1035 Lys Pro Tyr Lys Phe Ser Asn Gln Lys Leu Arg Asp Leu Gly Leu Glu 285 290 295 300 TTC ACC CCG GTG AAG CAG TGC CTG TAC GAA ACT GTC AAG AGC TTG CAG 1083 Phe Thr Pro Val Lys Gln Cys Leu Tyr Glu Thr Val Lys Ser Leu Gln 305 310 315 GAG AAA GGC CAC CTA CCA GTC CCC TCC CCG CCG GAA GAT TCG GTG CGT 1131 Glu Lys Gly His Leu Pro Val Pro Ser Pro Pro Glu Asp Ser Val Arg 320 325 330 ATT CAG GGA TGATCTTAGA TCCATCACGG TGCGCATTTG TAATCCGGAG 1180 Ile Gln Gly 335 AAATGAGAGA AACATGTGGG AATTTGTTTG TACTTTTCTA AGTCAAACCT GGAGATAC 1240 ACCCTGAGTT CTGCATTGGA ATGGAAGTTG TCAATTGTTC CAAAAAAAAA AAAAAAA 1297 335 amino acids amino acid linear protein unknown 14 Met Pro Val Asp Ala Leu Pro Gly Ser Gly Gln Thr Val Cys Val Thr 1 5 10 15 Gly Ala Gly Gly Phe Ile Ala Ser Trp Ile Val Lys Leu Leu Leu Glu 20 25 30 Arg Gly Tyr Thr Val Arg Gly Thr Val Arg Asn Pro Asp Asp Pro Lys 35 40 45 Asn Gly His Leu Arg Asp Leu Glu Gly Ala Ser Glu Arg Leu Thr Leu 50 55 60 Tyr Lys Gly Asp Leu Met Asp Asp Gly Ser Leu Glu Glu Ala Ile Lys 65 70 75 80 Gly Cys Asp Gly Val Val His Thr Ala Ser Pro Val Thr Asp Asp Pro 85 90 95 Glu Gln Met Val Glu Pro Ala Val Ile Gly Thr Lys Asn Val Ile Val 100 105 110 Ala Ala Ala Glu Ala Lys Val Arg Arg Val Val Phe Thr Ser Ser Ile 115 120 125 Gly Ala Val Thr Met Asp Pro Asn Arg Ala Asp Val Val Val Asp Glu 130 135 140 Ser Cys Trp Ser Asp Leu Glu Phe Cys Lys Ser Thr Lys Asn Trp Tyr 145 150 155 160 Cys Tyr Gly Lys Ala Val Ala Glu Lys Ala Ala Trp Pro Glu Gly Lys 165 170 175 Glu Arg Gly Val Asp Leu Val Val Ile Asn Pro Val Leu Val Leu Gly 180 185 190 Pro Leu Leu Gln Ser Thr Ile Asn Ala Ser Ile Ile His Ile Leu Lys 195 200 205 Tyr Leu Thr Gly Ser Ala Lys Thr Tyr Ala Asn Ser Val Gln Ala Tyr 210 215 220 Val His Val Lys Asp Val Ala Leu Ala His Val Leu Val Leu Glu Thr 225 230 235 240 Pro Ser Ala Ser Gly Arg Tyr Leu Cys Ala Glu Ser Val Leu His Arg 245 250 255 Gly Asp Val Val Glu Ile Leu Ala Lys Phe Phe Pro Glu Tyr Asn Val 260 265 270 Pro Thr Lys Cys Ser Asp Glu Val Asn Pro Arg Val Lys Pro Tyr Lys 275 280 285 Phe Ser Asn Gln Lys Leu Arg Asp Leu Gly Leu Glu Phe Thr Pro Val 290 295 300 Lys Gln Cys Leu Tyr Glu Thr Val Lys Ser Leu Gln Glu Lys Gly His 305 310 315 320 Leu Pro Val Pro Ser Pro Pro Glu Asp Ser Val Arg Ile Gln Gly 325 330 335 7 amino acids amino acid single linear peptide unknown 15 Asn Trp Tyr Cys Tyr Gly Lys 1 5 13 amino acids amino acid single linear peptide unknown Modified-site /label= Xaa /note= “any amino acid” 16 His Leu Pro Val Pro Xaa Pro Pro Glu Asp Ser Val Arg 1 5 10 13 amino acids amino acid single linear peptide unknown 17 Thr Tyr Ala Asn Ser Val Gln Ala Tyr Val His Val Lys 1 5 10 15 amino acids amino acid single linear peptide unknown 18 Gly Cys Asp Gly Val Val His Thr Ala Ser Pro Val Thr Asp Asp 1 5 10 15 12 amino acids amino acid single linear peptide unknown 19 Leu Arg Asp Leu Gly Leu Glu Phe Thr Pro Val Lys 1 5 10 14 amino acids amino acid single linear peptide unknown 20 Gly Asp Leu Met Asp Tyr Gly Ser Leu Glu Glu Ala Ile Lys 1 5 10 8 amino acids amino acid single linear peptide unknown 21 Lys Asn Trp Tyr Cys Tyr Gly Lys 1 5 22 base pairs nucleic acid both linear cDNA unknown 22 AARAAYTGGT AYTGYTAYGG AA 22 16 amino acids amino acid single linear peptide unknown 23 Lys Gly Cys Asp Gly Val Val His Thr Ala Ser Pro Val Thr Asp As 1 5 10 15 19 base pairs nucleic acid both linear cDNA unknown 24 AARGGTGYGA YGGGTGTCA 19 13 amino acids amino acid single linear peptide unknown 25 Lys Leu Arg Asp Leu Gly Leu Glu Phe Thr Pro Val Lys 1 5 10 14 base pairs nucleic acid both linear cDNA unknown 26 GARTTYACCC GTAA 14 15 amino acids amino acid single linear peptide unknown 27 Lys Gly Asp Leu Met Asp Tyr Gly Ser Leu Glu Glu Ala Ile Lys 1 5 10 15 21 base pairs nucleic acid both linear cDNA unknown 28 AARGGGAYYT ATGGAYTAYG G 21 26 base pairs nucleic acid both linear cDNA unknown 29 GGCAATCCCC ATATGCCCGT CGACGC 26Claims
1. A method of producing transgenic plants within which the biosynthesis of lignins is regulated either in the sense of an increase, or in the sense of a reduction of the lignin levels produced, relative to the normal lignin levels produced in plants comprising:
- transforming plant cells with a recombinant nucleotidc sequence comprising one or more coding regions, wherein said coding regions are selected from the group consisting of:
- the nuclcotide sequence represented by SEQ ID NO: 1, coding for a mRNA, said mRNA coding for the Cinnamoyl CoA Reductase (CCR) of lucerne represented by SEQ ID NO: 2; and
- the nucleotide sequence represented by SEQ ID NO: 3, coding for a mRNA, said mRNA coding for the CCR of maize represented by SEQ ID NO: 4, and
- the nucleotide sequence fully complementary to that represented by SEQ ID NO: 1, or SEQ ID NO: 3.
2. An isolated DNA sequence comprising:
- the nuclcotide sequence represented by SEQ ID NO: 1, coding for a mRNA, said mRNA coding for the Cinnamoyl CoA Reductase (CCR) represented by SEQ ID NO: 2, or
- the nucleotide sequence represented by SEQ ID NO: 3, coding for a mRNA, said mRNA coding for a protein represented by SEQ ID NO: 4.
3. An isolated DNA sequence comprising:
- the nucleotide sequence fully complementary to that represented by SEQ ID NO: 1 or
- the nucleotide sequence fully complementary to that represented by SEQ ID NO: 3.
4. An isolated mRNA selected from
- the mRNA coded by the DNA sequence represented by SEQ ID NO: 1 and the mRNA coded by the DNA sequence represented by SEQ ID NO: 3.
5. An anti sense mRNA comprising nucleotides fully complementary to a mRNA according to claim 4.
6. An isolated nucleotide sequence coding for the CCRs represented by SEQ ID NO: 2 or SEQ ID NO: 4.
7. An isolated complex formed between an anti sense mRNA according to claim 5, and a CCR mRNA.
8. An isolated recombinant nucleotide sequence comprising at least one DNA sequence according to claim 2, said sequence being inserted in a heterologous sequence.
9. An isolated recombinant nucleotide sequence, comprising at least one fully complementary DNA sequence according to claim 3, inserted in a heterologous sequence.
10. A process for the regulation of the biosynthesis of lignins in a plant, either by reducing, or by increasing the levels of lignin produced, relative to the normal levels of lignins produced in said plant, said process comprising the step of transforming cells of said plant using a vector containing a nucleotide sequence according to claim 2.
11. A plant, plant fragment, cell, fruit, seed, or pollen, transformed by incorporation of at least one nucleotide sequence selected from the group consisting of:
- the nucleotide sequence represented by SEQ ID NO: 1, coding for a mRNA, said mRNA coding for the Cinnamoyl CoA Reductase (CCR) of lucerne represented by SEQ ID NO: 2,
- the nucleotide sequence represented by SEQ ID NO: 3, coding for a mRNA, said mRNA coding for the CCR of maize represented by SEQ ID NO: 4, and
- the nucleotide sequence fully complementary to that represented by SEQ ID NO: 1 and SEQ ID NO: 3.
12. An isolated recombinant nucleotide sequence according to claim 9 wherein said at least one fully complementary DNA sequence is operatively linked to at least one of a promoter or a terminator.
13. An isolated recombinant vector comprising a recombinant nucleotide sequence according to claim 12.
14. A process for reducing the biosynthesis of lignins in plants, relative to the normal levels of lignins produced in these plants, said process comprising transforming cells of said plants with a vector containing a nucleotide sequence according to claim 3.
| 0 155 872 | September 1985 | EP |
| WO9305159 | March 1993 | WO |
| WO 93 05159 | March 1993 | WO |
| WO 95 27790 | October 1995 | WO |
- Smith et al. Nature. 1988. vol. 334: 724-726, 1988.*
- Theoretical and Applied Genetics, vol. 87, No. 8, pp. 1006-1015, XP002006034 Carron, T.R., Et Al.: “Genetic Modification of Condensed Tannin Biosynthesis in Lotus Corniculatus.1. Heterologous Antisense Dihydroflavonol Reductase Down-Regulates Tannin Accumulation in “Hairy Root” Cultures” see the entire document..
- Bull. Liason—Groupe Polyphenols, vol. 16(PT.2), pp. 295-300, XP002006035 Robbins, M.P., Et Al.: “Manipulation of Condensed Tannin Biosynthesis in Forage Legumes” see p. 296.
- J. Cell. Biochem. Suppl., vol. 17A, p. 26 XP002006036 Campbell, M.M., Et Al.: “Hydroxycinnamoyl-coA reductase from Eucalyptus. Molecular analysis of a key control point of lignification” *abtégé A 305 * & Keystone Symposium on the Extracellular Matrix of Plants: Molecular, Cellular and Developmental Biology, Sant Fe, New Mexico, USA, Jan. 9-15, 1993.
- New Phytologist 129 (2). 1995. 203-236., XP002006037 Boudet A M Et Al: “Tansley review No. 80: Biochemistry and molecular biology of lignification.” See p. 221.
- Plant Physiology (Rockville) 106 (2). Oct. 1994. 625-632., XP002006038 Goffner D Et Al: “Purification and characterization of cinnamoyl-coenzyme A:NADP oxidoreductase in Eucalyptus gunnii.” See the entire document.
- Abstr.Pap.Am.Chem.Soc.;(1996) 211 Meet., Pt.1, CHED274 DEN: ASCRAL ISSN: 0065-7727 1TH ACS National Meeting, New Orleans, LA, Mar. 24-28, 1996., XP000618488 Boudet A M: “Genes involved in monolignol biosynthesis and their manipulation for tailoring new lignins” see abstract.
- EMBL Sequence Database. REL. 43. Accession No. D46598. Mar. 9, 1995., XP002025776 Sasaki, T., Et Al.: “Rice cDNA, partial sequence (S11367-1A)” see sequence.
- EMBL Sequence Database. REL. 42. Accession No. T41765. Jan. 31, 1995, XP002025777 Newman, T., Et Al.: “10346 Arabidopsis thaliana cDNA clone 67E6T7” see sequence.
- Plant Physiology, vol. 96, 1991, pp. 577-583, XP002025778 Lagrimini, L.M.: “Wound-induced deposition of polyphenols in transgenic plants overexpressing peroxidase” see the entire document.
- Eur. J. Biochem. 139, 259-265(1984) FEBS 1984; Purification and properties of cinnamoyl-CoA reductase and cinnamyl alcohol dehydrogenase from poplar stems ( Populus X euramericana ) Farid Sarni et al.
Type: Grant
Filed: Jul 24, 1998
Date of Patent: Apr 3, 2001
Assignees: Centre National de la Recherche Scientifique (Paris), Institut National de la Recherche Agronomique (Paris)
Inventors: Alain-Michel Boudet (Toulouse), Magalle Pichon (Fourqueveaux), Jacqueline Grima-Pettenati (Fourqueveaux), Michel Beckert (Cournon d'Auvergne), Pascal Gamas (L'Union), Jean-François Briat (St Clement de Riviere)
Primary Examiner: Paula K. Hutzell
Assistant Examiner: Ousama Zaghmout
Attorney, Agent or Law Firm: Nixon & Vanderhye P.C.
Application Number: 09/043,937
International Classification: A01H/100; A01H/900; A01H/500; C12N/1582; C12N/1587;